Merge "sigchain: switch from __thread to pthread_setspecific."
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 8faaec1..4955562 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -90,8 +90,9 @@
 constexpr uint32_t kReferenceLoadMinFarOffset = 16 * KB;
 
 // Flags controlling the use of link-time generated thunks for Baker read barriers.
-constexpr bool kBakerReadBarrierLinkTimeThunksEnableForFields = true;
-constexpr bool kBakerReadBarrierLinkTimeThunksEnableForGcRoots = true;
+// Not yet implemented for heap poisoning.
+constexpr bool kBakerReadBarrierLinkTimeThunksEnableForFields = !kPoisonHeapReferences;
+constexpr bool kBakerReadBarrierLinkTimeThunksEnableForGcRoots = !kPoisonHeapReferences;
 
 // Some instructions have special requirements for a temporary, for example
 // LoadClass/kBssEntry and LoadString/kBssEntry for Baker read barrier require
diff --git a/compiler/optimizing/loop_optimization.cc b/compiler/optimizing/loop_optimization.cc
index 4710b32..8e88c1e 100644
--- a/compiler/optimizing/loop_optimization.cc
+++ b/compiler/optimizing/loop_optimization.cc
@@ -1082,7 +1082,10 @@
     HInstruction* s = block->GetFirstInstruction();
     if (s != nullptr && s->IsSuspendCheck()) {
       HInstruction* c = s->GetNext();
-      if (c != nullptr && c->IsCondition() && c->GetUses().HasExactlyOneElement()) {
+      if (c != nullptr &&
+          c->IsCondition() &&
+          c->GetUses().HasExactlyOneElement() &&  // only used for termination
+          !c->HasEnvironmentUses()) {  // unlikely, but not impossible
         HInstruction* i = c->GetNext();
         if (i != nullptr && i->IsIf() && i->InputAt(0) == c) {
           iset_->insert(c);
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index b4ea20b..81566c4 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -2931,7 +2931,7 @@
   // time (bug 10645725) unless we're a debug build or running on valgrind. Note: The Dex2Oat class
   // should not destruct the runtime in this case.
   if (!art::kIsDebugBuild && (RUNNING_ON_MEMORY_TOOL == 0)) {
-    exit(result);
+    _exit(result);
   }
   return result;
 }
diff --git a/dexlayout/Android.bp b/dexlayout/Android.bp
index e26d051..4b65c52 100644
--- a/dexlayout/Android.bp
+++ b/dexlayout/Android.bp
@@ -14,6 +14,7 @@
 
 art_cc_defaults {
     name: "libart-dexlayout-defaults",
+    defaults: ["art_defaults"],
     host_supported: true,
     srcs: [
         "dexlayout.cc",
diff --git a/dexlayout/dex_ir.cc b/dexlayout/dex_ir.cc
index 4905b5c..6bd9da8 100644
--- a/dexlayout/dex_ir.cc
+++ b/dexlayout/dex_ir.cc
@@ -496,8 +496,8 @@
       dex_file.GetClassAnnotationSet(disk_annotations_item);
   AnnotationSetItem* class_annotation = nullptr;
   if (class_set_item != nullptr) {
-    uint32_t offset = disk_annotations_item->class_annotations_off_;
-    class_annotation = CreateAnnotationSetItem(dex_file, class_set_item, offset);
+    uint32_t item_offset = disk_annotations_item->class_annotations_off_;
+    class_annotation = CreateAnnotationSetItem(dex_file, class_set_item, item_offset);
   }
   const DexFile::FieldAnnotationsItem* fields =
       dex_file.GetFieldAnnotations(disk_annotations_item);
@@ -784,7 +784,7 @@
   std::function<uint32_t(const dex_ir::Collections&)> offset_fn;
 };
 
-static const std::vector<FileSectionDescriptor> kFileSectionDescriptors = {
+static const FileSectionDescriptor kFileSectionDescriptors[] = {
   {
     "Header",
     DexFile::kDexTypeHeaderItem,
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index 0536f322..344d735 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -393,6 +393,7 @@
       index = dec_insn->VRegB();
       secondary_index = dec_insn->VRegH();
       width = 4;
+      break;
     default:
       break;
   }  // switch
@@ -1816,7 +1817,15 @@
       output_location += "/" + dex_file_location + ".new";
     }
     new_file.reset(OS::CreateEmptyFile(output_location.c_str()));
-    ftruncate(new_file->Fd(), header_->FileSize());
+    if (new_file == nullptr) {
+      LOG(ERROR) << "Could not create dex writer output file: " << output_location;
+      return;
+    }
+    if (ftruncate(new_file->Fd(), header_->FileSize()) != 0) {
+      LOG(ERROR) << "Could not grow dex writer output file: " << output_location;;
+      new_file->Erase();
+      return;
+    }
     mem_map_.reset(MemMap::MapFile(header_->FileSize(), PROT_READ | PROT_WRITE, MAP_SHARED,
         new_file->Fd(), 0, /*low_4gb*/ false, output_location.c_str(), &error_msg));
   } else {
@@ -1825,7 +1834,7 @@
   }
   if (mem_map_ == nullptr) {
     LOG(ERROR) << "Could not create mem map for dex writer output: " << error_msg;
-    if (new_file.get() != nullptr) {
+    if (new_file != nullptr) {
       new_file->Erase();
     }
     return;
diff --git a/runtime/dex_file-inl.h b/runtime/dex_file-inl.h
index e884e39..41db4d8 100644
--- a/runtime/dex_file-inl.h
+++ b/runtime/dex_file-inl.h
@@ -59,11 +59,17 @@
 }
 
 inline const char* DexFile::StringByTypeIdx(dex::TypeIndex idx, uint32_t* unicode_length) const {
+  if (!idx.IsValid()) {
+    return nullptr;
+  }
   const TypeId& type_id = GetTypeId(idx);
   return StringDataAndUtf16LengthByIdx(type_id.descriptor_idx_, unicode_length);
 }
 
 inline const char* DexFile::StringByTypeIdx(dex::TypeIndex idx) const {
+  if (!idx.IsValid()) {
+    return nullptr;
+  }
   const TypeId& type_id = GetTypeId(idx);
   return StringDataByIdx(type_id.descriptor_idx_);
 }
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index 85100ae..688f95b 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -590,6 +590,10 @@
 
 void DexFile::InitializeSectionsFromMapList() {
   const MapList* map_list = reinterpret_cast<const MapList*>(begin_ + header_->map_off_);
+  if (header_->map_off_ == 0 || header_->map_off_ > size_) {
+    // Bad offset. The dex file verifier runs after this method and will reject the file.
+    return;
+  }
   const size_t count = map_list->size_;
 
   size_t map_limit = header_->map_off_ + count * sizeof(MapItem);
diff --git a/runtime/dex_file_test.cc b/runtime/dex_file_test.cc
index 9131715..f811287 100644
--- a/runtime/dex_file_test.cc
+++ b/runtime/dex_file_test.cc
@@ -161,6 +161,16 @@
   "ACACAAALABgAAAAAAAAAAACgge4CAABjbGFzc2VzLmRleFVUBQADAWPlV3V4CwABBOQDAQAEiBMA"
   "AFBLBQYAAAAAAwADAPUAAABkBAAAAAA=";
 
+static const char kRawDexBadMapOffset[] =
+  "ZGV4CjAzNQAZKGSz85r+tXJ1I24FYi+FpQtWbXtelAmoAQAAcAAAAHhWNBIAAAAAAAAAAEAwIBAF"
+  "AAAAcAAAAAMAAACEAAAAAQAAAJAAAAAAAAAAAAAAAAIAAACcAAAAAQAAAKwAAADcAAAAzAAAAOQA"
+  "AADsAAAA9AAAAPkAAAANAQAAAgAAAAMAAAAEAAAABAAAAAIAAAAAAAAAAAAAAAAAAAABAAAAAAAA"
+  "AAAAAAABAAAAAQAAAAAAAAABAAAAAAAAABUBAAAAAAAAAQABAAEAAAAQAQAABAAAAHAQAQAAAA4A"
+  "Bjxpbml0PgAGQS5qYXZhAANMQTsAEkxqYXZhL2xhbmcvT2JqZWN0OwABVgABAAcOAAAAAQAAgYAE"
+  "zAEACwAAAAAAAAABAAAAAAAAAAEAAAAFAAAAcAAAAAIAAAADAAAAhAAAAAMAAAABAAAAkAAAAAUA"
+  "AAACAAAAnAAAAAYAAAABAAAArAAAAAEgAAABAAAAzAAAAAIgAAAFAAAA5AAAAAMgAAABAAAAEAEA"
+  "AAAgAAABAAAAFQEAAAAQAAABAAAAIAEAAA==";
+
 static void DecodeAndWriteDexFile(const char* base64, const char* location) {
   // decode base64
   CHECK(base64 != nullptr);
@@ -212,7 +222,8 @@
 
 static std::unique_ptr<const DexFile> OpenDexFileInMemoryBase64(const char* base64,
                                                                 const char* location,
-                                                                uint32_t location_checksum) {
+                                                                uint32_t location_checksum,
+                                                                bool expect_success) {
   CHECK(base64 != nullptr);
   std::vector<uint8_t> dex_bytes = DecodeBase64Vec(base64);
   CHECK_NE(dex_bytes.size(), 0u);
@@ -232,7 +243,11 @@
                                                         /* verify */ true,
                                                         /* verify_checksum */ true,
                                                         &error_message));
-  CHECK(dex_file != nullptr) << error_message;
+  if (expect_success) {
+    CHECK(dex_file != nullptr) << error_message;
+  } else {
+    CHECK(dex_file == nullptr) << "Expected dex file open to fail.";
+  }
   return dex_file;
 }
 
@@ -282,7 +297,7 @@
 TEST_F(DexFileTest, HeaderInMemory) {
   ScratchFile tmp;
   std::unique_ptr<const DexFile> raw =
-      OpenDexFileInMemoryBase64(kRawDex, tmp.GetFilename().c_str(), 0x00d87910U);
+      OpenDexFileInMemoryBase64(kRawDex, tmp.GetFilename().c_str(), 0x00d87910U, true);
   ValidateDexFileHeader(std::move(raw));
 }
 
@@ -569,4 +584,18 @@
   EXPECT_EQ(dex_files.size(), 3u);
 }
 
+TEST_F(DexFileTest, OpenDexBadMapOffset) {
+  ScratchFile tmp;
+  std::unique_ptr<const DexFile> raw =
+      OpenDexFileInMemoryBase64(kRawDexBadMapOffset, tmp.GetFilename().c_str(), 0xb3642819U, false);
+  EXPECT_EQ(raw, nullptr);
+}
+
+TEST_F(DexFileTest, GetStringWithNoIndex) {
+  ScratchFile tmp;
+  std::unique_ptr<const DexFile> raw(OpenDexFileBase64(kRawDex, tmp.GetFilename().c_str()));
+  dex::TypeIndex idx;
+  EXPECT_EQ(raw->StringByTypeIdx(idx), nullptr);
+}
+
 }  // namespace art
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 24ba52f..bcf5008 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -1108,7 +1108,9 @@
     space::RegionSpace* region_space = collector->RegionSpace();
     CHECK(!region_space->IsInFromSpace(obj)) << "Scanning object " << obj << " in from space";
     VerifyNoFromSpaceRefsFieldVisitor visitor(collector);
-    obj->VisitReferences(visitor, visitor);
+    obj->VisitReferences</*kVisitNativeRoots*/true, kDefaultVerifyFlags, kWithoutReadBarrier>(
+        visitor,
+        visitor);
     if (kUseBakerReadBarrier) {
       CHECK_EQ(obj->GetReadBarrierState(), ReadBarrier::WhiteState())
           << "obj=" << obj << " non-white rb_state " << obj->GetReadBarrierState();
@@ -1232,7 +1234,9 @@
     CHECK(!region_space->IsInFromSpace(obj)) << "Scanning object " << obj << " in from space";
     collector->AssertToSpaceInvariant(nullptr, MemberOffset(0), obj);
     AssertToSpaceInvariantFieldVisitor visitor(collector);
-    obj->VisitReferences(visitor, visitor);
+    obj->VisitReferences</*kVisitNativeRoots*/true, kDefaultVerifyFlags, kWithoutReadBarrier>(
+        visitor,
+        visitor);
   }
 
  private:
@@ -1471,8 +1475,7 @@
     // Add to the live bytes per unevacuated from space. Note this code is always run by the
     // GC-running thread (no synchronization required).
     DCHECK(region_space_bitmap_->Test(to_ref));
-    // Disable the read barrier in SizeOf for performance, which is safe.
-    size_t obj_size = to_ref->SizeOf<kDefaultVerifyFlags, kWithoutReadBarrier>();
+    size_t obj_size = to_ref->SizeOf<kDefaultVerifyFlags>();
     size_t alloc_size = RoundUp(obj_size, space::RegionSpace::kAlignment);
     region_space_->AddLiveBytes(to_ref, alloc_size);
   }
@@ -1714,16 +1717,19 @@
 }
 
 // Assert the to-space invariant.
-void ConcurrentCopying::AssertToSpaceInvariant(mirror::Object* obj, MemberOffset offset,
+void ConcurrentCopying::AssertToSpaceInvariant(mirror::Object* obj,
+                                               MemberOffset offset,
                                                mirror::Object* ref) {
-  CHECK(heap_->collector_type_ == kCollectorTypeCC) << static_cast<size_t>(heap_->collector_type_);
+  CHECK_EQ(heap_->collector_type_, kCollectorTypeCC);
   if (is_asserting_to_space_invariant_) {
-    if (region_space_->IsInToSpace(ref)) {
+    using RegionType = space::RegionSpace::RegionType;
+    space::RegionSpace::RegionType type = region_space_->GetRegionType(ref);
+    if (type == RegionType::kRegionTypeToSpace) {
       // OK.
       return;
-    } else if (region_space_->IsInUnevacFromSpace(ref)) {
+    } else if (type == RegionType::kRegionTypeUnevacFromSpace) {
       CHECK(IsMarkedInUnevacFromSpace(ref)) << ref;
-    } else if (region_space_->IsInFromSpace(ref)) {
+    } else if (UNLIKELY(type == RegionType::kRegionTypeFromSpace)) {
       // Not OK. Do extra logging.
       if (obj != nullptr) {
         LogFromSpaceRefHolder(obj, offset);
@@ -1888,10 +1894,10 @@
   explicit RefFieldsVisitor(ConcurrentCopying* collector)
       : collector_(collector) {}
 
-  void operator()(ObjPtr<mirror::Object> obj, MemberOffset offset, bool /* is_static */)
+  void operator()(mirror::Object* obj, MemberOffset offset, bool /* is_static */)
       const ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_)
       REQUIRES_SHARED(Locks::heap_bitmap_lock_) {
-    collector_->Process(obj.Ptr(), offset);
+    collector_->Process(obj, offset);
   }
 
   void operator()(ObjPtr<mirror::Class> klass, ObjPtr<mirror::Reference> ref) const
@@ -2064,7 +2070,7 @@
     AssertToSpaceInvariant(nullptr, MemberOffset(0), java_lang_Object.Ptr());
     CHECK_EQ(byte_size, (java_lang_Object->GetObjectSize<kVerifyNone, kWithoutReadBarrier>()));
     dummy_obj->SetClass(java_lang_Object.Ptr());
-    CHECK_EQ(byte_size, (dummy_obj->SizeOf<kVerifyNone, kWithoutReadBarrier>()));
+    CHECK_EQ(byte_size, (dummy_obj->SizeOf<kVerifyNone>()));
   } else {
     // Use an int array.
     dummy_obj->SetClass(int_array_class);
@@ -2075,7 +2081,7 @@
     CHECK_EQ(dummy_arr->GetLength(), length)
         << "byte_size=" << byte_size << " length=" << length
         << " component_size=" << component_size << " data_offset=" << data_offset;
-    CHECK_EQ(byte_size, (dummy_obj->SizeOf<kVerifyNone, kWithoutReadBarrier>()))
+    CHECK_EQ(byte_size, (dummy_obj->SizeOf<kVerifyNone>()))
         << "byte_size=" << byte_size << " length=" << length
         << " component_size=" << component_size << " data_offset=" << data_offset;
   }
@@ -2142,10 +2148,10 @@
 
 mirror::Object* ConcurrentCopying::Copy(mirror::Object* from_ref) {
   DCHECK(region_space_->IsInFromSpace(from_ref));
-  // No read barrier to avoid nested RB that might violate the to-space
-  // invariant. Note that from_ref is a from space ref so the SizeOf()
-  // call will access the from-space meta objects, but it's ok and necessary.
-  size_t obj_size = from_ref->SizeOf<kDefaultVerifyFlags, kWithoutReadBarrier>();
+  // There must not be a read barrier to avoid nested RB that might violate the to-space invariant.
+  // Note that from_ref is a from space ref so the SizeOf() call will access the from-space meta
+  // objects, but it's ok and necessary.
+  size_t obj_size = from_ref->SizeOf<kDefaultVerifyFlags>();
   size_t region_space_alloc_size = RoundUp(obj_size, space::RegionSpace::kAlignment);
   size_t region_space_bytes_allocated = 0U;
   size_t non_moving_space_bytes_allocated = 0U;
diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc
index 357541f..a853b98 100644
--- a/runtime/gc/heap.cc
+++ b/runtime/gc/heap.cc
@@ -2337,9 +2337,7 @@
     size_t bin_size = object_addr - context->prev_;
     // Add the bin consisting of the end of the previous object to the start of the current object.
     collector->AddBin(bin_size, context->prev_);
-    // Turn off read barrier. ZygoteCompactingCollector doesn't use it (even in the CC build.)
-    context->prev_ = object_addr + RoundUp(obj->SizeOf<kDefaultVerifyFlags, kWithoutReadBarrier>(),
-                                           kObjectAlignment);
+    context->prev_ = object_addr + RoundUp(obj->SizeOf<kDefaultVerifyFlags>(), kObjectAlignment);
   }
 
   void AddBin(size_t size, uintptr_t position) {
@@ -2359,8 +2357,7 @@
 
   virtual mirror::Object* MarkNonForwardedObject(mirror::Object* obj)
       REQUIRES(Locks::heap_bitmap_lock_, Locks::mutator_lock_) {
-    // Turn off read barrier. ZygoteCompactingCollector doesn't use it (even in the CC build.)
-    size_t obj_size = obj->SizeOf<kDefaultVerifyFlags, kWithoutReadBarrier>();
+    size_t obj_size = obj->SizeOf<kDefaultVerifyFlags>();
     size_t alloc_size = RoundUp(obj_size, kObjectAlignment);
     mirror::Object* forward_address;
     // Find the smallest bin which we can move obj in.
diff --git a/runtime/mirror/object-inl.h b/runtime/mirror/object-inl.h
index 811f1ea..f83645e 100644
--- a/runtime/mirror/object-inl.h
+++ b/runtime/mirror/object-inl.h
@@ -513,8 +513,11 @@
   return GetClass<kVerifyFlags>()->IsPhantomReferenceClass();
 }
 
-template<VerifyObjectFlags kVerifyFlags, ReadBarrierOption kReadBarrierOption>
+template<VerifyObjectFlags kVerifyFlags>
 inline size_t Object::SizeOf() {
+  // Read barrier is never required for SizeOf since objects sizes are constant. Reading from-space
+  // values is OK because of that.
+  static constexpr ReadBarrierOption kReadBarrierOption = kWithoutReadBarrier;
   size_t result;
   constexpr auto kNewFlags = static_cast<VerifyObjectFlags>(kVerifyFlags & ~kVerifyThis);
   if (IsArrayInstance<kVerifyFlags, kReadBarrierOption>()) {
diff --git a/runtime/mirror/object.h b/runtime/mirror/object.h
index f7ab26d..417a22d 100644
--- a/runtime/mirror/object.h
+++ b/runtime/mirror/object.h
@@ -128,8 +128,7 @@
   template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
   ALWAYS_INLINE bool InstanceOf(ObjPtr<Class> klass) REQUIRES_SHARED(Locks::mutator_lock_);
 
-  template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags,
-           ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
+  template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
   size_t SizeOf() REQUIRES_SHARED(Locks::mutator_lock_);
 
