Cleanup of redefinition testing
Move redefine logic into a single common function and perform some
other cleanup.
Test: mma -j40 test-art-host
Change-Id: I8618bda4f392b683ce198374066e356b87578e7b
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index d1c2293..1ad3f08 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -1142,6 +1142,34 @@
return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
}
+ static jvmtiError RedefineClassDirect(ArtJvmTiEnv* env,
+ jclass klass,
+ jint dex_size,
+ unsigned char* dex_file) {
+ if (!IsValidEnv(env)) {
+ return ERR(INVALID_ENVIRONMENT);
+ }
+ jvmtiError ret = OK;
+ std::string location;
+ if ((ret = GetClassLocation(env, klass, &location)) != OK) {
+ // TODO Do something more here? Maybe give log statements?
+ return ret;
+ }
+ std::string error;
+ ret = Redefiner::RedefineClass(env,
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ klass,
+ location,
+ dex_size,
+ reinterpret_cast<uint8_t*>(dex_file),
+ &error);
+ if (ret != OK) {
+ LOG(ERROR) << "FAILURE TO REDEFINE " << error;
+ }
+ return ret;
+ }
+
// TODO This will be called by the event handler for the art::ti Event Load Event
static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
const std::vector<jclass>& classes,
@@ -1252,7 +1280,10 @@
reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
// nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
- nullptr, // reserved3
+ // SPECIAL FUNCTION: RedefineClassDirect Is normally reserved3
+ // TODO Remove once we have events working.
+ reinterpret_cast<void*>(JvmtiFunctions::RedefineClassDirect),
+ // nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
JvmtiFunctions::SuspendThread,
JvmtiFunctions::ResumeThread,
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f7b8b92..f545125 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -58,6 +58,21 @@
namespace openjdkjvmti {
+jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
+ JNIEnv* jni_env = nullptr;
+ jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
+ if (ret != JNI_OK) {
+ // TODO Different error might be better?
+ return ERR(INTERNAL);
+ }
+ art::ScopedObjectAccess soa(jni_env);
+ art::StackHandleScope<1> hs(art::Thread::Current());
+ art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
+ const art::DexFile& dex = hs_klass->GetDexFile();
+ *location = dex.GetLocation();
+ return OK;
+}
+
// TODO Move this function somewhere more appropriate.
// Gets the data surrounding the given class.
jvmtiError GetTransformationData(ArtJvmTiEnv* env,
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 35b990b..0ad5099 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -41,6 +41,8 @@
namespace openjdkjvmti {
+jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
+
// Gets the data surrounding the given class.
jvmtiError GetTransformationData(ArtJvmTiEnv* env,
jclass klass,
diff --git a/test/902-hello-transformation/expected.txt b/test/902-hello-transformation/expected.txt
index a826f93..4774b81 100644
--- a/test/902-hello-transformation/expected.txt
+++ b/test/902-hello-transformation/expected.txt
@@ -1,3 +1,2 @@
hello
-modifying class 'Transform'
Goodbye
diff --git a/test/902-hello-transformation/run b/test/902-hello-transformation/run
index 3755d1d..94a8b2d 100755
--- a/test/902-hello-transformation/run
+++ b/test/902-hello-transformation/run
@@ -27,12 +27,11 @@
arg="jvm"
else
arg="art"
-fi
-
-if [[ "$@" != *"--debuggable"* ]]; then
- other_args=" -Xcompiler-option --debuggable "
-else
- other_args=""
+ if [[ "$@" != *"--debuggable"* ]]; then
+ other_args=" -Xcompiler-option --debuggable "
+ else
+ other_args=""
+ fi
fi
./default-run "$@" --experimental agents \
diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java
index 204b6e7..ec47119 100644
--- a/test/902-hello-transformation/src/Main.java
+++ b/test/902-hello-transformation/src/Main.java
@@ -14,7 +14,40 @@
* limitations under the License.