   Object* Clone(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_)
diff --git a/runtime/openjdkjvmti/ti_heap.cc b/runtime/openjdkjvmti/ti_heap.cc
index 49d9aca..7fc5104 100644
--- a/runtime/openjdkjvmti/ti_heap.cc
+++ b/runtime/openjdkjvmti/ti_heap.cc
@@ -888,8 +888,8 @@
       bool add_to_worklist = ReportRoot(root_obj, info);
       // We use visited_ to mark roots already so we do not need another set.
       if (visited_->find(root_obj) == visited_->end()) {
-        visited_->insert(root_obj);
         if (add_to_worklist) {
+          visited_->insert(root_obj);
           worklist_->push_back(root_obj);
         }
       }
diff --git a/runtime/parsed_options.cc b/runtime/parsed_options.cc
index 0784e59..8ffd8bb 100644
--- a/runtime/parsed_options.cc
+++ b/runtime/parsed_options.cc
@@ -476,7 +476,10 @@
     Usage(nullptr);
     return false;
   } else if (args.Exists(M::ShowVersion)) {
-    UsageMessage(stdout, "ART version %s\n", Runtime::GetVersion());
+    UsageMessage(stdout,
+                 "ART version %s %s\n",
+                 Runtime::GetVersion(),
+                 GetInstructionSetString(kRuntimeISA));
     Exit(0);
   } else if (args.Exists(M::BootClassPath)) {
     LOG(INFO) << "setting boot class path to " << *args.Get(M::BootClassPath);
diff --git a/runtime/read_barrier-inl.h b/runtime/read_barrier-inl.h
index 2b38b2e..c102fb0 100644
--- a/runtime/read_barrier-inl.h
+++ b/runtime/read_barrier-inl.h
@@ -28,12 +28,15 @@
 
 namespace art {
 
+// Disabled for performance reasons.
+static constexpr bool kCheckDebugDisallowReadBarrierCount = false;
+
 template <typename MirrorType, ReadBarrierOption kReadBarrierOption, bool kAlwaysUpdateField>
 inline MirrorType* ReadBarrier::Barrier(
     mirror::Object* obj, MemberOffset offset, mirror::HeapReference<MirrorType>* ref_addr) {
   constexpr bool with_read_barrier = kReadBarrierOption == kWithReadBarrier;
   if (kUseReadBarrier && with_read_barrier) {
-    if (kIsDebugBuild) {
+    if (kCheckDebugDisallowReadBarrierCount) {
       Thread* const self = Thread::Current();
       if (self != nullptr) {
         CHECK_EQ(self->GetDebugDisallowReadBarrierCount(), 0u);
diff --git a/runtime/stack.cc b/runtime/stack.cc
index 333128b..5c6eead 100644
--- a/runtime/stack.cc
+++ b/runtime/stack.cc
@@ -913,7 +913,9 @@
               << " next=" << *cur_quick_frame_;
         }
 
-        cur_depth_++;
+        if (kCount == CountTransitions::kYes || !method->IsRuntimeMethod()) {
+          cur_depth_++;
+        }
         method = *cur_quick_frame_;
       }
     } else if (cur_shadow_frame_ != nullptr) {
diff --git a/test/623-checker-loop-regressions/src/Main.java b/test/623-checker-loop-regressions/src/Main.java
index f0b3278..2b30986 100644
--- a/test/623-checker-loop-regressions/src/Main.java
+++ b/test/623-checker-loop-regressions/src/Main.java
@@ -288,6 +288,28 @@
     }
   }
 
+  // A strange function that does not inline.
+  private static void $noinline$foo(boolean x, int n) {
+    if (n < 0)
+      throw new Error("oh no");
+    if (n > 100) {
+      $noinline$foo(!x, n - 1);
+      $noinline$foo(!x, n - 2);
+      $noinline$foo(!x, n - 3);
+      $noinline$foo(!x, n - 4);
+    }
+  }
+
+  // A loop with environment uses of x (the terminating condition). As exposed by bug
+  // b/37247891, the loop can be unrolled, but should handle the (unlikely, but clearly
+  // not impossible) environment uses of the terminating condition in a correct manner.
+  private static void envUsesInCond() {
+    boolean x = false;
+    for (int i = 0; !(x = i >= 1); i++) {
+      $noinline$foo(true, i);
+    }
+  }
+
   public static void main(String[] args) {
     expectEquals(10, earlyExitFirst(-1));
     for (int i = 0; i <= 10; i++) {
@@ -369,6 +391,8 @@
       expectEquals(aa[i], bb.charAt(i));
     }
 
+    envUsesInCond();
+
     System.out.println("passed");
   }
 
diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java
index ed8a500..af49cb4 100644
--- a/test/902-hello-transformation/src/Main.java
+++ b/test/902-hello-transformation/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,53 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
-    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test902.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi();
-    doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    t.sayHi();
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/902-hello-transformation/src/Transform.java b/test/902-hello-transformation/src/Transform.java
deleted file mode 100644
index 8e8af35..0000000
--- a/test/902-hello-transformation/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/902-hello-transformation/src/art/Redefinition.java b/test/902-hello-transformation/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/902-hello-transformation/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/902-hello-transformation/src/art/Test902.java b/test/902-hello-transformation/src/art/Test902.java
new file mode 100644
index 0000000..e95558f
--- /dev/null
+++ b/test/902-hello-transformation/src/art/Test902.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test902 {
+
+  static class Transform {
+    public void sayHi() {
+      // Use lower 'h' to make sure the string will have a different string id
+      // than the transformation (the transformation code is the same except
+      // the actual printed String, which was making the test inacurately passing
+      // in JIT mode when loading the string from the dex cache, as the string ids
+      // of the two different strings were the same).
+      // We know the string ids will be different because lexicographically:
+      // "Goodbye" < "LTransform;" < "hello".
+      System.out.println("hello");
+    }
+  }
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTAyLmphdmEMAAcA" +
+    "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MDIkVHJhbnNmb3JtAQAJ" +
+    "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+    "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+    "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTAyACAABQAGAAAA" +
+    "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAJQABAAsACAABAAkA" +
+    "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAnAAgAKAACAAwAAAACAA0AFwAAAAoA" +
+    "AQAFABQAFgAI");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCpghS3AAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+    "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+    "TGFydC9UZXN0OTAyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkwMjsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+    "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+    "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+    "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTAyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+    "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAlAAcOACcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    t.sayHi();
+  }
+}
diff --git a/test/913-heaps/expected.txt b/test/913-heaps/expected.txt
index 2a183ee..702b247 100644
--- a/test/913-heaps/expected.txt
+++ b/test/913-heaps/expected.txt
@@ -1,9 +1,10 @@
 ---
 true true
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -14,11 +15,13 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -31,20 +34,24 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 root@root --(jni-global)--> 1@1000 [size=16, length=-1]
 root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
 root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -55,11 +62,13 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -72,43 +81,48 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 ---
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 ---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 ---
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 ---
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 ---
 root@root --(jni-global)--> 1@1000 [size=16, length=-1]
 root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
 root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 ---
 [1@0 (32, 'HelloWorld'), 2@0 (16, '')]
 2
@@ -148,16 +162,17 @@
 10008
 --- klass ---
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 root@root --(jni-global)--> 1@1000 [size=16, length=-1]
 root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
@@ -167,13 +182,15 @@
 root@root --(thread)--> 1@1000 [size=16, length=-1]
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 --- heap_filter ---
 ---- tagged objects
@@ -182,10 +199,11 @@
 ---
 ---
 ---- untagged objects
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -196,11 +214,13 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -213,20 +233,24 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 root@root --(jni-global)--> 1@1000 [size=16, length=-1]
 root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=13,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 10])--> 1@1000 [size=16, length=-1]
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=4,location= 19])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
 root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -237,11 +261,13 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -254,16 +280,20 @@
 2@1000 --(class)--> 1000@0 [size=123, length=-1]
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 ---- tagged classes
-root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -273,6 +303,7 @@
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -284,9 +315,12 @@
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
-root@root --(thread)--> 3000@0 [size=132, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 3000@0 [size=136, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=5,method=run,vreg=2,location= 0])--> 3000@0 [size=136, length=-1]
+root@root --(thread)--> 3000@0 [size=136, length=-1]
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
 1002@0 --(interface)--> 2001@0 [size=124, length=-1]
 1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
@@ -296,6 +330,7 @@
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
@@ -307,24 +342,26 @@
 3@1001 --(class)--> 1001@0 [size=123, length=-1]
 4@1000 --(class)--> 1000@0 [size=123, length=-1]
 5@1002 --(class)--> 1002@0 [size=123, length=-1]
+5@1002 --(field@8)--> 500@0 [size=20, length=2]
 6@1000 --(class)--> 1000@0 [size=123, length=-1]
 ---
 ---- untagged classes
 root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=13,location= 32])--> 1@1000 [size=16, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 root@root --(jni-global)--> 1@1000 [size=16, length=-1]
 root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
@@ -335,14 +372,16 @@
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
 1@1000 --(field@2)--> 2@1000 [size=16, length=-1]
 1@1000 --(field@3)--> 3@1001 [size=24, length=-1]
 3@1001 --(field@4)--> 4@1000 [size=16, length=-1]
-3@1001 --(field@5)--> 5@1002 [size=32, length=-1]
-5@1002 --(field@8)--> 6@1000 [size=16, length=-1]
-5@1002 --(field@9)--> 1@1000 [size=16, length=-1]
+3@1001 --(field@5)--> 5@1002 [size=36, length=-1]
+500@0 --(array-element@1)--> 2@1000 [size=16, length=-1]
+5@1002 --(field@10)--> 1@1000 [size=16, length=-1]
+5@1002 --(field@9)--> 6@1000 [size=16, length=-1]
 ---
diff --git a/test/913-heaps/heaps.cc b/test/913-heaps/heaps.cc
index 6a06b29..19e12ae 100644
--- a/test/913-heaps/heaps.cc
+++ b/test/913-heaps/heaps.cc
@@ -19,40 +19,35 @@
 #include <string.h>
 
 #include <iostream>
+#include <sstream>
 #include <vector>
 
 #include "android-base/macros.h"
 #include "android-base/logging.h"
 #include "android-base/stringprintf.h"
 
-#include "jit/jit.h"
 #include "jni.h"
-#include "native_stack_dump.h"
 #include "jvmti.h"
-#include "runtime.h"
-#include "scoped_thread_state_change-inl.h"
-#include "thread-inl.h"
-#include "thread_list.h"
 
 // Test infrastructure
 #include "jni_helper.h"
 #include "jvmti_helper.h"
 #include "test_env.h"
+#include "ti_utf.h"
 
 namespace art {
 namespace Test913Heaps {
 
 using android::base::StringPrintf;
 
+#define FINAL final
+#define OVERRIDE override
+#define UNREACHABLE  __builtin_unreachable
+
 extern "C" JNIEXPORT void JNICALL Java_art_Test913_forceGarbageCollection(
-    JNIEnv* env ATTRIBUTE_UNUSED, jclass klass ATTRIBUTE_UNUSED) {
+    JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
   jvmtiError ret = jvmti_env->ForceGarbageCollection();
-  if (ret != JVMTI_ERROR_NONE) {
-    char* err;
-    jvmti_env->GetErrorName(ret, &err);
-    printf("Error forcing a garbage collection: %s\n", err);
-    jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
-  }
+  JvmtiErrorToException(env, jvmti_env, ret);
 }
 
 class IterationConfig {
@@ -92,7 +87,8 @@
                         user_data);
 }
 
-static bool Run(jint heap_filter,
+static bool Run(JNIEnv* env,
+                jint heap_filter,
                 jclass klass_filter,
                 jobject initial_object,
                 IterationConfig* config) {
@@ -105,14 +101,7 @@
                                                initial_object,
                                                &callbacks,
                                                config);
-  if (ret != JVMTI_ERROR_NONE) {
-    char* err;
-    jvmti_env->GetErrorName(ret, &err);
-    printf("Failure running FollowReferences: %s\n", err);
-    jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(err));
-    return false;
-  }
-  return true;
+  return !JvmtiErrorToException(env, jvmti_env, ret);
 }
 
 extern "C" JNIEXPORT jobjectArray JNICALL Java_art_Test913_followReferences(
@@ -142,6 +131,27 @@
                 jint length,
                 void* user_data ATTRIBUTE_UNUSED) OVERRIDE {
       jlong tag = *tag_ptr;
+
+      // Ignore any jni-global roots with untagged classes. These can be from the environment,
+      // or the JIT.
+      if (reference_kind == JVMTI_HEAP_REFERENCE_JNI_GLOBAL && class_tag == 0) {
+        return 0;
+      }
+      // Ignore classes (1000-1002@0) for thread objects. These can be held by the JIT.
+      if (reference_kind == JVMTI_HEAP_REFERENCE_THREAD && class_tag == 0 &&
+              (1000 <= *tag_ptr &&  *tag_ptr <= 1002)) {
+        return 0;
+      }
+      // Ignore stack-locals of untagged threads. That is the environment.
+      if (reference_kind == JVMTI_HEAP_REFERENCE_STACK_LOCAL &&
+          reference_info->stack_local.thread_tag != 3000) {
+        return 0;
+      }
+      // Ignore array elements with an untagged source. These are from the environment.
+      if (reference_kind == JVMTI_HEAP_REFERENCE_ARRAY_ELEMENT && *referrer_tag_ptr == 0) {
+        return 0;
+      }
+
       // Only check tagged objects.
       if (tag == 0) {
         return JVMTI_VISIT_OBJECTS;
@@ -201,10 +211,6 @@
                                   reference_info,
                                   adapted_size,
                                   length));
-
-      if (reference_kind == JVMTI_HEAP_REFERENCE_THREAD && *tag_ptr == 1000) {
-        DumpStacks();
-      }
     }
 
     std::vector<std::string> GetLines() const {
@@ -259,9 +265,15 @@
         if (info_.jni_local.method != nullptr) {
           jvmti_env->GetMethodName(info_.jni_local.method, &name, nullptr, nullptr);
         }
+        // Normalize the thread id, as this depends on the number of other threads
+        // and which thread is running the test. Should be:
+        //   jlong thread_id = info_.jni_local.thread_id;
+        // TODO: A pre-pass before the test should be able fetch this number, so it can
+        //       be compared explicitly.
+        jlong thread_id = 1;
         std::string ret = StringPrintf("jni-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
                                        "method=%s]",
-                                       info_.jni_local.thread_id,
+                                       thread_id,
                                        info_.jni_local.thread_tag,
                                        info_.jni_local.depth,
                                        name == nullptr ? "<null>" : name);
@@ -284,13 +296,12 @@
                         jlong size,
                         jint length,
                         const jvmtiHeapReferenceInfo* reference_info)
-          REQUIRES_SHARED(Locks::mutator_lock_)
           : Elem(referrer, referree, size, length) {
         memcpy(&info_, reference_info, sizeof(jvmtiHeapReferenceInfo));
-        // Debug stack trace for failure condition. Remove when done.
-        if (info_.stack_local.depth == 3 && info_.stack_local.slot == 13) {
-          DumpNativeStack(std::cerr, GetTid());
-          Thread::Current()->DumpJavaStack(std::cerr, false, false);
+
+        // Debug code. Try to figure out where bad depth is coming from.
+        if (reference_info->stack_local.depth == 6) {
+          LOG(FATAL) << "Unexpected depth of 6";
         }
       }
 
@@ -300,9 +311,15 @@
         if (info_.stack_local.method != nullptr) {
           jvmti_env->GetMethodName(info_.stack_local.method, &name, nullptr, nullptr);
         }
+        // Normalize the thread id, as this depends on the number of other threads
+        // and which thread is running the test. Should be:
+        //   jlong thread_id = info_.stack_local.thread_id;
+        // TODO: A pre-pass before the test should be able fetch this number, so it can
+        //       be compared explicitly.
+        jlong thread_id = 1;
         std::string ret = StringPrintf("stack-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
                                        "method=%s,vreg=%d,location=% " PRId64 "]",
-                                       info_.stack_local.thread_id,
+                                       thread_id,
                                        info_.stack_local.thread_tag,
                                        info_.stack_local.depth,
                                        name == nullptr ? "<null>" : name,
@@ -361,7 +378,13 @@
                                                         tmp));
         }
         case JVMTI_HEAP_REFERENCE_ARRAY_ELEMENT: {
-          std::string tmp = StringPrintf("array-element@%d", reference_info->array.index);
+          jint index = reference_info->array.index;
+          // Normalize if it's "0@0" -> "3000@1".
+          // TODO: A pre-pass could probably give us this index to check explicitly.
+          if (referrer == "0@0" && referree == "3000@0") {
+            index = 0;
+          }
+          std::string tmp = StringPrintf("array-element@%d", index);
           return std::unique_ptr<Elem>(new StringElement(referrer,
                                                          referree,
                                                          size,
@@ -459,16 +482,6 @@
       UNREACHABLE();
     }
 
-    static void DumpStacks() NO_THREAD_SAFETY_ANALYSIS {
-      auto dump_function = [](art::Thread* t, void* data ATTRIBUTE_UNUSED) {
-        std::string name;
-        t->GetThreadName(name);
-        LOG(ERROR) << name;
-        art::DumpNativeStack(LOG_STREAM(ERROR), t->GetTid());
-      };
-      art::Runtime::Current()->GetThreadList()->ForEach(dump_function, nullptr);
-    }
-
     jint counter_;
     const jint stop_after_;
     const jint follow_set_;
@@ -476,8 +489,6 @@
     std::vector<std::unique_ptr<Elem>> lines_;
   };
 
-  jit::ScopedJitSuspend sjs;  // Wait to avoid JIT influence (e.g., JNI globals).
-
   // If jniRef isn't null, add a local and a global ref.
   ScopedLocalRef<jobject> jni_local_ref(env, nullptr);
   jobject jni_global_ref = nullptr;
@@ -487,7 +498,9 @@
   }
 
   PrintIterationConfig config(stop_after, follow_set);
-  Run(heap_filter, klass_filter, initial_object, &config);
+  if (!Run(env, heap_filter, klass_filter, initial_object, &config)) {
+    return nullptr;
+  }
 
   std::vector<std::string> lines = config.GetLines();
   jobjectArray ret = CreateObjectArray(env,
@@ -528,10 +541,10 @@
                                             void* user_data) {
       FindStringCallbacks* p = reinterpret_cast<FindStringCallbacks*>(user_data);
       if (*tag_ptr != 0) {
-        size_t utf_byte_count = CountUtf8Bytes(value, value_length);
+        size_t utf_byte_count = ti::CountUtf8Bytes(value, value_length);
         std::unique_ptr<char[]> mod_utf(new char[utf_byte_count + 1]);
         memset(mod_utf.get(), 0, utf_byte_count + 1);
-        ConvertUtf16ToModifiedUtf8(mod_utf.get(), utf_byte_count, value, value_length);
+        ti::ConvertUtf16ToModifiedUtf8(mod_utf.get(), utf_byte_count, value, value_length);
         p->data.push_back(android::base::StringPrintf("%" PRId64 "@%" PRId64 " (%" PRId64 ", '%s')",
                                                       *tag_ptr,
                                                       class_tag,
diff --git a/test/913-heaps/src/art/Test913.java b/test/913-heaps/src/art/Test913.java
index c54ecb0..d3b29cf 100644
--- a/test/913-heaps/src/art/Test913.java
+++ b/test/913-heaps/src/art/Test913.java
@@ -21,12 +21,34 @@
 import java.util.Collections;
 import java.util.HashMap;
 import java.util.HashSet;
+import java.util.concurrent.CountDownLatch;
 
 public class Test913 {
   public static void run() throws Exception {
     Main.bindAgentJNIForClass(Test913.class);
 
     doTest();
+
+    // Use a countdown latch for synchronization, as join() will introduce more roots.
+    final CountDownLatch cdl1 = new CountDownLatch(1);
+
+    // Run the follow-references tests on a dedicated thread so we know the specific Thread type.
+    Thread t = new Thread() {
+      @Override
+      public void run() {
+        try {
+          Test913.runFollowReferences();
+        } catch (Exception e) {
+          throw new RuntimeException(e);
+        }
+        cdl1.countDown();
+      }
+    };
+    t.start();
+    cdl1.await();
+  }
+
+  public static void runFollowReferences() throws Exception {
     new TestConfig().doFollowReferencesTest();
 
     Runtime.getRuntime().gc();
@@ -349,6 +371,14 @@
       cInst.baz2 = aInst;
       v.add(cInstStr, aInstStr);  // C -->(field) --> A.
 
+      A[] aArray = new A[2];
+      setTag(aArray, 500);
+      aArray[1] = a2Inst;
+      cInst.array = aArray;
+      String aArrayStr = "500@0";
+      v.add(cInstStr, aArrayStr);
+      v.add(aArrayStr, a2InstStr);
+
       return aInst;
     }
   }
@@ -386,6 +416,7 @@
   public static class C extends B implements I2 {
     public A baz;
     public A baz2;
+    public A[] array;
 
     public C() {}
     public C(A a, A b) {
@@ -481,7 +512,8 @@
           if (currentHead == null) {
             currentHead = referrer;
           } else {
-            if (!currentHead.equals(referrer)) {
+            // Ignore 0@0, as it can happen at any time (as it stands for all other objects).
+            if (!currentHead.equals(referrer) && !referrer.equals("0@0")) {
               completedReferrers.add(currentHead);
               currentHead = referrer;
               if (completedReferrers.contains(referrer)) {
diff --git a/test/914-hello-obsolescence/src/Main.java b/test/914-hello-obsolescence/src/Main.java
index 2ec7664..ab5c7f4 100644
--- a/test/914-hello-obsolescence/src/Main.java
+++ b/test/914-hello-obsolescence/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,60 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-    "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
-    "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
-    "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
-    "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
-    "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
-    "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
-    "AQAPAAAAAgAQ");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
-    "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
-    "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
-    "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-    "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-    "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
-    "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
-    "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-    "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-    "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-    "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
-    "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
-    "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
-    "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
-    "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test914.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-    t.sayHi(() -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    });
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/914-hello-obsolescence/src/Transform.java b/test/914-hello-obsolescence/src/Transform.java
deleted file mode 100644
index 8cda6cd..0000000
--- a/test/914-hello-obsolescence/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(Runnable r) {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Hello" < "LTransform;" < "hello".
-    System.out.println("hello");
-    r.run();
-    System.out.println("goodbye");
-  }
-}
diff --git a/test/914-hello-obsolescence/src/art/Redefinition.java b/test/914-hello-obsolescence/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/914-hello-obsolescence/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/914-hello-obsolescence/src/art/Test914.java b/test/914-hello-obsolescence/src/art/Test914.java
new file mode 100644
index 0000000..ef2710d
--- /dev/null
+++ b/test/914-hello-obsolescence/src/art/Test914.java
@@ -0,0 +1,86 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test914 {
+
+  // The class we will be transforming.
+  static class Transform {
+    public void sayHi(Runnable r) {
+      System.out.println("hello");
+      r.run();
+      System.out.println("goodbye");
+    }
+  }
+
+  // static class Transform {
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+    "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkxNC5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+    "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+    "L1Rlc3Q5MTQkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+    "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+    "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+    "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTE0ACAABwAIAAAAAAACAAAACQAK" +
+    "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+    "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+    "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBlmxNYAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+    "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+    "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+    "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+    "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+    "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+    "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+    "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5MTQkVHJhbnNmb3JtOwANTGFydC9UZXN0OTE0OwAiTGRh" +
+    "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+    "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+    "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+    "ZXN0OTE0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+    "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+    "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+    "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+    "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+    "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+    "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+    "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+    "AA==");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+    t.sayHi(() -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    });
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/915-obsolete-2/src/Main.java b/test/915-obsolete-2/src/Main.java
index fc73ee8..be51234 100644
--- a/test/915-obsolete-2/src/Main.java
+++ b/test/915-obsolete-2/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,86 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   private void Start() {
-  //     System.out.println("Hello - private - Transformed");
-  //   }
-  //
-  //   private void Finish() {
-  //     System.out.println("Goodbye - private - Transformed");
-  //   }
-  //
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Pre Start private method call - Transformed");
-  //     Start();
-  //     System.out.println("Post Start private method call - Transformed");
-  //     r.run();
-  //     System.out.println("Pre Finish private method call - Transformed");
-  //     Finish();
-  //     System.out.println("Post Finish private method call - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAMgoADgAZCQAaABsIABwKAB0AHggAHwgAIAoADQAhCAAiCwAjACQIACUKAA0AJggA" +
-    "JwcAKAcAKQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUBAAVTdGFydAEA" +
-    "BkZpbmlzaAEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7KVYBAApTb3VyY2VGaWxlAQAO" +
-    "VHJhbnNmb3JtLmphdmEMAA8AEAcAKgwAKwAsAQAdSGVsbG8gLSBwcml2YXRlIC0gVHJhbnNmb3Jt" +
-    "ZWQHAC0MAC4ALwEAH0dvb2RieWUgLSBwcml2YXRlIC0gVHJhbnNmb3JtZWQBACtQcmUgU3RhcnQg" +
-    "cHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAATABABACxQb3N0IFN0YXJ0IHByaXZh" +
-    "dGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcAMAwAMQAQAQAsUHJlIEZpbmlzaCBwcml2YXRl" +
-    "IG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQMABQAEAEALVBvc3QgRmluaXNoIHByaXZhdGUgbWV0" +
-    "aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAEACVRyYW5zZm9ybQEAEGphdmEvbGFuZy9PYmplY3QBABBq" +
-    "YXZhL2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQATamF2YS9pby9Q" +
-    "cmludFN0cmVhbQEAB3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xhbmcv" +
-    "UnVubmFibGUBAANydW4AIAANAA4AAAAAAAQAAAAPABAAAQARAAAAHQABAAEAAAAFKrcAAbEAAAAB" +
-    "ABIAAAAGAAEAAAABAAIAEwAQAAEAEQAAACUAAgABAAAACbIAAhIDtgAEsQAAAAEAEgAAAAoAAgAA" +
-    "AAMACAAEAAIAFAAQAAEAEQAAACUAAgABAAAACbIAAhIFtgAEsQAAAAEAEgAAAAoAAgAAAAcACAAI" +
-    "AAEAFQAWAAEAEQAAAGMAAgACAAAAL7IAAhIGtgAEKrcAB7IAAhIItgAEK7kACQEAsgACEgq2AAQq" +
-    "twALsgACEgy2AASxAAAAAQASAAAAIgAIAAAACwAIAAwADAANABQADgAaAA8AIgAQACYAEQAuABIA" +
-    "AQAXAAAAAgAY");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCM0QYTJmX+NsZXkImojgSkJtXyuew3oaXcBAAAcAAAAHhWNBIAAAAAAAAAADwEAAAX" +
-    "AAAAcAAAAAcAAADMAAAAAwAAAOgAAAABAAAADAEAAAcAAAAUAQAAAQAAAEwBAABwAwAAbAEAAD4C" +
-    "AABGAgAATgIAAG8CAACOAgAAmwIAALICAADGAgAA3AIAAPACAAAEAwAAMwMAAGEDAACPAwAAvAMA" +
-    "AMMDAADTAwAA1gMAANoDAADuAwAA8wMAAPwDAAABBAAABAAAAAUAAAAGAAAABwAAAAgAAAAJAAAA" +
-    "EAAAABAAAAAGAAAAAAAAABEAAAAGAAAAMAIAABEAAAAGAAAAOAIAAAUAAQATAAAAAAAAAAAAAAAA" +
-    "AAAAAQAAAAAAAAAOAAAAAAABABYAAAABAAIAFAAAAAIAAAAAAAAAAwAAABUAAAAAAAAAAAAAAAIA" +
-    "AAAAAAAADwAAAAAAAAAmBAAAAAAAAAEAAQABAAAACAQAAAQAAABwEAUAAAAOAAMAAQACAAAADQQA" +
-    "AAkAAABiAAAAGwECAAAAbiAEABAADgAAAAMAAQACAAAAEwQAAAkAAABiAAAAGwEDAAAAbiAEABAA" +
-    "DgAAAAQAAgACAAAAGQQAACoAAABiAAAAGwENAAAAbiAEABAAcBACAAIAYgAAABsBCwAAAG4gBAAQ" +
-    "AHIQBgADAGIAAAAbAQwAAABuIAQAEABwEAEAAgBiAAAAGwEKAAAAbiAEABAADgABAAAAAwAAAAEA" +
-    "AAAEAAY8aW5pdD4ABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVs" +
-    "bG8gLSBwcml2YXRlIC0gVHJhbnNmb3JtZWQAC0xUcmFuc2Zvcm07ABVMamF2YS9pby9QcmludFN0" +
-    "cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xh" +
-    "bmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AC1Qb3N0IEZpbmlzaCBwcml2YXRlIG1ldGhv" +
-    "ZCBjYWxsIC0gVHJhbnNmb3JtZWQALFBvc3QgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRy" +
-    "YW5zZm9ybWVkACxQcmUgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAr" +
-    "UHJlIFN0YXJ0IHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAFU3RhcnQADlRyYW5z" +
-    "Zm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00LjEzAANvdXQAB3ByaW50bG4AA3J1bgAF" +
-    "c2F5SGkAAQAHDgAHAAcOhwADAAcOhwALAQAHDoc8hzyHPIcAAAADAQCAgATsAgEChAMBAqgDAwHM" +
-    "Aw0AAAAAAAAAAQAAAAAAAAABAAAAFwAAAHAAAAACAAAABwAAAMwAAAADAAAAAwAAAOgAAAAEAAAA" +
-    "AQAAAAwBAAAFAAAABwAAABQBAAAGAAAAAQAAAEwBAAABIAAABAAAAGwBAAABEAAAAgAAADACAAAC" +
-    "IAAAFwAAAD4CAAADIAAABAAAAAgEAAAAIAAAAQAAACYEAAAAEAAAAQAAADwEAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test915.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-    t.sayHi(() -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    });
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/915-obsolete-2/src/Transform.java b/test/915-obsolete-2/src/Transform.java
deleted file mode 100644
index e914e29..0000000
--- a/test/915-obsolete-2/src/Transform.java
+++ /dev/null
@@ -1,35 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  private void Start() {
-    System.out.println("hello - private");
-  }
-
-  private void Finish() {
-    System.out.println("goodbye - private");
-  }
-
-  public void sayHi(Runnable r) {
-    System.out.println("Pre Start private method call");
-    Start();
-    System.out.println("Post Start private method call");
-    r.run();
-    System.out.println("Pre Finish private method call");
-    Finish();
-    System.out.println("Post Finish private method call");
-  }
-}
diff --git a/test/915-obsolete-2/src/art/Redefinition.java b/test/915-obsolete-2/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/915-obsolete-2/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/915-obsolete-2/src/art/Test915.java b/test/915-obsolete-2/src/art/Test915.java
new file mode 100644
index 0000000..63c7f34
--- /dev/null
+++ b/test/915-obsolete-2/src/art/Test915.java
@@ -0,0 +1,123 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test915 {
+
+  static class Transform {
+    private void Start() {
+      System.out.println("hello - private");
+    }
+
+    private void Finish() {
+      System.out.println("goodbye - private");
+    }
+
+    public void sayHi(Runnable r) {
+      System.out.println("Pre Start private method call");
+      Start();
+      System.out.println("Post Start private method call");
+      r.run();
+      System.out.println("Pre Finish private method call");
+      Finish();
+      System.out.println("Post Finish private method call");
+    }
+  }
+
+  // static class Transform {
+  //   private void Start() {
+  //     System.out.println("Hello - private - Transformed");
+  //   }
+  //
+  //   private void Finish() {
+  //     System.out.println("Goodbye - private - Transformed");
+  //   }
+  //
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Pre Start private method call - Transformed");
+  //     Start();
+  //     System.out.println("Post Start private method call - Transformed");
+  //     r.run();
+  //     System.out.println("Pre Finish private method call - Transformed");
+  //     Finish();
+  //     System.out.println("Post Finish private method call - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQANgoADgAZCQAaABsIABwKAB0AHggAHwgAIAoADQAhCAAiCwAjACQIACUKAA0AJggA" +
+    "JwcAKQcALAEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUBAAVTdGFydAEA" +
+    "BkZpbmlzaAEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7KVYBAApTb3VyY2VGaWxlAQAM" +
+    "VGVzdDkxNS5qYXZhDAAPABAHAC0MAC4ALwEAHUhlbGxvIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVk" +
+    "BwAwDAAxADIBAB9Hb29kYnllIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVkAQArUHJlIFN0YXJ0IHBy" +
+    "aXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAwAEwAQAQAsUG9zdCBTdGFydCBwcml2YXRl" +
+    "IG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQHADMMADQAEAEALFByZSBGaW5pc2ggcHJpdmF0ZSBt" +
+    "ZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAAUABABAC1Qb3N0IEZpbmlzaCBwcml2YXRlIG1ldGhv" +
+    "ZCBjYWxsIC0gVHJhbnNmb3JtZWQHADUBABVhcnQvVGVzdDkxNSRUcmFuc2Zvcm0BAAlUcmFuc2Zv" +
+    "cm0BAAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEA" +
+    "A291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmlu" +
+    "dGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuAQAL" +
+    "YXJ0L1Rlc3Q5MTUAIAANAA4AAAAAAAQAAAAPABAAAQARAAAAHQABAAEAAAAFKrcAAbEAAAABABIA" +
+    "AAAGAAEAAAAFAAIAEwAQAAEAEQAAACUAAgABAAAACbIAAhIDtgAEsQAAAAEAEgAAAAoAAgAAAAcA" +
+    "CAAIAAIAFAAQAAEAEQAAACUAAgABAAAACbIAAhIFtgAEsQAAAAEAEgAAAAoAAgAAAAoACAALAAEA" +
+    "FQAWAAEAEQAAAGMAAgACAAAAL7IAAhIGtgAEKrcAB7IAAhIItgAEK7kACQEAsgACEgq2AAQqtwAL" +
+    "sgACEgy2AASxAAAAAQASAAAAIgAIAAAADQAIAA4ADAAPABQAEAAaABEAIgASACYAEwAuABQAAgAX" +
+    "AAAAAgAYACsAAAAKAAEADQAoACoACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAQ+GYcAAAAAAAAAAAAAAAAAAAAAAAAAADUBQAAcAAAAHhWNBIAAAAAAAAAABAFAAAd" +
+    "AAAAcAAAAAoAAADkAAAAAwAAAAwBAAABAAAAMAEAAAcAAAA4AQAAAQAAAHABAABEBAAAkAEAAJAB" +
+    "AACYAQAAoAEAAMEBAADgAQAA+QEAAAgCAAAsAgAATAIAAGMCAAB3AgAAjQIAAKECAAC1AgAA5AIA" +
+    "ABIDAABAAwAAbQMAAHQDAACCAwAAjQMAAJADAACUAwAAoQMAAKcDAACsAwAAtQMAALoDAADBAwAA" +
+    "BAAAAAUAAAAGAAAABwAAAAgAAAAJAAAACgAAAAsAAAAMAAAAFAAAABQAAAAJAAAAAAAAABUAAAAJ" +
+    "AAAA0AMAABUAAAAJAAAAyAMAAAgABAAYAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAARAAAAAAABABsA" +
+    "AAAEAAIAGQAAAAUAAAAAAAAABgAAABoAAAAAAAAAAAAAAAUAAAAAAAAAEgAAAAAFAADMBAAAAAAA" +
+    "AAY8aW5pdD4ABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVsbG8g" +
+    "LSBwcml2YXRlIC0gVHJhbnNmb3JtZWQAF0xhcnQvVGVzdDkxNSRUcmFuc2Zvcm07AA1MYXJ0L1Rl" +
+    "c3Q5MTU7ACJMZGFsdmlrL2Fubm90YXRpb24vRW5jbG9zaW5nQ2xhc3M7AB5MZGFsdmlrL2Fubm90" +
+    "YXRpb24vSW5uZXJDbGFzczsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmpl" +
+    "Y3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5n" +
+    "L1N5c3RlbTsALVBvc3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAs" +
+    "UG9zdCBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALFByZSBGaW5pc2gg" +
+    "cHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkACtQcmUgU3RhcnQgcHJpdmF0ZSBtZXRo" +
+    "b2QgY2FsbCAtIFRyYW5zZm9ybWVkAAVTdGFydAAMVGVzdDkxNS5qYXZhAAlUcmFuc2Zvcm0AAVYA" +
+    "AlZMAAthY2Nlc3NGbGFncwAEbmFtZQADb3V0AAdwcmludGxuAANydW4ABXNheUhpAAV2YWx1ZQAB" +
+    "AAAABwAAAAEAAAAGAAAABQAHDgAKAAcOAQgPAAcABw4BCA8ADQEABw4BCA8BAw8BCA8BAw8BCA8B" +
+    "Aw8BCA8AAQABAAEAAADYAwAABAAAAHAQBQAAAA4AAwABAAIAAADdAwAACQAAAGIAAAAbAQIAAABu" +
+    "IAQAEAAOAAAAAwABAAIAAADlAwAACQAAAGIAAAAbAQMAAABuIAQAEAAOAAAABAACAAIAAADtAwAA" +
+    "KgAAAGIAAAAbARAAAABuIAQAEABwEAIAAgBiAAAAGwEOAAAAbiAEABAAchAGAAMAYgAAABsBDwAA" +
+    "AG4gBAAQAHAQAQACAGIAAAAbAQ0AAABuIAQAEAAOAAAAAwEAgIAEiAgBAqAIAQLECAMB6AgAAAIC" +
+    "ARwYAQIDAhYECBcXEwACAAAA5AQAAOoEAAD0BAAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAA" +
+    "AAEAAAAdAAAAcAAAAAIAAAAKAAAA5AAAAAMAAAADAAAADAEAAAQAAAABAAAAMAEAAAUAAAAHAAAA" +
+    "OAEAAAYAAAABAAAAcAEAAAIgAAAdAAAAkAEAAAEQAAACAAAAyAMAAAMgAAAEAAAA2AMAAAEgAAAE" +
+    "AAAACAQAAAAgAAABAAAAzAQAAAQgAAACAAAA5AQAAAMQAAABAAAA9AQAAAYgAAABAAAAAAUAAAAQ" +
+    "AAABAAAAEAUAAA==");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+    t.sayHi(() -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    });
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/916-obsolete-jit/src/Main.java b/test/916-obsolete-jit/src/Main.java
index 3453261..cb202e4 100644
--- a/test/916-obsolete-jit/src/Main.java
+++ b/test/916-obsolete-jit/src/Main.java
@@ -14,6 +14,9 @@
  * limitations under the License.
  */
 
+
+import art.Redefinition;
+
 import java.util.function.Consumer;
 import java.lang.reflect.Method;
 import java.util.Base64;
@@ -144,7 +147,7 @@
         // Actually do the redefinition. The stack looks good.
         retry = false;
         w.accept("transforming calling function");
-        doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+        Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
       }
     };
     // This just prints something out to show we are running the Runnable.
@@ -168,9 +171,4 @@
   private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
 