*/
+import java.util.Base64;
public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
public static void main(String[] args) {
System.loadLibrary(args[1]);
doTest(new Transform());
@@ -22,10 +55,12 @@
public static void doTest(Transform t) {
t.sayHi();
- doClassTransformation(Transform.class);
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
t.sayHi();
}
// Transforms the class
- private static native void doClassTransformation(Class target);
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
}
diff --git a/test/902-hello-transformation/transform.cc b/test/902-hello-transformation/transform.cc
deleted file mode 100644
index 3369dd4..0000000
--- a/test/902-hello-transformation/transform.cc
+++ /dev/null
@@ -1,153 +0,0 @@
-/*
- * Copyright (C) 2013 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include <iostream>
-#include <pthread.h>
-#include <stdio.h>
-#include <vector>
-
-#include "art_method-inl.h"
-#include "base/logging.h"
-#include "jni.h"
-#include "openjdkjvmti/jvmti.h"
-#include "ti-agent/common_helper.h"
-#include "ti-agent/common_load.h"
-#include "utils.h"
-
-namespace art {
-namespace Test902HelloTransformation {
-
-static bool RuntimeIsJvm = false;
-
-bool IsJVM() {
- return RuntimeIsJvm;
-}
-
-// base64 encoded class/dex file for
-//
-// class Transform {
-// public void sayHi() {
-// System.out.println("Goodbye");
-// }
-// }
-const char* class_file_base64 =
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB"
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA"
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq"
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph"
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG"
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB"
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=";
-
-const char* dex_file_base64 =
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO"
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB"
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA"
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA"
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA"
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA"
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50"
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh"
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291"
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA"
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA"
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA"
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=";
-
-static void JNICALL transformationHook(jvmtiEnv *jvmtienv,
- JNIEnv* jni_env ATTRIBUTE_UNUSED,
- jclass class_being_redefined ATTRIBUTE_UNUSED,
- jobject loader ATTRIBUTE_UNUSED,
- const char* name,
- jobject protection_domain ATTRIBUTE_UNUSED,
- jint class_data_len ATTRIBUTE_UNUSED,
- const unsigned char* class_data ATTRIBUTE_UNUSED,
- jint* new_class_data_len,
- unsigned char** new_class_data) {
- if (strcmp("Transform", name)) {
- return;
- }
- printf("modifying class '%s'\n", name);
- bool is_jvm = IsJVM();
- size_t decode_len = 0;
- unsigned char* new_data;
- std::unique_ptr<uint8_t[]> file_data(
- DecodeBase64((is_jvm) ? class_file_base64 : dex_file_base64, &decode_len));
- jvmtiError ret = JVMTI_ERROR_NONE;
- if ((ret = jvmtienv->Allocate(static_cast<jlong>(decode_len), &new_data)) != JVMTI_ERROR_NONE) {
- printf("Unable to allocate buffer!\n");
- return;
- }
- memcpy(new_data, file_data.get(), decode_len);
- *new_class_data_len = static_cast<jint>(decode_len);
- *new_class_data = new_data;
- return;
-}
-
-using RetransformWithHookFunction = jvmtiError (*)(jvmtiEnv*, jclass, jvmtiEventClassFileLoadHook);
-static void DoClassTransformation(jvmtiEnv* jvmtienv, JNIEnv* jnienv, jclass target) {
- if (IsJVM()) {
- UNUSED(jnienv);
- jvmtienv->SetEventNotificationMode(JVMTI_ENABLE, JVMTI_EVENT_CLASS_FILE_LOAD_HOOK, nullptr);
- jvmtiError ret = jvmtienv->RetransformClasses(1, &target);
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmtienv->GetErrorName(ret, &err);
- printf("Error transforming: %s\n", err);
- }
- } else {
- RetransformWithHookFunction f =
- reinterpret_cast<RetransformWithHookFunction>(jvmtienv->functions->reserved1);
- if (f(jvmtienv, target, transformationHook) != JVMTI_ERROR_NONE) {
- printf("Failed to tranform class!");
- return;
- }
- }
-}
-
-extern "C" JNIEXPORT void JNICALL Java_Main_doClassTransformation(JNIEnv* env,
- jclass,
- jclass target) {
- JavaVM* vm;
- if (env->GetJavaVM(&vm)) {
- printf("Unable to get javaVM!\n");
- return;
- }
- DoClassTransformation(jvmti_env, env, target);
-}
-
-// Don't do anything
-jint OnLoad(JavaVM* vm,
- char* options,
- void* reserved ATTRIBUTE_UNUSED) {
- RuntimeIsJvm = (strcmp("jvm", options) == 0);
- if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
- printf("Unable to get jvmti env!\n");
- return 1;
- }
- SetAllCapabilities(jvmti_env);
- if (IsJVM()) {
- jvmtiEventCallbacks cbs;
- memset(&cbs, 0, sizeof(cbs));
- cbs.ClassFileLoadHook = transformationHook;
- jvmti_env->SetEventCallbacks(&cbs, sizeof(jvmtiEventCallbacks));
- }
- return 0;
-}