   private static native void ensureJitCompiled(Class c, String name);
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/916-obsolete-jit/src/art/Redefinition.java b/test/916-obsolete-jit/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/916-obsolete-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/917-fields-transformation/src/Main.java b/test/917-fields-transformation/src/Main.java
index 588af49..289b89f 100644
--- a/test/917-fields-transformation/src/Main.java
+++ b/test/917-fields-transformation/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,67 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-
-  // base64 encoded class/dex file for
-  // class Transform {
-  //   public String take1;
-  //   public String take2;
-  //
-  //   public Transform(String a, String b) {
-  //     take1 = a;
-  //     take2 = b;
-  //   }
-  //
-  //   public String getResult() {
-  //     return take2;
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAFwoABQARCQAEABIJAAQAEwcAFAcAFQEABXRha2UxAQASTGphdmEvbGFuZy9TdHJp" +
-    "bmc7AQAFdGFrZTIBAAY8aW5pdD4BACcoTGphdmEvbGFuZy9TdHJpbmc7TGphdmEvbGFuZy9TdHJp" +
-    "bmc7KVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAJZ2V0UmVzdWx0AQAUKClMamF2YS9sYW5n" +
-    "L1N0cmluZzsBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkAFgwABgAHDAAIAAcBAAlU" +
-    "cmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQADKClWACAABAAFAAAAAgABAAYABwAAAAEACAAH" +
-    "AAAAAgABAAkACgABAAsAAAAzAAIAAwAAAA8qtwABKiu1AAIqLLUAA7EAAAABAAwAAAASAAQAAAAU" +
-    "AAQAFQAJABYADgAXAAEADQAOAAEACwAAAB0AAQABAAAABSq0AAOwAAAAAQAMAAAABgABAAAAGgAB" +
-    "AA8AAAACABA=");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAGUTBb4jIABRlaI9rejdk7RCfyqR2kmNSkAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAM" +
-    "AAAAcAAAAAQAAACgAAAAAwAAALAAAAACAAAA1AAAAAMAAADkAAAAAQAAAPwAAACIAQAAHAEAAFwB" +
-    "AABkAQAAZwEAAHQBAACIAQAAnAEAAKwBAACvAQAAtAEAAMgBAADTAQAA2gEAAAIAAAADAAAABAAA" +
-    "AAYAAAABAAAAAgAAAAAAAAAGAAAAAwAAAAAAAAAHAAAAAwAAAFQBAAAAAAIACgAAAAAAAgALAAAA" +
-    "AAACAAAAAAAAAAAACQAAAAEAAQAAAAAAAAAAAAAAAAABAAAAAAAAAAUAAAAAAAAA8AEAAAAAAAAD" +
-    "AAMAAQAAAOEBAAAIAAAAcBACAAAAWwEAAFsCAQAOAAIAAQAAAAAA6wEAAAMAAABUEAEAEQAAAAIA" +
-    "AAACAAIABjxpbml0PgABTAALTFRyYW5zZm9ybTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEv" +
-    "bGFuZy9TdHJpbmc7AA5UcmFuc2Zvcm0uamF2YQABVgADVkxMABJlbWl0dGVyOiBqYWNrLTQuMTkA" +
-    "CWdldFJlc3VsdAAFdGFrZTEABXRha2UyABQCAAAHDjwtLQAaAAcOAAACAQEAAQEBAIGABJwCAQG8" +
-    "AgAADQAAAAAAAAABAAAAAAAAAAEAAAAMAAAAcAAAAAIAAAAEAAAAoAAAAAMAAAADAAAAsAAAAAQA" +
-    "AAACAAAA1AAAAAUAAAADAAAA5AAAAAYAAAABAAAA/AAAAAEgAAACAAAAHAEAAAEQAAABAAAAVAEA" +
-    "AAIgAAAMAAAAXAEAAAMgAAACAAAA4QEAAAAgAAABAAAA8AEAAAAQAAABAAAABAIAAA==");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform("Hello", "Goodbye"),
-           new Transform("start", "end"));
+  public static void main(String[] args) throws Exception {
+    art.Test917.run();
   }
-
-  private static void printTransform(Transform t) {
-    System.out.println("Result is " + t.getResult());
-    System.out.println("take1 is " + t.take1);
-    System.out.println("take2 is " + t.take2);
-  }
-  public static void doTest(Transform t1, Transform t2) {
-    printTransform(t1);
-    printTransform(t2);
-    doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    printTransform(t1);
-    printTransform(t2);
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/917-fields-transformation/src/Transform.java b/test/917-fields-transformation/src/Transform.java
deleted file mode 100644
index 6fe6223..0000000
--- a/test/917-fields-transformation/src/Transform.java
+++ /dev/null
@@ -1,29 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public String take1;
-  public String take2;
-
-  public Transform(String take1, String take2) {
-    this.take1 = take1;
-    this.take2 = take2;
-  }
-
-  public String getResult() {
-    return take1;
-  }
-}
diff --git a/test/917-fields-transformation/src/art/Redefinition.java b/test/917-fields-transformation/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/917-fields-transformation/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/917-fields-transformation/src/art/Test917.java b/test/917-fields-transformation/src/art/Test917.java
new file mode 100644
index 0000000..245e92e
--- /dev/null
+++ b/test/917-fields-transformation/src/art/Test917.java
@@ -0,0 +1,97 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test917 {
+
+  static class Transform {
+    public String take1;
+    public String take2;
+
+    public Transform(String take1, String take2) {
+      this.take1 = take1;
+      this.take2 = take2;
+    }
+
+    public String getResult() {
+      return take1;
+    }
+  }
+
+
+  // base64 encoded class/dex file for
+  // static class Transform {
+  //   public String take1;
+  //   public String take2;
+  //
+  //   public Transform(String a, String b) {
+  //     take1 = a;
+  //     take2 = b;
+  //   }
+  //
+  //   public String getResult() {
+  //     return take2;
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAGwoABQARCQAEABIJAAQAEwcAFQcAGAEABXRha2UxAQASTGphdmEvbGFuZy9TdHJp" +
+    "bmc7AQAFdGFrZTIBAAY8aW5pdD4BACcoTGphdmEvbGFuZy9TdHJpbmc7TGphdmEvbGFuZy9TdHJp" +
+    "bmc7KVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAJZ2V0UmVzdWx0AQAUKClMamF2YS9sYW5n" +
+    "L1N0cmluZzsBAApTb3VyY2VGaWxlAQAMVGVzdDkxNy5qYXZhDAAJABkMAAYABwwACAAHBwAaAQAV" +
+    "YXJ0L1Rlc3Q5MTckVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9s" +
+    "YW5nL09iamVjdAEAAygpVgEAC2FydC9UZXN0OTE3ACAABAAFAAAAAgABAAYABwAAAAEACAAHAAAA" +
+    "AgABAAkACgABAAsAAAAzAAIAAwAAAA8qtwABKiu1AAIqLLUAA7EAAAABAAwAAAASAAQAAAAJAAQA" +
+    "CgAJAAsADgAMAAEADQAOAAEACwAAAB0AAQABAAAABSq0AAOwAAAAAQAMAAAABgABAAAADwACAA8A" +
+    "AAACABAAFwAAAAoAAQAEABQAFgAI");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBdcPySAAAAAAAAAAAAAAAAAAAAAAAAAACQAwAAcAAAAHhWNBIAAAAAAAAAAMwCAAAS" +
+    "AAAAcAAAAAcAAAC4AAAAAwAAANQAAAACAAAA+AAAAAMAAAAIAQAAAQAAACABAABQAgAAQAEAAEAB" +
+    "AABIAQAASwEAAGQBAABzAQAAlwEAALcBAADLAQAA3wEAAO0BAAD4AQAA+wEAAAACAAANAgAAGAIA" +
+    "AB4CAAAlAgAALAIAAAIAAAADAAAABAAAAAUAAAAGAAAABwAAAAoAAAABAAAABQAAAAAAAAAKAAAA" +
+    "BgAAAAAAAAALAAAABgAAADQCAAAAAAUADwAAAAAABQAQAAAAAAACAAAAAAAAAAAADQAAAAQAAQAA" +
+    "AAAAAAAAAAAAAAAEAAAAAAAAAAgAAAC8AgAAjAIAAAAAAAAGPGluaXQ+AAFMABdMYXJ0L1Rlc3Q5" +
+    "MTckVHJhbnNmb3JtOwANTGFydC9UZXN0OTE3OwAiTGRhbHZpay9hbm5vdGF0aW9uL0VuY2xvc2lu" +
+    "Z0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABJMamF2YS9sYW5nL09iamVj" +
+    "dDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAMVGVzdDkxNy5qYXZhAAlUcmFuc2Zvcm0AAVYAA1ZMTAAL" +
+    "YWNjZXNzRmxhZ3MACWdldFJlc3VsdAAEbmFtZQAFdGFrZTEABXRha2UyAAV2YWx1ZQAAAgAAAAUA" +
+    "BQAJAgAABw4BAw8BAg8BAg8ADwAHDgAAAAADAAMAAQAAADwCAAAIAAAAcBACAAAAWwEAAFsCAQAO" +
+    "AAIAAQAAAAAATAIAAAMAAABUEAEAEQAAAAACAQEAAQEBAIGABNQEAQH0BAAAAgIBERgBAgMCDAQI" +
+    "DhcJAAIAAACgAgAApgIAALACAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAABIAAABw" +
+    "AAAAAgAAAAcAAAC4AAAAAwAAAAMAAADUAAAABAAAAAIAAAD4AAAABQAAAAMAAAAIAQAABgAAAAEA" +
+    "AAAgAQAAAiAAABIAAABAAQAAARAAAAEAAAA0AgAAAyAAAAIAAAA8AgAAASAAAAIAAABUAgAAACAA" +
+    "AAEAAACMAgAABCAAAAIAAACgAgAAAxAAAAEAAACwAgAABiAAAAEAAAC8AgAAABAAAAEAAADMAgAA");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform("Hello", "Goodbye"),
+           new Transform("start", "end"));
+  }
+
+  private static void printTransform(Transform t) {
+    System.out.println("Result is " + t.getResult());
+    System.out.println("take1 is " + t.take1);
+    System.out.println("take2 is " + t.take2);
+  }
+  public static void doTest(Transform t1, Transform t2) {
+    printTransform(t1);
+    printTransform(t2);
+    Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    printTransform(t1);
+    printTransform(t2);
+  }
+}
diff --git a/test/919-obsolete-fields/src/Main.java b/test/919-obsolete-fields/src/Main.java
index 34ee2a9..10eadb2 100644
--- a/test/919-obsolete-fields/src/Main.java
+++ b/test/919-obsolete-fields/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,135 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.function.Consumer;
-import java.util.Base64;
-
 public class Main {
-
-  // What follows is the base64 encoded representation of the following class:
-  //
-  // import java.util.function.Consumer;
-  //
-  // class Transform {
-  //   private Consumer<String> reporter;
-  //   public Transform(Consumer<String> reporter) {
-  //     this.reporter = reporter;
-  //   }
-  //
-  //   private void Start() {
-  //     reporter.accept("Hello - private - Transformed");
-  //   }
-  //
-  //   private void Finish() {
-  //     reporter.accept("Goodbye - private - Transformed");
-  //   }
-  //
-  //   public void sayHi(Runnable r) {
-  //     reporter.accept("pre Start private method call - Transformed");
-  //     Start();
-  //     reporter.accept("post Start private method call - Transformed");
-  //     r.run();
-  //     reporter.accept("pre Finish private method call - Transformed");
-  //     Finish();
-  //     reporter.accept("post Finish private method call - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQANAoADgAfCQANACAIACELACIAIwgAJAgAJQoADQAmCAAnCwAoACkIACoKAA0AKwgA" +
-    "LAcALQcALgEACHJlcG9ydGVyAQAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsBAAlTaWdu" +
-    "YXR1cmUBADFMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyPExqYXZhL2xhbmcvU3RyaW5nOz47" +
-    "AQAGPGluaXQ+AQAgKExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7KVYBAARDb2RlAQAPTGlu" +
-    "ZU51bWJlclRhYmxlAQA0KExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI8TGphdmEvbGFuZy9T" +
-    "dHJpbmc7PjspVgEABVN0YXJ0AQADKClWAQAGRmluaXNoAQAFc2F5SGkBABcoTGphdmEvbGFuZy9S" +
-    "dW5uYWJsZTspVgEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwAEwAZDAAPABABAB1IZWxs" +
-    "byAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAcALwwAMAAxAQAfR29vZGJ5ZSAtIHByaXZhdGUgLSBU" +
-    "cmFuc2Zvcm1lZAEAK3ByZSBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQM" +
-    "ABgAGQEALHBvc3QgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkBwAyDAAz" +
-    "ABkBACxwcmUgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAwAGgAZAQAt" +
-    "cG9zdCBGaW5pc2ggcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkAQAJVHJhbnNmb3Jt" +
-    "AQAQamF2YS9sYW5nL09iamVjdAEAG2phdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcgEABmFjY2Vw" +
-    "dAEAFShMamF2YS9sYW5nL09iamVjdDspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgAgAA0A" +
-    "DgAAAAEAAgAPABAAAQARAAAAAgASAAQAAQATABQAAgAVAAAAKgACAAIAAAAKKrcAASortQACsQAA" +
-    "AAEAFgAAAA4AAwAAABUABAAWAAkAFwARAAAAAgAXAAIAGAAZAAEAFQAAACgAAgABAAAADCq0AAIS" +
-    "A7kABAIAsQAAAAEAFgAAAAoAAgAAABoACwAbAAIAGgAZAAEAFQAAACgAAgABAAAADCq0AAISBbkA" +
-    "BAIAsQAAAAEAFgAAAAoAAgAAAB4ACwAfAAEAGwAcAAEAFQAAAG8AAgACAAAAOyq0AAISBrkABAIA" +
-    "KrcAByq0AAISCLkABAIAK7kACQEAKrQAAhIKuQAEAgAqtwALKrQAAhIMuQAEAgCxAAAAAQAWAAAA" +
-    "IgAIAAAAIgALACMADwAkABoAJQAgACYAKwAnAC8AKAA6ACkAAQAdAAAAAgAe");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAw/b59wCwTlSVDmuhPEezuK3oe0rtT4ujMBQAAcAAAAHhWNBIAAAAAAAAAAAgFAAAd" +
-    "AAAAcAAAAAYAAADkAAAABAAAAPwAAAABAAAALAEAAAcAAAA0AQAAAQAAAGwBAABABAAAjAEAAJoC" +
-    "AACdAgAAoAIAAKgCAACsAgAAsgIAALoCAADbAgAA+gIAAAcDAAAmAwAAOgMAAFADAABkAwAAggMA" +
-    "AKEDAACoAwAAuAMAALsDAAC/AwAAxwMAANsDAAAKBAAAOAQAAGYEAACTBAAAnQQAAKIEAACpBAAA" +
-    "CAAAAAkAAAAKAAAACwAAAA4AAAARAAAAEQAAAAUAAAAAAAAAEgAAAAUAAACEAgAAEgAAAAUAAACM" +
-    "AgAAEgAAAAUAAACUAgAAAAAEABkAAAAAAAMAAgAAAAAAAAAFAAAAAAAAAA8AAAAAAAIAGwAAAAIA" +
-    "AAACAAAAAwAAABoAAAAEAAEAEwAAAAAAAAAAAAAAAgAAAAAAAAAQAAAAZAIAAO8EAAAAAAAAAQAA" +
-    "ANEEAAABAAAA3wQAAAIAAgABAAAAsAQAAAYAAABwEAQAAABbAQAADgADAAEAAgAAALgEAAAJAAAA" +
-    "VCAAABsBBgAAAHIgBgAQAA4AAAADAAEAAgAAAL4EAAAJAAAAVCAAABsBBwAAAHIgBgAQAA4AAAAE" +
-    "AAIAAgAAAMQEAAAqAAAAVCAAABsBGAAAAHIgBgAQAHAQAgACAFQgAAAbARYAAAByIAYAEAByEAUA" +
-    "AwBUIAAAGwEXAAAAciAGABAAcBABAAIAVCAAABsBFQAAAHIgBgAQAA4AAAAAAAEAAAABAAAAAAAA" +
-    "AAAAAACMAQAAAAAAAJQBAAABAAAAAgAAAAEAAAADAAAAAQAAAAQAASgAATwABjxpbml0PgACPjsA" +
-    "BD47KVYABkZpbmlzaAAfR29vZGJ5ZSAtIHByaXZhdGUgLSBUcmFuc2Zvcm1lZAAdSGVsbG8gLSBw" +
-    "cml2YXRlIC0gVHJhbnNmb3JtZWQAC0xUcmFuc2Zvcm07AB1MZGFsdmlrL2Fubm90YXRpb24vU2ln" +
-    "bmF0dXJlOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEv" +
-    "bGFuZy9TdHJpbmc7ABxMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyAB1MamF2YS91dGlsL2Z1" +
-    "bmN0aW9uL0NvbnN1bWVyOwAFU3RhcnQADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAAGYWNjZXB0ABJl" +
-    "bWl0dGVyOiBqYWNrLTQuMTkALXBvc3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFu" +
-    "c2Zvcm1lZAAscG9zdCBTdGFydCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALHBy" +
-    "ZSBGaW5pc2ggcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkACtwcmUgU3RhcnQgcHJp" +
-    "dmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkAAhyZXBvcnRlcgADcnVuAAVzYXlIaQAFdmFs" +
-    "dWUAFQEABw48LQAeAAcOhwAaAAcOhwAiAQAHDoc8hzyHPIcAAgEBHBwEFw0XARcMFwMCAQEcHAUX" +
-    "ABcNFwEXDBcEAAEDAQACAIGABJwDAQK4AwEC3AMDAYAEABAAAAAAAAAAAQAAAAAAAAABAAAAHQAA" +
-    "AHAAAAACAAAABgAAAOQAAAADAAAABAAAAPwAAAAEAAAAAQAAACwBAAAFAAAABwAAADQBAAAGAAAA" +
-    "AQAAAGwBAAADEAAAAgAAAIwBAAABIAAABAAAAJwBAAAGIAAAAQAAAGQCAAABEAAAAwAAAIQCAAAC" +
-    "IAAAHQAAAJoCAAADIAAABAAAALAEAAAEIAAAAgAAANEEAAAAIAAAAQAAAO8EAAAAEAAAAQAAAAgF" +
-    "AAA=");
-
-  // A class that we can use to keep track of the output of this test.
-  private static class TestWatcher implements Consumer<String> {
-    private StringBuilder sb;
-    public TestWatcher() {
-      sb = new StringBuilder();
-    }
-
-    @Override
-    public void accept(String s) {
-      sb.append(s);
-      sb.append('\n');
-    }
-
-    public String getOutput() {
-      return sb.toString();
-    }
+  public static void main(String[] args) throws Exception {
+    art.Test919.run();
   }
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    TestWatcher w = new TestWatcher();
-    doTest(new Transform(w), w);
-  }
-
-  private static boolean interpreting = true;
-  private static boolean retry = false;
-
-  public static void doTest(Transform t, TestWatcher w) {
-    Runnable do_redefinition = () -> {
-      w.accept("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    };
-    // This just prints something out to show we are running the Runnable.
-    Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
-
-    // Try and redefine.
-    t.sayHi(say_nothing);
-    t.sayHi(do_redefinition);
-    t.sayHi(say_nothing);
-
-    // Print output of last run.
-    System.out.print(w.getOutput());
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/919-obsolete-fields/src/Transform.java b/test/919-obsolete-fields/src/Transform.java
deleted file mode 100644
index c8e3cbd..0000000
--- a/test/919-obsolete-fields/src/Transform.java
+++ /dev/null
@@ -1,42 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-import java.util.function.Consumer;
-
-class Transform {
-  private Consumer<String> reporter;
-  public Transform(Consumer<String> reporter) {
-    this.reporter = reporter;
-  }
-
-  private void Start() {
-    reporter.accept("hello - private");
-  }
-
-  private void Finish() {
-    reporter.accept("goodbye - private");
-  }
-
-  public void sayHi(Runnable r) {
-    reporter.accept("Pre Start private method call");
-    Start();
-    reporter.accept("Post Start private method call");
-    r.run();
-    reporter.accept("Pre Finish private method call");
-    Finish();
-    reporter.accept("Post Finish private method call");
-  }
-}
diff --git a/test/919-obsolete-fields/src/art/Redefinition.java b/test/919-obsolete-fields/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/919-obsolete-fields/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/919-obsolete-fields/src/art/Test919.java b/test/919-obsolete-fields/src/art/Test919.java
new file mode 100644
index 0000000..11971ef
--- /dev/null
+++ b/test/919-obsolete-fields/src/art/Test919.java
@@ -0,0 +1,173 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.function.Consumer;
+import java.util.Base64;
+
+public class Test919 {
+
+  static class Transform {
+    private Consumer<String> reporter;
+    public Transform(Consumer<String> reporter) {
+      this.reporter = reporter;
+    }
+
+    private void Start() {
+      reporter.accept("hello - private");
+    }
+
+    private void Finish() {
+      reporter.accept("goodbye - private");
+    }
+
+    public void sayHi(Runnable r) {
+      reporter.accept("Pre Start private method call");
+      Start();
+      reporter.accept("Post Start private method call");
+      r.run();
+      reporter.accept("Pre Finish private method call");
+      Finish();
+      reporter.accept("Post Finish private method call");
+    }
+  }
+
+
+  // What follows is the base64 encoded representation of the following class:
+  //
+  // import java.util.function.Consumer;
+  //
+  // static class Transform {
+  //   private Consumer<String> reporter;
+  //   public Transform(Consumer<String> reporter) {
+  //     this.reporter = reporter;
+  //   }
+  //
+  //   private void Start() {
+  //     reporter.accept("Hello - private - Transformed");
+  //   }
+  //
+  //   private void Finish() {
+  //     reporter.accept("Goodbye - private - Transformed");
+  //   }
+  //
+  //   public void sayHi(Runnable r) {
+  //     reporter.accept("pre Start private method call - Transformed");
+  //     Start();
+  //     reporter.accept("post Start private method call - Transformed");
+  //     r.run();
+  //     reporter.accept("pre Finish private method call - Transformed");
+  //     Finish();
+  //     reporter.accept("post Finish private method call - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAOAoADgAfCQANACAIACELACIAIwgAJAgAJQoADQAmCAAnCwAoACkIACoKAA0AKwgA" +
+    "LAcALgcAMQEACHJlcG9ydGVyAQAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsBAAlTaWdu" +
+    "YXR1cmUBADFMamF2YS91dGlsL2Z1bmN0aW9uL0NvbnN1bWVyPExqYXZhL2xhbmcvU3RyaW5nOz47" +
+    "AQAGPGluaXQ+AQAgKExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI7KVYBAARDb2RlAQAPTGlu" +
+    "ZU51bWJlclRhYmxlAQA0KExqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXI8TGphdmEvbGFuZy9T" +
+    "dHJpbmc7PjspVgEABVN0YXJ0AQADKClWAQAGRmluaXNoAQAFc2F5SGkBABcoTGphdmEvbGFuZy9S" +
+    "dW5uYWJsZTspVgEAClNvdXJjZUZpbGUBAAxUZXN0OTE5LmphdmEMABMAGQwADwAQAQAdSGVsbG8g" +
+    "LSBwcml2YXRlIC0gVHJhbnNmb3JtZWQHADIMADMANAEAH0dvb2RieWUgLSBwcml2YXRlIC0gVHJh" +
+    "bnNmb3JtZWQBACtwcmUgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRyYW5zZm9ybWVkDAAY" +
+    "ABkBACxwb3N0IFN0YXJ0IHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcANQwANgAZ" +
+    "AQAscHJlIEZpbmlzaCBwcml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQMABoAGQEALXBv" +
+    "c3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAcANwEAFWFydC9UZXN0" +
+    "OTE5JFRyYW5zZm9ybQEACVRyYW5zZm9ybQEADElubmVyQ2xhc3NlcwEAEGphdmEvbGFuZy9PYmpl" +
+    "Y3QBABtqYXZhL3V0aWwvZnVuY3Rpb24vQ29uc3VtZXIBAAZhY2NlcHQBABUoTGphdmEvbGFuZy9P" +
+    "YmplY3Q7KVYBABJqYXZhL2xhbmcvUnVubmFibGUBAANydW4BAAthcnQvVGVzdDkxOQAgAA0ADgAA" +
+    "AAEAAgAPABAAAQARAAAAAgASAAQAAQATABQAAgAVAAAAKgACAAIAAAAKKrcAASortQACsQAAAAEA" +
+    "FgAAAA4AAwAAAAgABAAJAAkACgARAAAAAgAXAAIAGAAZAAEAFQAAACgAAgABAAAADCq0AAISA7kA" +
+    "BAIAsQAAAAEAFgAAAAoAAgAAAA0ACwAOAAIAGgAZAAEAFQAAACgAAgABAAAADCq0AAISBbkABAIA" +
+    "sQAAAAEAFgAAAAoAAgAAABEACwASAAEAGwAcAAEAFQAAAG8AAgACAAAAOyq0AAISBrkABAIAKrcA" +
+    "Byq0AAISCLkABAIAK7kACQEAKrQAAhIKuQAEAgAqtwALKrQAAhIMuQAEAgCxAAAAAQAWAAAAIgAI" +
+    "AAAAFQALABYADwAXABoAGAAgABkAKwAaAC8AGwA6ABwAAgAdAAAAAgAeADAAAAAKAAEADQAtAC8A" +
+    "CA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBeEZYBAAAAAAAAAAAAAAAAAAAAAAAAAACMBgAAcAAAAHhWNBIAAAAAAAAAAMgFAAAi" +
+    "AAAAcAAAAAkAAAD4AAAABAAAABwBAAABAAAATAEAAAcAAABUAQAAAQAAAIwBAADgBAAArAEAAKwB" +
+    "AACvAQAAsgEAALoBAAC+AQAAxAEAAMwBAADtAQAADAIAACUCAAA0AgAAWAIAAHgCAACXAgAAqwIA" +
+    "AMECAADVAgAA8wIAABIDAAAZAwAAJwMAADIDAAA1AwAAOQMAAEEDAABOAwAAVAMAAIMDAACxAwAA" +
+    "3wMAAAwEAAAWBAAAGwQAACIEAAAIAAAACQAAAAoAAAALAAAADAAAAA0AAAAOAAAAEQAAABUAAAAV" +
+    "AAAACAAAAAAAAAAWAAAACAAAADQEAAAWAAAACAAAADwEAAAWAAAACAAAACwEAAAAAAcAHgAAAAAA" +
+    "AwACAAAAAAAAAAUAAAAAAAAAEgAAAAAAAgAgAAAABQAAAAIAAAAGAAAAHwAAAAcAAQAXAAAAAAAA" +
+    "AAAAAAAFAAAAAAAAABMAAACoBQAARAUAAAAAAAABKAABPAAGPGluaXQ+AAI+OwAEPjspVgAGRmlu" +
+    "aXNoAB9Hb29kYnllIC0gcHJpdmF0ZSAtIFRyYW5zZm9ybWVkAB1IZWxsbyAtIHByaXZhdGUgLSBU" +
+    "cmFuc2Zvcm1lZAAXTGFydC9UZXN0OTE5JFRyYW5zZm9ybTsADUxhcnQvVGVzdDkxOTsAIkxkYWx2" +
+    "aWsvYW5ub3RhdGlvbi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNs" +
+    "YXNzOwAdTGRhbHZpay9hbm5vdGF0aW9uL1NpZ25hdHVyZTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAU" +
+    "TGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAcTGphdmEvdXRpbC9mdW5j" +
+    "dGlvbi9Db25zdW1lcgAdTGphdmEvdXRpbC9mdW5jdGlvbi9Db25zdW1lcjsABVN0YXJ0AAxUZXN0" +
+    "OTE5LmphdmEACVRyYW5zZm9ybQABVgACVkwABmFjY2VwdAALYWNjZXNzRmxhZ3MABG5hbWUALXBv" +
+    "c3QgRmluaXNoIHByaXZhdGUgbWV0aG9kIGNhbGwgLSBUcmFuc2Zvcm1lZAAscG9zdCBTdGFydCBw" +
+    "cml2YXRlIG1ldGhvZCBjYWxsIC0gVHJhbnNmb3JtZWQALHByZSBGaW5pc2ggcHJpdmF0ZSBtZXRo" +
+    "b2QgY2FsbCAtIFRyYW5zZm9ybWVkACtwcmUgU3RhcnQgcHJpdmF0ZSBtZXRob2QgY2FsbCAtIFRy" +
+    "YW5zZm9ybWVkAAhyZXBvcnRlcgADcnVuAAVzYXlIaQAFdmFsdWUAAAAAAQAAAAcAAAABAAAABQAA" +
+    "AAEAAAAGAAAACAEABw4BAw8BAg8AEQAHDgEIDwANAAcOAQgPABUBAAcOAQgPAQMPAQgPAQMPAQgP" +
+    "AQMPAQgPAAACAAIAAQAAAEQEAAAGAAAAcBAEAAAAWwEAAA4AAwABAAIAAABQBAAACQAAAFQgAAAb" +
+    "AQYAAAByIAYAEAAOAAAAAwABAAIAAABYBAAACQAAAFQgAAAbAQcAAAByIAYAEAAOAAAABAACAAIA" +
+    "AABgBAAAKgAAAFQgAAAbAR0AAAByIAYAEABwEAIAAgBUIAAAGwEbAAAAciAGABAAchAFAAMAVCAA" +
+    "ABsBHAAAAHIgBgAQAHAQAQACAFQgAAAbARoAAAByIAYAEAAOAAABAwEAAgCBgAT8CAECmAkBArwJ" +
+    "AwHgCQICASEYAQIDAhgECBkXFAIEASEcBBcQFwEXDxcDAgQBIRwFFwAXEBcBFw8XBAAAAAIAAABc" +
+    "BQAAYgUAAAEAAABrBQAAAQAAAHkFAACMBQAAAQAAAAEAAAAAAAAAAAAAAJgFAAAAAAAAoAUAABAA" +
+    "AAAAAAAAAQAAAAAAAAABAAAAIgAAAHAAAAACAAAACQAAAPgAAAADAAAABAAAABwBAAAEAAAAAQAA" +
+    "AEwBAAAFAAAABwAAAFQBAAAGAAAAAQAAAIwBAAACIAAAIgAAAKwBAAABEAAAAwAAACwEAAADIAAA" +
+    "BAAAAEQEAAABIAAABAAAAHwEAAAAIAAAAQAAAEQFAAAEIAAABAAAAFwFAAADEAAAAwAAAIwFAAAG" +
+    "IAAAAQAAAKgFAAAAEAAAAQAAAMgFAAA=");
+
+  // A class that we can use to keep track of the output of this test.
+  private static class TestWatcher implements Consumer<String> {
+    private StringBuilder sb;
+    public TestWatcher() {
+      sb = new StringBuilder();
+    }
+
+    @Override
+    public void accept(String s) {
+      sb.append(s);
+      sb.append('\n');
+    }
+
+    public String getOutput() {
+      return sb.toString();
+    }
+  }
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    TestWatcher w = new TestWatcher();
+    doTest(new Transform(w), w);
+  }
+
+  public static void doTest(Transform t, TestWatcher w) {
+    Runnable do_redefinition = () -> {
+      w.accept("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    };
+    // This just prints something out to show we are running the Runnable.
+    Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
+
+    // Try and redefine.
+    t.sayHi(say_nothing);
+    t.sayHi(do_redefinition);
+    t.sayHi(say_nothing);
+
+    // Print output of last run.
+    System.out.print(w.getOutput());
+  }
+}
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index d9a4948..cfdcdc2 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -14,12 +14,12 @@
  * limitations under the License.
  */
 
-import java.util.ArrayList;
+import art.Redefinition;
+import java.util.Arrays;
+
 public class Main {
 
   public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-
     Verification.doTest(new Transform());
     NewName.doTest(new Transform());
     DifferentAccess.doTest(new Transform());
@@ -37,40 +37,40 @@
     Unmodifiable.doTest(new Transform[] { new Transform(), });
   }
 
-  // Transforms the class. This throws an exception if something goes wrong.
-  public static native void doCommonClassRedefinition(Class<?> target,
-                                                      byte[] classfile,
-                                                      byte[] dexfile) throws Exception;
+  // TODO Replace this shim with a better re-write of this test.
+  private static Redefinition.CommonClassDefinition mapCCD(CommonClassDefinition d) {
+    return new Redefinition.CommonClassDefinition(d.target, d.class_file_bytes, d.dex_file_bytes);
+  }
 
+  private static Redefinition.CommonClassDefinition[] toCCDA(CommonClassDefinition[] ds) {
+    return Arrays.stream(ds).map(Main::mapCCD).toArray(Redefinition.CommonClassDefinition[]::new);
+  }
+
+  public static void doCommonClassRedefinition(Class<?> target,
+                                               byte[] classfile,
+                                               byte[] dexfile) throws Exception {
+    Redefinition.doCommonClassRedefinition(target, classfile, dexfile);
+  }
   public static void doMultiClassRedefinition(CommonClassDefinition... defs) throws Exception {
-    ArrayList<Class<?>> classes = new ArrayList<>();
-    ArrayList<byte[]> class_files = new ArrayList<>();
-    ArrayList<byte[]> dex_files = new ArrayList<>();
-
-    for (CommonClassDefinition d : defs) {
-      classes.add(d.target);
-      class_files.add(d.class_file_bytes);
-      dex_files.add(d.dex_file_bytes);
-    }
-    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
-                                   class_files.toArray(new byte[0][]),
-                                   dex_files.toArray(new byte[0][]));
+    Redefinition.doMultiClassRedefinition(toCCDA(defs));
   }
-
   public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
-    for (CommonClassDefinition d : defs) {
-      addCommonTransformationResult(d.target.getCanonicalName(),
-                                    d.class_file_bytes,
-                                    d.dex_file_bytes);
-    }
+    Redefinition.addMultiTransformationResults(toCCDA(defs));
   }
-
-  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
-                                                           byte[][] classfiles,
-                                                           byte[][] dexfiles) throws Exception;
-  public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
-  public static native void enableCommonRetransformation(boolean enable);
-  public static native void addCommonTransformationResult(String target_name,
-                                                          byte[] class_bytes,
-                                                          byte[] dex_bytes);
+  public static void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                    byte[][] classfiles,
+                                                    byte[][] dexfiles) throws Exception {
+    Redefinition.doCommonMultiClassRedefinition(targets, classfiles, dexfiles);
+  }
+  public static void doCommonClassRetransformation(Class<?>... target) throws Exception {
+    Redefinition.doCommonClassRetransformation(target);
+  }
+  public static void enableCommonRetransformation(boolean enable) {
+    Redefinition.enableCommonRetransformation(enable);
+  }
+  public static void addCommonTransformationResult(String target_name,
+                                                   byte[] class_bytes,
+                                                   byte[] dex_bytes) {
+    Redefinition.addCommonTransformationResult(target_name, class_bytes, dex_bytes);
+  }
 }
diff --git a/test/921-hello-failure/src/art/Redefinition.java b/test/921-hello-failure/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/921-hello-failure/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/926-multi-obsolescence/src/CommonClassDefinition.java b/test/926-multi-obsolescence/src/CommonClassDefinition.java
deleted file mode 100644
index 62602a0..0000000
--- a/test/926-multi-obsolescence/src/CommonClassDefinition.java
+++ /dev/null
@@ -1,27 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class CommonClassDefinition {
-  public final Class<?> target;
-  public final byte[] class_file_bytes;
-  public final byte[] dex_file_bytes;
-
-  CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
-    this.target = target;
-    this.class_file_bytes = class_file_bytes;
-    this.dex_file_bytes = dex_file_bytes;
-  }
-}
diff --git a/test/926-multi-obsolescence/src/Main.java b/test/926-multi-obsolescence/src/Main.java
index 2440908..8e21b8f 100644
--- a/test/926-multi-obsolescence/src/Main.java
+++ b/test/926-multi-obsolescence/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,115 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.ArrayList;
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  // }
-  private static CommonClassDefinition VALID_DEFINITION_T1 = new CommonClassDefinition(
-      Transform.class,
-      Base64.getDecoder().decode(
-        "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-        "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-        "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
-        "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
-        "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
-        "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
-        "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
-        "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
-        "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
-        "AQAPAAAAAgAQ"),
-      Base64.getDecoder().decode(
-        "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
-        "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
-        "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
-        "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-        "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-        "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
-        "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
-        "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-        "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-        "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-        "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
-        "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
-        "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
-        "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
-        "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA="));
-  // class Transform2 {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello 2 - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye 2 - Transformed");
-  //   }
-  // }
-  private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
-      Transform2.class,
-      Base64.getDecoder().decode(
-        "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-        "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-        "KVYBAApTb3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoHABwMAB0AHgEAFUhlbGxvIDIg" +
-        "LSBUcmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABdHb29kYnllIDIgLSBUcmFuc2Zvcm1lZAEA" +
-        "ClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEA" +
-        "FUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAV" +
-        "KExqYXZhL2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAA" +
-        "AAACAAAACQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsA" +
-        "AAA7AAIAAgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4A" +
-        "BQAWAAYAAQAPAAAAAgAQ"),
-      Base64.getDecoder().decode(
-        "ZGV4CjAzNQCee5Z6+AuFcjnPjjn7QYgZmKSmFQCO4nxUAwAAcAAAAHhWNBIAAAAAAAAAALQCAAAR" +
-        "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAQAgAARAEAAKIB" +
-        "AACqAQAAwwEAANoBAADoAQAA/wEAABMCAAApAgAAPQIAAFECAABiAgAAZQIAAGkCAAB9AgAAggIA" +
-        "AIsCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-        "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-        "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
-        "AwAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
-        "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AF0dvb2RieWUgMiAtIFRyYW5zZm9ybWVkABVIZWxs" +
-        "byAyIC0gVHJhbnNmb3JtZWQADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJM" +
-        "amF2YS9sYW5nL09iamVjdDsAFExqYXZhL2xhbmcvUnVubmFibGU7ABJMamF2YS9sYW5nL1N0cmlu" +
-        "ZzsAEkxqYXZhL2xhbmcvU3lzdGVtOwAPVHJhbnNmb3JtMi5qYXZhAAFWAAJWTAASZW1pdHRlcjog" +
-        "amFjay00LjIwAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICA" +
-        "BMQCAQHcAgANAAAAAAAAAAEAAAAAAAAAAQAAABEAAABwAAAAAgAAAAcAAAC0AAAAAwAAAAMAAADQ" +
-        "AAAABAAAAAEAAAD0AAAABQAAAAUAAAD8AAAABgAAAAEAAAAkAQAAASAAAAIAAABEAQAAARAAAAIA" +
-        "AACUAQAAAiAAABEAAACiAQAAAyAAAAIAAACXAgAAACAAAAEAAAClAgAAABAAAAEAAAC0AgAA"));
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform(), new Transform2());
+  public static void main(String[] args) throws Exception {
+    art.Test926.run();
   }
-
-  public static void doTest(final Transform t1, final Transform2 t2) {
-    t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
-    t1.sayHi(() -> {
-      t2.sayHi(() -> {
-        System.out.println("transforming calling functions");
-        doMultiClassRedefinition(VALID_DEFINITION_T1, VALID_DEFINITION_T2);
-      });
-    });
-    t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
-  }
-
-  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
-    ArrayList<Class<?>> classes = new ArrayList<>();
-    ArrayList<byte[]> class_files = new ArrayList<>();
-    ArrayList<byte[]> dex_files = new ArrayList<>();
-
-    for (CommonClassDefinition d : defs) {
-      classes.add(d.target);
-      class_files.add(d.class_file_bytes);
-      dex_files.add(d.dex_file_bytes);
-    }
-    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
-                                   class_files.toArray(new byte[0][]),
-                                   dex_files.toArray(new byte[0][]));
-  }
-
-  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
-                                                           byte[][] classfiles,
-                                                           byte[][] dexfiles);
 }
diff --git a/test/926-multi-obsolescence/src/Transform.java b/test/926-multi-obsolescence/src/Transform.java
deleted file mode 100644
index 8cda6cd..0000000
--- a/test/926-multi-obsolescence/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(Runnable r) {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Hello" < "LTransform;" < "hello".
-    System.out.println("hello");
-    r.run();
-    System.out.println("goodbye");
-  }
-}
diff --git a/test/926-multi-obsolescence/src/Transform2.java b/test/926-multi-obsolescence/src/Transform2.java
deleted file mode 100644
index 4877f84..0000000
--- a/test/926-multi-obsolescence/src/Transform2.java
+++ /dev/null
@@ -1,23 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
-  public void sayHi(Runnable r) {
-    System.out.println("hello - 2");
-    r.run();
-    System.out.println("goodbye - 2");
-  }
-}
diff --git a/test/926-multi-obsolescence/src/art/Redefinition.java b/test/926-multi-obsolescence/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/926-multi-obsolescence/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/926-multi-obsolescence/src/art/Test926.java b/test/926-multi-obsolescence/src/art/Test926.java
new file mode 100644
index 0000000..843d05c
--- /dev/null
+++ b/test/926-multi-obsolescence/src/art/Test926.java
@@ -0,0 +1,140 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.CommonClassDefinition;
+import java.util.ArrayList;
+import java.util.Base64;
+
+public class Test926 {
+
+  static class Transform {
+    public void sayHi(Runnable r) {
+      System.out.println("hello");
+      r.run();
+      System.out.println("goodbye");
+    }
+  }
+
+  static class Transform2 {
+    public void sayHi(Runnable r) {
+      System.out.println("hello - 2");
+      r.run();
+      System.out.println("goodbye - 2");
+    }
+  }
+  // static class Transform {
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  // }
+  private static CommonClassDefinition VALID_DEFINITION_T1 = new CommonClassDefinition(
+      Transform.class,
+      Base64.getDecoder().decode(
+        "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+        "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+        "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkyNi5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+        "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+        "L1Rlc3Q5MjYkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+        "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+        "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+        "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTI2ACAABwAIAAAAAAACAAAACQAK" +
+        "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAADAABAA0ADgABAAsAAAA7AAIAAgAA" +
+        "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAA4ACAAPAA4AEAAWABEAAgAP" +
+        "AAAAAgAQAB0AAAAKAAEABwAaABwACA=="),
+      Base64.getDecoder().decode(
+        "ZGV4CjAzNQB8m+R/AAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+        "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+        "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+        "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+        "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+        "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+        "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+        "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5MjYkVHJhbnNmb3JtOwANTGFydC9UZXN0OTI2OwAiTGRh" +
+        "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+        "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+        "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+        "ZXN0OTI2LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+        "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAMAAcOAA4BAAcOAQgP" +
+        "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+        "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+        "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+        "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+        "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+        "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+        "AA=="));
+  // static class Transform2 {
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello 2 - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye 2 - Transformed");
+  //   }
+  // }
+  private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+      Transform2.class,
+      Base64.getDecoder().decode(
+        "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+        "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+        "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDkyNi5qYXZhDAAJAAoHAB8MACAAIQEAFUhlbGxvIDIgLSBU" +
+        "cmFuc2Zvcm1lZAcAIgwAIwAkBwAlDAAmAAoBABdHb29kYnllIDIgLSBUcmFuc2Zvcm1lZAcAJwEA" +
+        "FmFydC9UZXN0OTI2JFRyYW5zZm9ybTIBAApUcmFuc2Zvcm0yAQAMSW5uZXJDbGFzc2VzAQAQamF2" +
+        "YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0" +
+        "cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmlu" +
+        "ZzspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTI2ACAABwAIAAAAAAAC" +
+        "AAAACQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7" +
+        "AAIAAgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAW" +
+        "AAoAAgAPAAAAAgAQAB0AAAAKAAEABwAaABwACA=="),
+      Base64.getDecoder().decode(
+        "ZGV4CjAzNQBCnaUuAAAAAAAAAAAAAAAAAAAAAAAAAABABAAAcAAAAHhWNBIAAAAAAAAAAHwDAAAX" +
+        "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADYAgAAaAEAAGgB" +
+        "AABwAQAAiQEAAKABAAC6AQAAyQEAAO0BAAANAgAAJAIAADgCAABOAgAAYgIAAHYCAACEAgAAkAIA" +
+        "AJMCAACXAgAApAIAAKoCAACvAgAAuAIAAL0CAADEAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+        "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAzAIAAA8AAAAJAAAA1AIAAAgABAAS" +
+        "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+        "AAAMAAAAbAMAAEADAAAAAAAABjxpbml0PgAXR29vZGJ5ZSAyIC0gVHJhbnNmb3JtZWQAFUhlbGxv" +
+        "IDIgLSBUcmFuc2Zvcm1lZAAYTGFydC9UZXN0OTI2JFRyYW5zZm9ybTI7AA1MYXJ0L1Rlc3Q5MjY7" +
+        "ACJMZGFsdmlrL2Fubm90YXRpb24vRW5jbG9zaW5nQ2xhc3M7AB5MZGFsdmlrL2Fubm90YXRpb24v" +
+        "SW5uZXJDbGFzczsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABRM" +
+        "amF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
+        "bTsADFRlc3Q5MjYuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANv" +
+        "dXQAB3ByaW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAABAAAABgAAAAEAAAAHAAAABQAHDgAHAQAH" +
+        "DgEIDwEDDwEIDwABAAEAAQAAANwCAAAEAAAAcBADAAAADgAEAAIAAgAAAOECAAAUAAAAYgAAABsB" +
+        "AgAAAG4gAgAQAHIQBAADAGIAAAAbAQEAAABuIAIAEAAOAAAAAQEAgIAE8AUBAYgGAAACAgEWGAEC" +
+        "AwIQBAgRFw0AAgAAAFADAABWAwAAYAMAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAA" +
+        "FwAAAHAAAAACAAAACgAAAMwAAAADAAAAAwAAAPQAAAAEAAAAAQAAABgBAAAFAAAABQAAACABAAAG" +
+        "AAAAAQAAAEgBAAACIAAAFwAAAGgBAAABEAAAAgAAAMwCAAADIAAAAgAAANwCAAABIAAAAgAAAPAC" +
+        "AAAAIAAAAQAAAEADAAAEIAAAAgAAAFADAAADEAAAAQAAAGADAAAGIAAAAQAAAGwDAAAAEAAAAQAA" +
+        "AHwDAAA="));
+
+  public static void run() throws Exception {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform(), new Transform2());
+  }
+
+  public static void doTest(final Transform t1, final Transform2 t2) throws Exception {
+    t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+    t1.sayHi(() -> {
+      t2.sayHi(() -> {
+        System.out.println("transforming calling functions");
+        Redefinition.doMultiClassRedefinition(VALID_DEFINITION_T1, VALID_DEFINITION_T2);
+      });
+    });
+    t1.sayHi(() -> { t2.sayHi(() -> { System.out.println("Not doing anything here"); }); });
+  }
+}
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
index da59c74..38c1d36 100644
--- a/test/930-hello-retransform/src/Main.java
+++ b/test/930-hello-retransform/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,57 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
-    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test930.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi();
-    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class);
-    t.sayHi();
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
deleted file mode 100644
index 8e8af35..0000000
--- a/test/930-hello-retransform/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/930-hello-retransform/src/art/Redefinition.java b/test/930-hello-retransform/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/930-hello-retransform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/art/Test930.java b/test/930-hello-retransform/src/art/Test930.java
new file mode 100644
index 0000000..6c0fc16
--- /dev/null
+++ b/test/930-hello-retransform/src/art/Test930.java
@@ -0,0 +1,78 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test930 {
+
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMwLmphdmEMAAcA" +
+    "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MzAkVHJhbnNmb3JtAQAJ" +
+    "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+    "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+    "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTMwACAABQAGAAAA" +
+    "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+    "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+    "AQAFABQAFgAI");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBsgu9qAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+    "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+    "TGFydC9UZXN0OTMwJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMDsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+    "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+    "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+    "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTMwLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+    "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    Redefinition.addCommonTransformationResult("art/Test930$Transform", CLASS_BYTES, DEX_BYTES);
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+}
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
index 14e5da0..fba40f6 100644
--- a/test/932-transform-saves/src/Main.java
+++ b/test/932-transform-saves/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,103 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("hello");
-   *   }
-   * }
-   */
-  private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
-      "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-      "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-      "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
-      "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
-      "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
-      "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
-      "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
-  private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
-      "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-      "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-      "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
-      "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-      "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
-      "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
-      "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
-      "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
-      "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
-      "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
-      "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-      "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-      "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
-    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
-  private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test932.run();
   }
-
-  public static void doTest(Transform t) {
-    // TODO We currently need to do this transform call since we don't have any way to make the
-    // original-dex-file a single-class dex-file letting us restore it easily. We should use the
-    // manipulation library that is being made when we store the original dex file.
-    // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
-    // is one we can return to unaltered.
-    doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
-    t.sayHi();
-
-    // Now turn it into DEX_BYTES_B so it says 'Goodbye'
-    addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class);
-    t.sayHi();
-
-    // Now turn it back to normal by removing the load-hook and transforming again.
-    enableCommonRetransformation(false);
-    doCommonClassRetransformation(Transform.class);
-    t.sayHi();
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_bytes,
-                                                       byte[] dex_bytes);
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
deleted file mode 100644
index 83f7aa4..0000000
--- a/test/932-transform-saves/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("foobar");
-  }
-}
diff --git a/test/932-transform-saves/src/art/Redefinition.java b/test/932-transform-saves/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/932-transform-saves/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/art/Test932.java b/test/932-transform-saves/src/art/Test932.java
new file mode 100644
index 0000000..3a62232
--- /dev/null
+++ b/test/932-transform-saves/src/art/Test932.java
@@ -0,0 +1,129 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test932 {
+
+  // This class is never used so just have it print out a bogus value so we can detect if something
+  // goes very wrong.
+  static class Transform {
+    public void sayHi() {
+      System.out.println("foobar");
+    }
+  }
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("hello");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+    "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMyLmphdmEMAAcA" +
+    "CAcAGQwAGgAbAQAFaGVsbG8HABwMAB0AHgcAHwEAFWFydC9UZXN0OTMyJFRyYW5zZm9ybQEACVRy" +
+    "YW5zZm9ybQEADElubmVyQ2xhc3NlcwEAEGphdmEvbGFuZy9PYmplY3QBABBqYXZhL2xhbmcvU3lz" +
+    "dGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQATamF2YS9pby9QcmludFN0cmVhbQEA" +
+    "B3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAAthcnQvVGVzdDkzMgAgAAUABgAAAAAA" +
+    "AgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAUAAQALAAgAAQAJAAAA" +
+    "JQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAABwAIAAgAAgAMAAAAAgANABcAAAAKAAEA" +
+    "BQAUABYACA==");
+  private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAngjnzAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAZQEAAHQBAACYAQAAuAEAAM8BAADjAQAA9wEAAAsCAAAZAgAAJAIAACcCAAArAgAAOAIA" +
+    "AD8CAABFAgAASgIAAFMCAABaAgAAAQAAAAIAAAADAAAABAAAAAUAAAAGAAAABwAAAAgAAAALAAAA" +
+    "CwAAAAgAAAAAAAAADAAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAJAAAA5AIAALgCAAAAAAAABjxpbml0PgAXTGFydC9UZXN0" +
+    "OTMyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMjsAIkxkYWx2aWsvYW5ub3RhdGlvbi9FbmNsb3Np" +
+    "bmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEvaW8vUHJpbnRT" +
+    "dHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFu" +
+    "Zy9TeXN0ZW07AAxUZXN0OTMyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAAVo" +
+    "ZWxsbwAEbmFtZQADb3V0AAdwcmludGxuAAVzYXlIaQAFdmFsdWUAAAAAAQAAAAYAAAAFAAcOAAcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQ4A" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg0ECA8XCgACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+    "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTMyLmphdmEMAAcA" +
+    "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5MzIkVHJhbnNmb3JtAQAJ" +
+    "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+    "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+    "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTMyACAABQAGAAAA" +
+    "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+    "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+    "AQAFABQAFgAI");
+  private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+    "ZGV4CjAzNQByglN3AAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+    "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+    "TGFydC9UZXN0OTMyJFRyYW5zZm9ybTsADUxhcnQvVGVzdDkzMjsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+    "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+    "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+    "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTMyLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+    "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    // TODO We currently need to do this transform call since we don't have any way to make the
+    // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+    // manipulation library that is being made when we store the original dex file.
+    // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+    // is one we can return to unaltered.
+    Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+    t.sayHi();
+
+    // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+    Redefinition.addCommonTransformationResult("art/Test932$Transform", CLASS_BYTES_B, DEX_BYTES_B);
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+
+    // Now turn it back to normal by removing the load-hook and transforming again.
+    Redefinition.enableCommonRetransformation(false);
+    Redefinition.doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+}
diff --git a/test/934-load-transform/src/Main.java b/test/934-load-transform/src/Main.java
index 606ce78..69c839f 100644
--- a/test/934-load-transform/src/Main.java
+++ b/test/934-load-transform/src/Main.java
@@ -14,6 +14,10 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.addCommonTransformationResult;
+import static art.Redefinition.enableCommonRetransformation;
+import static art.Redefinition.setPopRetransformations;
+
 import java.lang.reflect.*;
 import java.util.Base64;
 