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
diff --git a/test/902-hello-transformation/transform.h b/test/902-hello-transformation/transform.h
deleted file mode 100644
index 661058d..0000000
--- a/test/902-hello-transformation/transform.h
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
diff --git a/test/Android.bp b/test/Android.bp
index fe20f29..44c64c1 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -244,8 +244,8 @@
defaults: ["libartagent-defaults"],
srcs: [
"ti-agent/common_load.cc",
+ "ti-agent/common_helper.cc",
"901-hello-ti-agent/basics.cc",
- "902-hello-transformation/transform.cc",
"903-hello-tagging/tagging.cc",
"904-object-allocation/tracking.cc",
"905-object-free/tracking_free.cc",
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
new file mode 100644
index 0000000..3e2b168
--- /dev/null
+++ b/test/ti-agent/common_helper.cc
@@ -0,0 +1,91 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "ti-agent/common_helper.h"
+
+#include <stdio.h>
+
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ti-agent/common_load.h"
+#include "utils.h"
+
+namespace art {
+bool RuntimeIsJVM;
+
+bool IsJVM() {
+ return RuntimeIsJVM;
+}
+
+void SetAllCapabilities(jvmtiEnv* env) {
+ jvmtiCapabilities caps;
+ env->GetPotentialCapabilities(&caps);
+ env->AddCapabilities(&caps);
+}
+
+namespace common_redefine {
+
+using RedefineDirectFunction = jvmtiError (*)(jvmtiEnv*, jclass, jint, const unsigned char*);
+static void DoClassTransformation(jvmtiEnv* jvmti_env, JNIEnv* env,
+ jclass target,
+ jbyteArray class_file_bytes,
+ jbyteArray dex_file_bytes) {
+ jbyteArray desired_array = IsJVM() ? class_file_bytes : dex_file_bytes;
+ jint len = static_cast<jint>(env->GetArrayLength(desired_array));
+ const unsigned char* redef_bytes = reinterpret_cast<const unsigned char*>(
+ env->GetByteArrayElements(desired_array, nullptr));
+ jvmtiError res;
+ if (IsJVM()) {
+ jvmtiClassDefinition def;
+ def.klass = target;
+ def.class_byte_count = static_cast<jint>(len);
+ def.class_bytes = redef_bytes;
+ res = jvmti_env->RedefineClasses(1, &def);
+ } else {
+ RedefineDirectFunction f =
+ reinterpret_cast<RedefineDirectFunction>(jvmti_env->functions->reserved3);
+ res = f(jvmti_env, target, len, redef_bytes);
+ }
+ if (res != JVMTI_ERROR_NONE) {
+ printf("Redefinition failed!");
+ }
+}
+
+// Magic JNI export that classes can use for redefining classes.
+// To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env,
+ jclass,
+ jclass target,
+ jbyteArray class_file_bytes,
+ jbyteArray dex_file_bytes) {
+ DoClassTransformation(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
+}
+
+// Don't do anything
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+ return 0;
+}
+
+} // namespace common_redefine
+
+} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 84997f3..76543fe 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -18,9 +18,19 @@
#define ART_TEST_TI_AGENT_COMMON_HELPER_H_
#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
#include "ScopedLocalRef.h"
namespace art {
+namespace common_redefine {
+
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+
+} // namespace common_redefine
+
+extern bool RuntimeIsJVM;
+
+bool IsJVM();
template <typename T>
static jobjectArray CreateObjectArray(JNIEnv* env,
@@ -53,11 +63,7 @@
return ret.release();
}
-static void SetAllCapabilities(jvmtiEnv* env) {
- jvmtiCapabilities caps;
- env->GetPotentialCapabilities(&caps);
- env->AddCapabilities(&caps);
-}
+void SetAllCapabilities(jvmtiEnv* env);
} // namespace art
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index a959482..2795cbc 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -23,9 +23,9 @@
#include "base/logging.h"
#include "base/macros.h"
#include "common_load.h"
+#include "common_helper.h"
#include "901-hello-ti-agent/basics.h"
-#include "902-hello-transformation/transform.h"
#include "903-hello-tagging/tagging.h"
#include "904-object-allocation/tracking.h"
#include "905-object-free/tracking_free.h"
@@ -54,7 +54,7 @@
// A list of all the agents we have for testing.
AgentLib agents[] = {
{ "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
- { "902-hello-transformation", Test902HelloTransformation::OnLoad, nullptr },
+ { "902-hello-transformation", common_redefine::OnLoad, nullptr },
{ "903-hello-tagging", Test903HelloTagging::OnLoad, nullptr },
{ "904-object-allocation", Test904ObjectAllocation::OnLoad, nullptr },
{ "905-object-free", Test905ObjectFree::OnLoad, nullptr },
@@ -95,6 +95,10 @@
return true;
}
+static void SetIsJVM(char* options) {
+ RuntimeIsJVM = strncmp(options, "jvm", 3) == 0;
+}
+
extern "C" JNIEXPORT jint JNICALL Agent_OnLoad(JavaVM* vm, char* options, void* reserved) {
char* remaining_options = nullptr;
char* name_option = nullptr;
@@ -112,6 +116,7 @@
printf("agent: %s does not include an OnLoad method.\n", name_option);
return -3;
}
+ SetIsJVM(remaining_options);
return lib->load(vm, remaining_options, reserved);
}
@@ -132,6 +137,7 @@
printf("agent: %s does not include an OnAttach method.\n", name_option);
return -3;
}
+ SetIsJVM(remaining_options);
return lib->attach(vm, remaining_options, reserved);
}