@@ -86,11 +90,4 @@
       e.printStackTrace();
     }
   }
-
-  private static native void setPopRetransformations(boolean should_pop);
-  // Transforms the class
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/934-load-transform/src/art/Redefinition.java b/test/934-load-transform/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/934-load-transform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/935-non-retransformable/src/Main.java b/test/935-non-retransformable/src/Main.java
index df92561..f240224 100644
--- a/test/935-non-retransformable/src/Main.java
+++ b/test/935-non-retransformable/src/Main.java
@@ -17,6 +17,8 @@
 import java.lang.reflect.*;
 import java.util.Base64;
 
+import art.Redefinition;
+
 class Main {
   public static String TEST_NAME = "935-non-retransformable";
 
@@ -74,10 +76,9 @@
   }
 
   public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    setPopRetransformations(false);
-    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
-    enableCommonRetransformation(true);
+    Redefinition.setPopRetransformations(false);
+    Redefinition.addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    Redefinition.enableCommonRetransformation(true);
     try {
       /* this is the "alternate" DEX/Jar file */
       ClassLoader new_loader = getClassLoaderFor(System.getenv("DEX_LOCATION"));
@@ -89,23 +90,14 @@
       run_test.invoke(null);
 
       // Remove the original transformation. It has been used by now.
-      popTransformationFor("Transform");
+      Redefinition.popTransformationFor("Transform");
       // Make sure we don't get called for transformation again.
-      addCommonTransformationResult("Transform", new byte[0], new byte[0]);
-      doCommonClassRetransformation(new_loader.loadClass("Transform"));
+      Redefinition.addCommonTransformationResult("Transform", new byte[0], new byte[0]);
+      Redefinition.doCommonClassRetransformation(new_loader.loadClass("Transform"));
       run_test.invoke(null);
     } catch (Exception e) {
       System.out.println(e.toString());
       e.printStackTrace();
     }
   }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... classes);
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
-  private static native void setPopRetransformations(boolean should_pop);
-  private static native void popTransformationFor(String target_name);
 }
diff --git a/test/935-non-retransformable/src/art/Redefinition.java b/test/935-non-retransformable/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/935-non-retransformable/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/937-hello-retransform-package/src/Main.java b/test/937-hello-retransform-package/src/Main.java
index 866f75d..eef56c2 100644
--- a/test/937-hello-retransform-package/src/Main.java
+++ b/test/937-hello-retransform-package/src/Main.java
@@ -17,6 +17,8 @@
 import java.util.Base64;
 
 import testing.*;
+import art.Redefinition;
+
 public class Main {
 
   /**
@@ -53,22 +55,14 @@
     "YgEAAAMgAAACAAAAGwIAAAAgAAABAAAAJgIAAAAQAAABAAAANAIAAA==");
 
   public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
     doTest(new Transform());
   }
 
   public static void doTest(Transform t) {
     t.sayHi();
-    addCommonTransformationResult("testing/Transform", CLASS_BYTES, DEX_BYTES);
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class);
+    Redefinition.addCommonTransformationResult("testing/Transform", CLASS_BYTES, DEX_BYTES);
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class);
     t.sayHi();
   }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/937-hello-retransform-package/src/art/Redefinition.java b/test/937-hello-retransform-package/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/937-hello-retransform-package/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/938-load-transform-bcp/src/Main.java b/test/938-load-transform-bcp/src/Main.java
index 21b841f..e560942 100644
--- a/test/938-load-transform-bcp/src/Main.java
+++ b/test/938-load-transform-bcp/src/Main.java
@@ -14,6 +14,7 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.*;
 import java.lang.reflect.*;
 import java.util.Base64;
 
@@ -114,11 +115,4 @@
       e.printStackTrace();
     }
   }
-
-  private static native void setPopRetransformations(boolean should_pop);
-  // Transforms the class
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/938-load-transform-bcp/src/art/Redefinition.java b/test/938-load-transform-bcp/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/938-load-transform-bcp/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/939-hello-transformation-bcp/src/Main.java b/test/939-hello-transformation-bcp/src/Main.java
index 0e1f845..7bda667 100644
--- a/test/939-hello-transformation-bcp/src/Main.java
+++ b/test/939-hello-transformation-bcp/src/Main.java
@@ -14,6 +14,7 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.doCommonClassRedefinition;
 import java.util.Base64;
 import java.util.OptionalLong;
 public class Main {
@@ -110,7 +111,6 @@
     "AABHBgAABCAAAAIAAACVBgAAACAAAAEAAACtBgAAABAAAAEAAAD4BgAA");
 
   public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
     // OptionalLong is a class that is unlikely to be used by the time this test starts and is not
     // likely to be changed in any meaningful way in the future.
     OptionalLong ol = OptionalLong.of(0xDEADBEEF);
@@ -119,9 +119,4 @@
     doCommonClassRedefinition(OptionalLong.class, CLASS_BYTES, DEX_BYTES);
     System.out.println("ol.toString() -> '" + ol.toString() + "'");
   }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/939-hello-transformation-bcp/src/art/Redefinition.java b/test/939-hello-transformation-bcp/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/939-hello-transformation-bcp/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/940-recursive-obsolete/src/Main.java b/test/940-recursive-obsolete/src/Main.java
index 724f82d..0b0211c 100644
--- a/test/940-recursive-obsolete/src/Main.java
+++ b/test/940-recursive-obsolete/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,77 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-
-  // class Transform {
-  //   public void sayHi(int recur, Runnable r) {
-  //     System.out.println("Hello" + recur + " - transformed");
-  //     if (recur == 1) {
-  //       r.run();
-  //       sayHi(recur - 1, r);
-  //     } else if (recur != 0) {
-  //       sayHi(recur - 1, r);
-  //     }
-  //     System.out.println("Goodbye" + recur + " - transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQANwoADwAZCQAaABsHABwKAAMAGQgAHQoAAwAeCgADAB8IACAKAAMAIQoAIgAjCwAk" +
-    "ACUKAA4AJggAJwcAKAcAKQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
-    "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADVN0YWNrTWFwVGFibGUBAApTb3Vy" +
-    "Y2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQcAKgwAKwAsAQAXamF2YS9sYW5nL1N0cmluZ0J1" +
-    "aWxkZXIBAAVIZWxsbwwALQAuDAAtAC8BAA4gLSB0cmFuc2Zvcm1lZAwAMAAxBwAyDAAzADQHADUM" +
-    "ADYAEQwAFAAVAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFuZy9PYmplY3QBABBqYXZh" +
-    "L2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07AQAGYXBwZW5kAQAtKExq" +
-    "YXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7AQAcKEkpTGphdmEvbGFu" +
-    "Zy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5nL1N0cmluZzsBABNqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAEmphdmEv" +
-    "bGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAgAAABAAEQABABIAAAAdAAEAAQAAAAUqtwAB" +
-    "sQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAnQADAAMAAABfsgACuwADWbcABBIFtgAGG7YA" +
-    "BxIItgAGtgAJtgAKGwSgABQsuQALAQAqGwRkLLYADKcADxuZAAsqGwRkLLYADLIAArsAA1m3AAQS" +
-    "DbYABhu2AAcSCLYABrYACbYACrEAAAACABMAAAAiAAgAAAADAB4ABAAjAAUAKQAGADQABwA4AAgA" +
-    "QAAKAF4ACwAWAAAABAACNAsAAQAXAAAAAgAY");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQA3pkIgnymz2/eri+mp2dyZo3jolQmaRPKEBAAAcAAAAHhWNBIAAAAAAAAAAOQDAAAa" +
-    "AAAAcAAAAAkAAADYAAAABgAAAPwAAAABAAAARAEAAAkAAABMAQAAAQAAAJQBAADQAgAAtAEAAJwC" +
-    "AACsAgAAtAIAAL0CAADEAgAAxwIAAMoCAADOAgAA0gIAAN8CAAD2AgAACgMAACADAAA0AwAATwMA" +
-    "AGMDAABzAwAAdgMAAHsDAAB/AwAAhwMAAJsDAACgAwAAqQMAAK4DAAC1AwAABAAAAAgAAAAJAAAA" +
-    "CgAAAAsAAAAMAAAADQAAAA4AAAAQAAAABQAAAAUAAAAAAAAABgAAAAYAAACEAgAABwAAAAYAAACM" +
-    "AgAAEAAAAAgAAAAAAAAAEQAAAAgAAACUAgAAEgAAAAgAAACMAgAABwACABUAAAABAAMAAQAAAAEA" +
-    "BAAYAAAAAgAFABYAAAADAAMAAQAAAAQAAwAXAAAABgADAAEAAAAGAAEAEwAAAAYAAgATAAAABgAA" +
-    "ABkAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAADWAwAAAAAAAAEAAQABAAAAvwMAAAQAAABwEAMA" +
-    "AAAOAAYAAwADAAAAxAMAAFQAAABiAAAAIgEGAHAQBQABABsCAwAAAG4gBwAhAAwBbiAGAEEADAEb" +
-    "AgAAAABuIAcAIQAMAW4QCAABAAwBbiACABAAEhAzBCsAchAEAAUA2AAE/24wAQADBWIAAAAiAQYA" +
-    "cBAFAAEAGwICAAAAbiAHACEADAFuIAYAQQAMARsCAAAAAG4gBwAhAAwBbhAIAAEADAFuIAIAEAAO" +
-    "ADgE3//YAAT/bjABAAMFKNgBAAAAAAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQA" +
-    "Bjxpbml0PgAHR29vZGJ5ZQAFSGVsbG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxl" +
-    "OwASTGphdmEvbGFuZy9TdHJpbmc7ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9s" +
-    "YW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6" +
-    "IGphY2stNC4yNAADb3V0AAdwcmludGxuAANydW4ABXNheUhpAAh0b1N0cmluZwABAAcOAAMCAAAH" +
-    "DgEgDzw8XQEgDxktAAAAAQEAgIAEtAMBAcwDDQAAAAAAAAABAAAAAAAAAAEAAAAaAAAAcAAAAAIA" +
-    "AAAJAAAA2AAAAAMAAAAGAAAA/AAAAAQAAAABAAAARAEAAAUAAAAJAAAATAEAAAYAAAABAAAAlAEA" +
-    "AAEgAAACAAAAtAEAAAEQAAADAAAAhAIAAAIgAAAaAAAAnAIAAAMgAAACAAAAvwMAAAAgAAABAAAA" +
-    "1gMAAAAQAAABAAAA5AMAAA==");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test940.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
-    t.sayHi(2, () -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    });
-    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/940-recursive-obsolete/src/Transform.java b/test/940-recursive-obsolete/src/Transform.java
deleted file mode 100644
index 97522cd..0000000
--- a/test/940-recursive-obsolete/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(int recur, Runnable r) {
-    System.out.println("hello" + recur);
-    if (recur == 1) {
-      r.run();
-      sayHi(recur - 1, r);
-    } else if (recur != 0) {
-      sayHi(recur - 1, r);
-    }
-    System.out.println("goodbye" + recur);
-  }
-}
diff --git a/test/940-recursive-obsolete/src/art/Redefinition.java b/test/940-recursive-obsolete/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/940-recursive-obsolete/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/940-recursive-obsolete/src/art/Test940.java b/test/940-recursive-obsolete/src/art/Test940.java
new file mode 100644
index 0000000..d67d772
--- /dev/null
+++ b/test/940-recursive-obsolete/src/art/Test940.java
@@ -0,0 +1,106 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test940 {
+
+  static class Transform {
+    public void sayHi(int recur, Runnable r) {
+      System.out.println("hello" + recur);
+      if (recur == 1) {
+        r.run();
+        sayHi(recur - 1, r);
+      } else if (recur != 0) {
+        sayHi(recur - 1, r);
+      }
+      System.out.println("goodbye" + recur);
+    }
+  }
+
+
+  // static class Transform {
+  //   public void sayHi(int recur, Runnable r) {
+  //     System.out.println("Hello" + recur + " - transformed");
+  //     if (recur == 1) {
+  //       r.run();
+  //       sayHi(recur - 1, r);
+  //     } else if (recur != 0) {
+  //       sayHi(recur - 1, r);
+  //     }
+  //     System.out.println("Goodbye" + recur + " - transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAOwoADwAZCQAaABsHABwKAAMAGQgAHQoAAwAeCgADAB8IACAKAAMAIQoAIgAjCwAk" +
+    "ACUKAA4AJggAJwcAKQcALAEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+    "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADVN0YWNrTWFwVGFibGUBAApTb3Vy" +
+    "Y2VGaWxlAQAMVGVzdDk0MC5qYXZhDAAQABEHAC0MAC4ALwEAF2phdmEvbGFuZy9TdHJpbmdCdWls" +
+    "ZGVyAQAFSGVsbG8MADAAMQwAMAAyAQAOIC0gdHJhbnNmb3JtZWQMADMANAcANQwANgA3BwA4DAA5" +
+    "ABEMABQAFQEAB0dvb2RieWUHADoBABVhcnQvVGVzdDk0MCRUcmFuc2Zvcm0BAAlUcmFuc2Zvcm0B" +
+    "AAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291" +
+    "dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEABmFwcGVuZAEALShMamF2YS9sYW5nL1N0cmluZzsp" +
+    "TGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEAHChJKUxqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcjsB" +
+    "AAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9TdHJpbmc7AQATamF2YS9pby9QcmludFN0cmVhbQEA" +
+    "B3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xhbmcvUnVubmFibGUBAANy" +
+    "dW4BAAthcnQvVGVzdDk0MAAgAA4ADwAAAAAAAgAAABAAEQABABIAAAAdAAEAAQAAAAUqtwABsQAA" +
+    "AAEAEwAAAAYAAQAAAAUAAQAUABUAAQASAAAAnQADAAMAAABfsgACuwADWbcABBIFtgAGG7YABxII" +
+    "tgAGtgAJtgAKGwSgABQsuQALAQAqGwRkLLYADKcADxuZAAsqGwRkLLYADLIAArsAA1m3AAQSDbYA" +
+    "Bhu2AAcSCLYABrYACbYACrEAAAACABMAAAAiAAgAAAAHAB4ACAAjAAkAKQAKADQACwA4AAwAQAAO" +
+    "AF4ADwAWAAAABAACNAsAAgAXAAAAAgAYACsAAAAKAAEADgAoACoACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQDQv3jgAAAAAAAAAAAAAAAAAAAAAAAAAAB8BQAAcAAAAHhWNBIAAAAAAAAAALgEAAAg" +
+    "AAAAcAAAAAwAAADwAAAABgAAACABAAABAAAAaAEAAAkAAABwAQAAAQAAALgBAACkAwAA2AEAANgB" +
+    "AADoAQAA8AEAAPkBAAAAAgAAAwIAAAYCAAAKAgAADgIAACcCAAA2AgAAWgIAAHoCAACRAgAApQIA" +
+    "ALsCAADPAgAA6gIAAP4CAAAMAwAAFwMAABoDAAAfAwAAIwMAADADAAA4AwAAPgMAAEMDAABMAwAA" +
+    "UQMAAFgDAABiAwAABAAAAAgAAAAJAAAACgAAAAsAAAAMAAAADQAAAA4AAAAPAAAAEAAAABEAAAAU" +
+    "AAAABQAAAAgAAAAAAAAABgAAAAkAAAB8AwAABwAAAAkAAAB0AwAAFAAAAAsAAAAAAAAAFQAAAAsA" +
+    "AABsAwAAFgAAAAsAAAB0AwAACgAFABoAAAABAAMAAQAAAAEABAAdAAAABQAFABsAAAAGAAMAAQAA" +
+    "AAcAAwAcAAAACQADAAEAAAAJAAEAGAAAAAkAAgAYAAAACQAAAB4AAAABAAAAAAAAAAYAAAAAAAAA" +
+    "EgAAAKgEAAB8BAAAAAAAAA4gLSB0cmFuc2Zvcm1lZAAGPGluaXQ+AAdHb29kYnllAAVIZWxsbwAB" +
+    "SQABTAACTEkAAkxMABdMYXJ0L1Rlc3Q5NDAkVHJhbnNmb3JtOwANTGFydC9UZXN0OTQwOwAiTGRh" +
+    "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+    "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+    "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAZTGphdmEvbGFuZy9TdHJpbmdCdWls" +
+    "ZGVyOwASTGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQwLmphdmEACVRyYW5zZm9ybQABVgADVklM" +
+    "AAJWTAALYWNjZXNzRmxhZ3MABmFwcGVuZAAEbmFtZQADb3V0AAdwcmludGxuAANydW4ABXNheUhp" +
+    "AAh0b1N0cmluZwAFdmFsdWUAAAAAAgAAAAAABwABAAAACAAAAAEAAAAAAAAABQAHDgAHAgAABw4B" +
+    "IA8BAw8BAw8BBRIBIA8BAQoBAg8AAAAAAQABAAEAAACEAwAABAAAAHAQAwAAAA4ABgADAAMAAACJ" +
+    "AwAAVQAAAGIAAAAiAQkAcBAFAAEAGwIDAAAAbiAHACEADAFuIAYAQQAMARsCAAAAAG4gBwAhAAwB" +
+    "bhAIAAEADAFuIAIAEAASEDMEKwByEAQABQDYAAT/bjABAAMFYgAAACIBCQBwEAUAAQAbAgIAAABu" +
+    "IAcAIQAMAW4gBgBBAAwBGwIAAAAAbiAHACEADAFuEAgAAQAMAW4gAgAQAA4AOATf/9gABP9uMAEA" +
+    "AwUpANj/AAAAAAEBAICABKgHAQHABwAAAgMBHxgCAgQCFwQIGRcTAAIAAACMBAAAkgQAAJwEAAAA" +
+    "AAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAACAAAABwAAAAAgAAAAwAAADwAAAAAwAAAAYA" +
+    "AAAgAQAABAAAAAEAAABoAQAABQAAAAkAAABwAQAABgAAAAEAAAC4AQAAAiAAACAAAADYAQAAARAA" +
+    "AAMAAABsAwAAAyAAAAIAAACEAwAAASAAAAIAAACoAwAAACAAAAEAAAB8BAAABCAAAAIAAACMBAAA" +
+    "AxAAAAEAAACcBAAABiAAAAEAAACoBAAAABAAAAEAAAC4BAAA");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+    t.sayHi(2, () -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    });
+    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/941-recurive-obsolete-jit/src/Main.java b/test/941-recurive-obsolete-jit/src/Main.java
index d88bb9b..1c391a4 100644
--- a/test/941-recurive-obsolete-jit/src/Main.java
+++ b/test/941-recurive-obsolete-jit/src/Main.java
@@ -14,6 +14,8 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.doCommonClassRedefinition;
+
 import java.util.Base64;
 import java.util.function.Consumer;
 import java.lang.reflect.Method;
@@ -148,9 +150,4 @@
   private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
 
   private static native void ensureJitCompiled(Class c, String name);
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/941-recurive-obsolete-jit/src/art/Redefinition.java b/test/941-recurive-obsolete-jit/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/941-recurive-obsolete-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/942-private-recursive/src/Main.java b/test/942-private-recursive/src/Main.java
index cac75c0..8a1f7c6 100644
--- a/test/942-private-recursive/src/Main.java
+++ b/test/942-private-recursive/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,82 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-
-  // class Transform {
-  //   public void sayHi(int recur, Runnable r) {
-  //     privateSayHi(recur, r);
-  //   }
-  //   private void privateSayHi(int recur, Runnable r) {
-  //     System.out.println("Hello" + recur + " - transformed");
-  //     if (recur == 1) {
-  //       r.run();
-  //       privateSayHi(recur - 1, r);
-  //     } else if (recur != 0) {
-  //       privateSayHi(recur - 1, r);
-  //     }
-  //     System.out.println("Goodbye" + recur + " - transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAOAoADwAaCgAOABsJABwAHQcAHgoABAAaCAAfCgAEACAKAAQAIQgAIgoABAAjCgAk" +
-    "ACULACYAJwgAKAcAKQcAKgEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
-    "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADHByaXZhdGVTYXlIaQEADVN0YWNr" +
-    "TWFwVGFibGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMABAAEQwAFgAVBwArDAAsAC0B" +
-    "ABdqYXZhL2xhbmcvU3RyaW5nQnVpbGRlcgEABUhlbGxvDAAuAC8MAC4AMAEADiAtIHRyYW5zZm9y" +
-    "bWVkDAAxADIHADMMADQANQcANgwANwARAQAHR29vZGJ5ZQEACVRyYW5zZm9ybQEAEGphdmEvbGFu" +
-    "Zy9PYmplY3QBABBqYXZhL2xhbmcvU3lzdGVtAQADb3V0AQAVTGphdmEvaW8vUHJpbnRTdHJlYW07" +
-    "AQAGYXBwZW5kAQAtKExqYXZhL2xhbmcvU3RyaW5nOylMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7" +
-    "AQAcKEkpTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEACHRvU3RyaW5nAQAUKClMamF2YS9sYW5n" +
-    "L1N0cmluZzsBABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0" +
-    "cmluZzspVgEAEmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgAgAA4ADwAAAAAAAwAAABAAEQABABIA" +
-    "AAAdAAEAAQAAAAUqtwABsQAAAAEAEwAAAAYAAQAAAAEAAQAUABUAAQASAAAAIwADAAMAAAAHKhss" +
-    "twACsQAAAAEAEwAAAAoAAgAAAAMABgAEAAIAFgAVAAEAEgAAAJ0AAwADAAAAX7IAA7sABFm3AAUS" +
-    "BrYABxu2AAgSCbYAB7YACrYACxsEoAAULLkADAEAKhsEZCy3AAKnAA8bmQALKhsEZCy3AAKyAAO7" +
-    "AARZtwAFEg22AAcbtgAIEgm2AAe2AAq2AAuxAAAAAgATAAAAIgAIAAAABgAeAAcAIwAIACkACQA0" +
-    "AAoAOAALAEAADQBeAA4AFwAAAAQAAjQLAAEAGAAAAAIAGQ==");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQBQqwVIiZvIuS8j1HDurKbXZEV62Mnug5PEBAAAcAAAAHhWNBIAAAAAAAAAACQEAAAb" +
-    "AAAAcAAAAAkAAADcAAAABgAAAAABAAABAAAASAEAAAoAAABQAQAAAQAAAKABAAAEAwAAwAEAAMAC" +
-    "AADQAgAA2AIAAOECAADoAgAA6wIAAO4CAADyAgAA9gIAAAMDAAAaAwAALgMAAEQDAABYAwAAcwMA" +
-    "AIcDAACXAwAAmgMAAJ8DAACjAwAAqwMAAL8DAADEAwAAzQMAANsDAADgAwAA5wMAAAQAAAAIAAAA" +
-    "CQAAAAoAAAALAAAADAAAAA0AAAAOAAAAEAAAAAUAAAAFAAAAAAAAAAYAAAAGAAAAqAIAAAcAAAAG" +
-    "AAAAsAIAABAAAAAIAAAAAAAAABEAAAAIAAAAuAIAABIAAAAIAAAAsAIAAAcAAgAVAAAAAQADAAEA" +
-    "AAABAAQAFwAAAAEABAAZAAAAAgAFABYAAAADAAMAAQAAAAQAAwAYAAAABgADAAEAAAAGAAEAEwAA" +
-    "AAYAAgATAAAABgAAABoAAAABAAAAAAAAAAMAAAAAAAAADwAAAAAAAAAQBAAAAAAAAAEAAQABAAAA" +
-    "8QMAAAQAAABwEAQAAAAOAAYAAwADAAAA9gMAAFQAAABiAAAAIgEGAHAQBgABABsCAwAAAG4gCAAh" +
-    "AAwBbiAHAEEADAEbAgAAAABuIAgAIQAMAW4QCQABAAwBbiADABAAEhAzBCsAchAFAAUA2AAE/3Aw" +
-    "AQADBWIAAAAiAQYAcBAGAAEAGwICAAAAbiAIACEADAFuIAcAQQAMARsCAAAAAG4gCAAhAAwBbhAJ" +
-    "AAEADAFuIAMAEAAOADgE3//YAAT/cDABAAMFKNgDAAMAAwAAAAgEAAAEAAAAcDABABACDgABAAAA" +
-    "AAAAAAEAAAAFAAAAAgAAAAAABAAOIC0gdHJhbnNmb3JtZWQABjxpbml0PgAHR29vZGJ5ZQAFSGVs" +
-    "bG8AAUkAAUwAAkxJAAJMTAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGph" +
-    "dmEvbGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7" +
-    "ABlMamF2YS9sYW5nL1N0cmluZ0J1aWxkZXI7ABJMamF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9y" +
-    "bS5qYXZhAAFWAANWSUwAAlZMAAZhcHBlbmQAEmVtaXR0ZXI6IGphY2stNC4yNAADb3V0AAdwcmlu" +
-    "dGxuAAxwcml2YXRlU2F5SGkAA3J1bgAFc2F5SGkACHRvU3RyaW5nAAEABw4ABgIAAAcOASAPPDxd" +
-    "ASAPGS0AAwIAAAcOPAAAAAIBAICABMADAQLYAwIBkAUAAA0AAAAAAAAAAQAAAAAAAAABAAAAGwAA" +
-    "AHAAAAACAAAACQAAANwAAAADAAAABgAAAAABAAAEAAAAAQAAAEgBAAAFAAAACgAAAFABAAAGAAAA" +
-    "AQAAAKABAAABIAAAAwAAAMABAAABEAAAAwAAAKgCAAACIAAAGwAAAMACAAADIAAAAwAAAPEDAAAA" +
-    "IAAAAQAAABAEAAAAEAAAAQAAACQEAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test942.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
-    t.sayHi(2, () -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    });
-    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/942-private-recursive/src/Transform.java b/test/942-private-recursive/src/Transform.java
deleted file mode 100644
index 7714326..0000000
--- a/test/942-private-recursive/src/Transform.java
+++ /dev/null
@@ -1,32 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  private void privateSayHi(int recur, Runnable r) {
-    System.out.println("hello" + recur);
-    if (recur == 1) {
-      r.run();
-      privateSayHi(recur - 1, r);
-    } else if (recur != 0) {
-      privateSayHi(recur - 1, r);
-    }
-    System.out.println("goodbye" + recur);
-  }
-
-  public void sayHi(int recur, Runnable r) {
-    privateSayHi(recur, r);
-  }
-}
diff --git a/test/942-private-recursive/src/art/Redefinition.java b/test/942-private-recursive/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/942-private-recursive/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/942-private-recursive/src/art/Test942.java b/test/942-private-recursive/src/art/Test942.java
new file mode 100644
index 0000000..cccc2fd
--- /dev/null
+++ b/test/942-private-recursive/src/art/Test942.java
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test942 {
+
+  static class Transform {
+    private void privateSayHi(int recur, Runnable r) {
+      System.out.println("hello" + recur);
+      if (recur == 1) {
+        r.run();
+        privateSayHi(recur - 1, r);
+      } else if (recur != 0) {
+        privateSayHi(recur - 1, r);
+      }
+      System.out.println("goodbye" + recur);
+    }
+
+    public void sayHi(int recur, Runnable r) {
+      privateSayHi(recur, r);
+    }
+  }
+
+
+  // static class Transform {
+  //   public void sayHi(int recur, Runnable r) {
+  //     privateSayHi(recur, r);
+  //   }
+  //   private void privateSayHi(int recur, Runnable r) {
+  //     System.out.println("Hello" + recur + " - transformed");
+  //     if (recur == 1) {
+  //       r.run();
+  //       privateSayHi(recur - 1, r);
+  //     } else if (recur != 0) {
+  //       privateSayHi(recur - 1, r);
+  //     }
+  //     System.out.println("Goodbye" + recur + " - transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAPAoADwAaCgAOABsJABwAHQcAHgoABAAaCAAfCgAEACAKAAQAIQgAIgoABAAjCgAk" +
+    "ACULACYAJwgAKAcAKgcALQEABjxpbml0PgEAAygpVgEABENvZGUBAA9MaW5lTnVtYmVyVGFibGUB" +
+    "AAVzYXlIaQEAGChJTGphdmEvbGFuZy9SdW5uYWJsZTspVgEADHByaXZhdGVTYXlIaQEADVN0YWNr" +
+    "TWFwVGFibGUBAApTb3VyY2VGaWxlAQAMVGVzdDk0Mi5qYXZhDAAQABEMABYAFQcALgwALwAwAQAX" +
+    "amF2YS9sYW5nL1N0cmluZ0J1aWxkZXIBAAVIZWxsbwwAMQAyDAAxADMBAA4gLSB0cmFuc2Zvcm1l" +
+    "ZAwANAA1BwA2DAA3ADgHADkMADoAEQEAB0dvb2RieWUHADsBABVhcnQvVGVzdDk0MiRUcmFuc2Zv" +
+    "cm0BAAlUcmFuc2Zvcm0BAAxJbm5lckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9s" +
+    "YW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEABmFwcGVuZAEALShMamF2" +
+    "YS9sYW5nL1N0cmluZzspTGphdmEvbGFuZy9TdHJpbmdCdWlsZGVyOwEAHChJKUxqYXZhL2xhbmcv" +
+    "U3RyaW5nQnVpbGRlcjsBAAh0b1N0cmluZwEAFCgpTGphdmEvbGFuZy9TdHJpbmc7AQATamF2YS9p" +
+    "by9QcmludFN0cmVhbQEAB3ByaW50bG4BABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBABJqYXZhL2xh" +
+    "bmcvUnVubmFibGUBAANydW4BAAthcnQvVGVzdDk0MgAgAA4ADwAAAAAAAwAAABAAEQABABIAAAAd" +
+    "AAEAAQAAAAUqtwABsQAAAAEAEwAAAAYAAQAAAAUAAQAUABUAAQASAAAAIwADAAMAAAAHKhsstwAC" +
+    "sQAAAAEAEwAAAAoAAgAAAAcABgAIAAIAFgAVAAEAEgAAAJ0AAwADAAAAX7IAA7sABFm3AAUSBrYA" +
+    "Bxu2AAgSCbYAB7YACrYACxsEoAAULLkADAEAKhsEZCy3AAKnAA8bmQALKhsEZCy3AAKyAAO7AARZ" +
+    "twAFEg22AAcbtgAIEgm2AAe2AAq2AAuxAAAAAgATAAAAIgAIAAAACgAeAAsAIwAMACkADQA0AA4A" +
+    "OAAPAEAAEQBeABIAFwAAAAQAAjQLAAIAGAAAAAIAGQAsAAAACgABAA4AKQArAAg=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQDiy6hGAAAAAAAAAAAAAAAAAAAAAAAAAAC4BQAAcAAAAHhWNBIAAAAAAAAAAPQEAAAh" +
+    "AAAAcAAAAAwAAAD0AAAABgAAACQBAAABAAAAbAEAAAoAAAB0AQAAAQAAAMQBAADUAwAA5AEAAOQB" +
+    "AAD0AQAA/AEAAAUCAAAMAgAADwIAABICAAAWAgAAGgIAADMCAABCAgAAZgIAAIYCAACdAgAAsQIA" +
+    "AMcCAADbAgAA9gIAAAoDAAAYAwAAIwMAACYDAAArAwAALwMAADwDAABEAwAASgMAAE8DAABYAwAA" +
+    "ZgMAAGsDAAByAwAAfAMAAAQAAAAIAAAACQAAAAoAAAALAAAADAAAAA0AAAAOAAAADwAAABAAAAAR" +
+    "AAAAFAAAAAUAAAAIAAAAAAAAAAYAAAAJAAAAlAMAAAcAAAAJAAAAjAMAABQAAAALAAAAAAAAABUA" +
+    "AAALAAAAhAMAABYAAAALAAAAjAMAAAoABQAaAAAAAQADAAEAAAABAAQAHAAAAAEABAAeAAAABQAF" +
+    "ABsAAAAGAAMAAQAAAAcAAwAdAAAACQADAAEAAAAJAAEAGAAAAAkAAgAYAAAACQAAAB8AAAABAAAA" +
+    "AAAAAAYAAAAAAAAAEgAAAOQEAAC0BAAAAAAAAA4gLSB0cmFuc2Zvcm1lZAAGPGluaXQ+AAdHb29k" +
+    "YnllAAVIZWxsbwABSQABTAACTEkAAkxMABdMYXJ0L1Rlc3Q5NDIkVHJhbnNmb3JtOwANTGFydC9U" +
+    "ZXN0OTQyOwAiTGRhbHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5v" +
+    "dGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2Jq" +
+    "ZWN0OwAUTGphdmEvbGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwAZTGphdmEvbGFu" +
+    "Zy9TdHJpbmdCdWlsZGVyOwASTGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQyLmphdmEACVRyYW5z" +
+    "Zm9ybQABVgADVklMAAJWTAALYWNjZXNzRmxhZ3MABmFwcGVuZAAEbmFtZQADb3V0AAdwcmludGxu" +
+    "AAxwcml2YXRlU2F5SGkAA3J1bgAFc2F5SGkACHRvU3RyaW5nAAV2YWx1ZQAAAgAAAAAABwABAAAA" +
+    "CAAAAAEAAAAAAAAABQAHDgAKAgAABw4BIA8BAw8BAw8BBRIBIA8BAQoBAg8ABwIAAAcOAQMPAAAB" +
+    "AAEAAQAAAJwDAAAEAAAAcBAEAAAADgAGAAMAAwAAAKEDAABVAAAAYgAAACIBCQBwEAYAAQAbAgMA" +
+    "AABuIAgAIQAMAW4gBwBBAAwBGwIAAAAAbiAIACEADAFuEAkAAQAMAW4gAwAQABIQMwQrAHIQBQAF" +
+    "ANgABP9wMAEAAwViAAAAIgEJAHAQBgABABsCAgAAAG4gCAAhAAwBbiAHAEEADAEbAgAAAABuIAgA" +
+    "IQAMAW4QCQABAAwBbiADABAADgA4BN//2AAE/3AwAQADBSkA2P8AAAMAAwADAAAAvQMAAAQAAABw" +
+    "MAEAEAIOAAAAAgEAgIAEyAcBAuAHAgGcCQAAAgMBIBgCAgQCFwQIGRcTAAIAAADIBAAAzgQAANgE" +
+    "AAAAAAAAAAAAAAAAAAAQAAAAAAAAAAEAAAAAAAAAAQAAACEAAABwAAAAAgAAAAwAAAD0AAAAAwAA" +
+    "AAYAAAAkAQAABAAAAAEAAABsAQAABQAAAAoAAAB0AQAABgAAAAEAAADEAQAAAiAAACEAAADkAQAA" +
+    "ARAAAAMAAACEAwAAAyAAAAMAAACcAwAAASAAAAMAAADIAwAAACAAAAEAAAC0BAAABCAAAAIAAADI" +
+    "BAAAAxAAAAEAAADYBAAABiAAAAEAAADkBAAAABAAAAEAAAD0BAAA");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+    t.sayHi(2, () -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    });
+    t.sayHi(2, () -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/943-private-recursive-jit/src/Main.java b/test/943-private-recursive-jit/src/Main.java
index f380c06..01760ad 100644
--- a/test/943-private-recursive-jit/src/Main.java
+++ b/test/943-private-recursive-jit/src/Main.java
@@ -14,6 +14,8 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.doCommonClassRedefinition;
+
 import java.util.Base64;
 import java.util.function.Consumer;
 import java.lang.reflect.Method;
@@ -164,9 +166,4 @@
   private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
 
   private static native void ensureJitCompiled(Class c, String name);
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/943-private-recursive-jit/src/art/Redefinition.java b/test/943-private-recursive-jit/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/943-private-recursive-jit/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/944-transform-classloaders/classloader.cc b/test/944-transform-classloaders/classloader.cc
deleted file mode 100644
index 698e023..0000000
--- a/test/944-transform-classloaders/classloader.cc
+++ /dev/null
@@ -1,43 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include "android-base/macros.h"
-#include "jni.h"
-#include "jvmti.h"
-#include "mirror/class-inl.h"
-#include "scoped_local_ref.h"
-
-// Test infrastructure
-#include "test_env.h"
-
-namespace art {
-namespace Test944TransformClassloaders {
-
-extern "C" JNIEXPORT jlong JNICALL Java_Main_getDexFilePointer(JNIEnv* env, jclass, jclass klass) {
-  if (Runtime::Current() == nullptr) {
-    env->ThrowNew(env->FindClass("java/lang/Exception"),
-                  "We do not seem to be running in ART! Unable to get dex file.");
-    return 0;
-  }
-  ScopedObjectAccess soa(env);
-  // This sequence of casts must be the same as those done in
-  // runtime/native/dalvik_system_DexFile.cc in order to ensure that we get the same results.
-  return static_cast<jlong>(reinterpret_cast<uintptr_t>(
-      &soa.Decode<mirror::Class>(klass)->GetDexFile()));
-}
-
-}  // namespace Test944TransformClassloaders
-}  // namespace art
diff --git a/test/944-transform-classloaders/src/CommonClassDefinition.java b/test/944-transform-classloaders/src/CommonClassDefinition.java
deleted file mode 100644
index 62602a0..0000000
--- a/test/944-transform-classloaders/src/CommonClassDefinition.java
+++ /dev/null
@@ -1,27 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class CommonClassDefinition {
-  public final Class<?> target;
-  public final byte[] class_file_bytes;
-  public final byte[] dex_file_bytes;
-
-  CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
-    this.target = target;
-    this.class_file_bytes = class_file_bytes;
-    this.dex_file_bytes = dex_file_bytes;
-  }
-}
diff --git a/test/944-transform-classloaders/src/Main.java b/test/944-transform-classloaders/src/Main.java
index b558660..3d76d23 100644
--- a/test/944-transform-classloaders/src/Main.java
+++ b/test/944-transform-classloaders/src/Main.java
@@ -14,254 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Arrays;
-import java.util.ArrayList;
-import java.util.Base64;
-import java.lang.reflect.*;
 public class Main {
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
-      Transform.class,
-      Base64.getDecoder().decode(
-        "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-        "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-        "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-        "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-        "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
-        "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-        "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0="),
-      Base64.getDecoder().decode(
-        "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-        "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-        "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-        "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-        "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-        "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-        "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-        "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-        "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-        "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-        "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-        "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-        "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA="));
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform2 {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye2");
-   *   }
-   * }
-   */
-  private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
-      Transform2.class,
-      Base64.getDecoder().decode(
-        "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-        "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA9UcmFuc2Zvcm0yLmphdmEM" +
-        "AAcACAcAFgwAFwAYAQAIR29vZGJ5ZTIHABkMABoAGwEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcv" +
-        "T2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEA" +
-        "E2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAA" +
-        "BQAGAAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAAQABAAsA" +
-        "CAABAAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAADAAgABAABAAwAAAACAA0="),
-      Base64.getDecoder().decode(
-        "ZGV4CjAzNQABX6vL8OT7aGLjbzFBEfCM9Aaz+zzGzVnQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
-        "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
-        "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
-        "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-        "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
-        "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-        "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
-        "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
-        "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjQA" +
-        "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
-        "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
-        "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
-        "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA"));
-
   public static void main(String[] args) throws Exception {
-    doTest();
-    System.out.println("Passed");
+    art.Test944.run();
   }
-
-  private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
-    if (!klass.isInstance(o)) {
-      throw new Exception(klass + " is not the class of " + o);
-    }
-  }
-
-  private static boolean arrayContains(long[] arr, long value) {
-    if (arr == null) {
-      return false;
-    }
-    for (int i = 0; i < arr.length; i++) {
-      if (arr[i] == value) {
-        return true;
-      }
-    }
-    return false;
-  }
-
-  /**
-   * Checks that we can find the dex-file for the given class in its classloader.
-   *
-   * Throws if it fails.
-   */
-  private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
-    // If all the android BCP classes were availible when compiling this test and access checks
-    // weren't a thing this function would be written as follows:
-    //
-    // long dexFilePtr = getDexFilePointer(klass);
-    // dalvik.system.BaseDexClassLoader loader =
-    //     (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
-    // dalvik.system.DexPathList pathListValue = loader.pathList;
-    // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
-    // int array_length = elementArrayValue.length;
-    // for (int i = 0; i < array_length; i++) {
-    //   dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
-    //   dalvik.system.DexFile curDexFile = curElement.dexFile;
-    //   if (curDexFile == null) {
-    //     continue;
-    //   }
-    //   long[] curCookie = (long[])curDexFile.mCookie;
-    //   long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
-    //   if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
-    //     return;
-    //   }
-    // }
-    // throw new Exception(
-    //     "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
-
-    // Get all the fields and classes we need by reflection.
-    Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
-    Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
-
-    Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
-    Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
-
-    Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
-    Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
-
-    Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
-    Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
-    Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
-
-    // Make all the fields accessible
-    AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
-                                                            elementArrayField,
-                                                            dexFileField,
-                                                            dexFileCookieField,
-                                                            dexFileInternalCookieField }, true);
-
-    long dexFilePtr = getDexFilePointer(klass);
-
-    ClassLoader loader = klass.getClassLoader();
-    checkIsInstance(baseDexClassLoaderClass, loader);
-    // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
-    Object pathListValue = pathListField.get(loader);
-
-    checkIsInstance(dexPathListClass, pathListValue);
-
-    // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
-    Object elementArrayValue = elementArrayField.get(pathListValue);
-    if (!elementArrayValue.getClass().isArray() ||
-        elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
-      throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
-    }
-    // int array_length = elementArrayValue.length;
-    int array_length = Array.getLength(elementArrayValue);
-    for (int i = 0; i < array_length; i++) {
-      // DexPathList.Element curElement = elementArrayValue[i];
-      Object curElement = Array.get(elementArrayValue, i);
-      checkIsInstance(dexPathListElementClass, curElement);
-
-      // DexFile curDexFile = curElement.dexFile;
-      Object curDexFile = dexFileField.get(curElement);
-      if (curDexFile == null) {
-        continue;
-      }
-      checkIsInstance(dexFileClass, curDexFile);
-
-      // long[] curCookie = (long[])curDexFile.mCookie;
-      long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
-      // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
-      long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
-
-      if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
-        return;
-      }
-    }
-    throw new Exception(
-        "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
-  }
-
-  private static void doTest() throws Exception {
-    art.Main.bindAgentJNIForClass(Main.class);
-
-    Transform t = new Transform();
-    Transform2 t2 = new Transform2();
-
-    long initial_t1_dex = getDexFilePointer(Transform.class);
-    long initial_t2_dex = getDexFilePointer(Transform2.class);
-    if (initial_t2_dex != initial_t1_dex) {
-      throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
-                          "have different initial dex files!");
-    }
-    checkDexFileInClassLoader(Transform.class);
-    checkDexFileInClassLoader(Transform2.class);
-
-    // Make sure they are loaded
-    t.sayHi();
-    t2.sayHi();
-    // Redefine both of the classes.
-    doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
-    // Make sure we actually transformed them!
-    t.sayHi();
-    t2.sayHi();
-
-    long final_t1_dex = getDexFilePointer(Transform.class);
-    long final_t2_dex = getDexFilePointer(Transform2.class);
-    if (final_t2_dex == final_t1_dex) {
-      throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
-                          "have the same initial dex files!");
-    } else if (final_t1_dex == initial_t1_dex) {
-      throw new Exception("The class " + Transform.class + " did not get a new dex file!");
-    } else if (final_t2_dex == initial_t2_dex) {
-      throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
-    }
-    // Check to make sure the new dex files are in the class loader.
-    checkDexFileInClassLoader(Transform.class);
-    checkDexFileInClassLoader(Transform2.class);
-  }
-
-  private static void doMultiClassRedefinition(CommonClassDefinition... defs) {
-    ArrayList<Class<?>> classes = new ArrayList<>();
-    ArrayList<byte[]> class_files = new ArrayList<>();
-    ArrayList<byte[]> dex_files = new ArrayList<>();
-
-    for (CommonClassDefinition d : defs) {
-      classes.add(d.target);
-      class_files.add(d.class_file_bytes);
-      dex_files.add(d.dex_file_bytes);
-    }
-    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
-                                   class_files.toArray(new byte[0][]),
-                                   dex_files.toArray(new byte[0][]));
-  }
-
-  // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
-  // DexFile a class is loaded from. This is converted from the DexFile* in the same way it is done
-  // in runtime/native/dalvik_system_DexFile.cc
-  private static native long getDexFilePointer(Class<?> target);
-  // Transforms the classes
-  private static native void doCommonMultiClassRedefinition(Class<?>[] targets,
-                                                            byte[][] classfiles,
-                                                            byte[][] dexfiles);
 }
diff --git a/test/944-transform-classloaders/src/Transform.java b/test/944-transform-classloaders/src/Transform.java
deleted file mode 100644
index 8e8af35..0000000
--- a/test/944-transform-classloaders/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/944-transform-classloaders/src/Transform2.java b/test/944-transform-classloaders/src/Transform2.java
deleted file mode 100644
index eb22842..0000000
--- a/test/944-transform-classloaders/src/Transform2.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
-  public void sayHi() {
-    System.out.println("hello2");
-  }
-}
diff --git a/test/944-transform-classloaders/src/art/Redefinition.java b/test/944-transform-classloaders/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/944-transform-classloaders/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/944-transform-classloaders/src/art/Test944.java b/test/944-transform-classloaders/src/art/Test944.java
new file mode 100644
index 0000000..fe1c024
--- /dev/null
+++ b/test/944-transform-classloaders/src/art/Test944.java
@@ -0,0 +1,297 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.CommonClassDefinition;
+
+import java.util.Arrays;
+import java.util.ArrayList;
+import java.util.Base64;
+import java.lang.reflect.*;
+public class Test944 {
+
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+  static class Transform2 {
+    public void sayHi() {
+      System.out.println("hello2");
+    }
+  }
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static CommonClassDefinition TRANSFORM_DEFINITION = new CommonClassDefinition(
+      Transform.class,
+      Base64.getDecoder().decode(
+        "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+        "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ0LmphdmEMAAcA" +
+        "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5NDQkVHJhbnNmb3JtAQAJ" +
+        "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+        "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+        "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ0ACAABQAGAAAA" +
+        "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAACgABAAsACAABAAkA" +
+        "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAMAAgADQACAAwAAAACAA0AFwAAAAoA" +
+        "AQAFABQAFgAI"),
+      Base64.getDecoder().decode(
+        "ZGV4CjAzNQCFgsuWAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+        "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+        "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+        "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+        "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+        "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+        "TGFydC9UZXN0OTQ0JFRyYW5zZm9ybTsADUxhcnQvVGVzdDk0NDsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+        "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+        "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+        "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQ0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+        "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAKAAcOAAwA" +
+        "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+        "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+        "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+        "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+        "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+        "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA=="));
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform2 {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye2");
+   *   }
+   * }
+   */
+  private static CommonClassDefinition TRANSFORM2_DEFINITION = new CommonClassDefinition(
+      Transform2.class,
+      Base64.getDecoder().decode(
+        "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+        "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ0LmphdmEMAAcA" +
+        "CAcAGQwAGgAbAQAIR29vZGJ5ZTIHABwMAB0AHgcAHwEAFmFydC9UZXN0OTQ0JFRyYW5zZm9ybTIB" +
+        "AApUcmFuc2Zvcm0yAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFu" +
+        "Zy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3Ry" +
+        "ZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ0ACAABQAG" +
+        "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAAB" +
+        "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAA" +
+        "AAoAAQAFABQAFgAI"),
+      Base64.getDecoder().decode(
+        "ZGV4CjAzNQAUg8BCAAAAAAAAAAAAAAAAAAAAAAAAAAC8AwAAcAAAAHhWNBIAAAAAAAAAAPgCAAAU" +
+        "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB4AgAARAEAAEQB" +
+        "AABMAQAAVgEAAHABAAB/AQAAowEAAMMBAADaAQAA7gEAAAICAAAWAgAAJAIAADACAAAzAgAANwIA" +
+        "AEQCAABKAgAATwIAAFgCAABfAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+        "DAAAAAgAAAAAAAAADQAAAAgAAABoAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+        "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA6AIAALwCAAAAAAAABjxpbml0PgAIR29vZGJ5ZTIA" +
+        "GExhcnQvVGVzdDk0NCRUcmFuc2Zvcm0yOwANTGFydC9UZXN0OTQ0OwAiTGRhbHZpay9hbm5vdGF0" +
+        "aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2" +
+        "YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7" +
+        "ABJMamF2YS9sYW5nL1N5c3RlbTsADFRlc3Q5NDQuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2Fj" +
+        "Y2Vzc0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAEAAAAGAAAABQAH" +
+        "DgAHAAcOAQgPAAAAAAEAAQABAAAAcAIAAAQAAABwEAMAAAAOAAMAAQACAAAAdQIAAAkAAABiAAAA" +
+        "GwEBAAAAbiACABAADgAAAAAAAQEAgIAEgAUBAZgFAAACAgETGAECAwIOBAgPFwsAAgAAAMwCAADS" +
+        "AgAA3AIAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAAFAAAAHAAAAACAAAACQAAAMAA" +
+        "AAADAAAAAgAAAOQAAAAEAAAAAQAAAPwAAAAFAAAABAAAAAQBAAAGAAAAAQAAACQBAAACIAAAFAAA" +
+        "AEQBAAABEAAAAQAAAGgCAAADIAAAAgAAAHACAAABIAAAAgAAAIACAAAAIAAAAQAAALwCAAAEIAAA" +
+        "AgAAAMwCAAADEAAAAQAAANwCAAAGIAAAAQAAAOgCAAAAEAAAAQAAAPgCAAA="));
+
+  public static void run() throws Exception {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest();
+    System.out.println("Passed");
+  }
+
+  private static void checkIsInstance(Class<?> klass, Object o) throws Exception {
+    if (!klass.isInstance(o)) {
+      throw new Exception(klass + " is not the class of " + o);
+    }
+  }
+
+  private static boolean arrayContains(long[] arr, long value) {
+    if (arr == null) {
+      return false;
+    }
+    for (int i = 0; i < arr.length; i++) {
+      if (arr[i] == value) {
+        return true;
+      }
+    }
+    return false;
+  }
+
+  /**
+   * Checks that we can find the dex-file for the given class in its classloader.
+   *
+   * Throws if it fails.
+   */
+  private static void checkDexFileInClassLoader(Class<?> klass) throws Exception {
+    // If all the android BCP classes were availible when compiling this test and access checks
+    // weren't a thing this function would be written as follows:
+    //
+    // long dexFilePtr = getDexFilePointer(klass);
+    // dalvik.system.BaseDexClassLoader loader =
+    //     (dalvik.system.BaseDexClassLoader)klass.getClassLoader();
+    // dalvik.system.DexPathList pathListValue = loader.pathList;
+    // dalvik.system.DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+    // int array_length = elementArrayValue.length;
+    // for (int i = 0; i < array_length; i++) {
+    //   dalvik.system.DexPathList.Element curElement = elementArrayValue[i];
+    //   dalvik.system.DexFile curDexFile = curElement.dexFile;
+    //   if (curDexFile == null) {
+    //     continue;
+    //   }
+    //   long[] curCookie = (long[])curDexFile.mCookie;
+    //   long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+    //   if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+    //     return;
+    //   }
+    // }
+    // throw new Exception(
+    //     "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+
+    // Get all the fields and classes we need by reflection.
+    Class<?> baseDexClassLoaderClass = Class.forName("dalvik.system.BaseDexClassLoader");
+    Field pathListField = baseDexClassLoaderClass.getDeclaredField("pathList");
+
+    Class<?> dexPathListClass = Class.forName("dalvik.system.DexPathList");
+    Field elementArrayField = dexPathListClass.getDeclaredField("dexElements");
+
+    Class<?> dexPathListElementClass = Class.forName("dalvik.system.DexPathList$Element");
+    Field dexFileField = dexPathListElementClass.getDeclaredField("dexFile");
+
+    Class<?> dexFileClass = Class.forName("dalvik.system.DexFile");
+    Field dexFileCookieField = dexFileClass.getDeclaredField("mCookie");
+    Field dexFileInternalCookieField = dexFileClass.getDeclaredField("mInternalCookie");
+
+    // Make all the fields accessible
+    AccessibleObject.setAccessible(new AccessibleObject[] { pathListField,
+                                                            elementArrayField,
+                                                            dexFileField,
+                                                            dexFileCookieField,
+                                                            dexFileInternalCookieField }, true);
+
+    long dexFilePtr = getDexFilePointer(klass);
+
+    ClassLoader loader = klass.getClassLoader();
+    checkIsInstance(baseDexClassLoaderClass, loader);
+    // DexPathList pathListValue = ((BaseDexClassLoader) loader).pathList;
+    Object pathListValue = pathListField.get(loader);
+
+    checkIsInstance(dexPathListClass, pathListValue);
+
+    // DexPathList.Element[] elementArrayValue = pathListValue.dexElements;
+    Object elementArrayValue = elementArrayField.get(pathListValue);
+    if (!elementArrayValue.getClass().isArray() ||
+        elementArrayValue.getClass().getComponentType() != dexPathListElementClass) {
+      throw new Exception("elementArrayValue is not an " + dexPathListElementClass + " array!");
+    }
+    // int array_length = elementArrayValue.length;
+    int array_length = Array.getLength(elementArrayValue);
+    for (int i = 0; i < array_length; i++) {
+      // DexPathList.Element curElement = elementArrayValue[i];
+      Object curElement = Array.get(elementArrayValue, i);
+      checkIsInstance(dexPathListElementClass, curElement);
+
+      // DexFile curDexFile = curElement.dexFile;
+      Object curDexFile = dexFileField.get(curElement);
+      if (curDexFile == null) {
+        continue;
+      }
+      checkIsInstance(dexFileClass, curDexFile);
+
+      // long[] curCookie = (long[])curDexFile.mCookie;
+      long[] curCookie = (long[])dexFileCookieField.get(curDexFile);
+      // long[] curInternalCookie = (long[])curDexFile.mInternalCookie;
+      long[] curInternalCookie = (long[])dexFileInternalCookieField.get(curDexFile);
+
+      if (arrayContains(curCookie, dexFilePtr) || arrayContains(curInternalCookie, dexFilePtr)) {
+        return;
+      }
+    }
+    throw new Exception(
+        "Unable to find dex file pointer " + dexFilePtr + " in class loader for " + klass);
+  }
+
+  private static void doTest() throws Exception {
+    Transform t = new Transform();
+    Transform2 t2 = new Transform2();
+
+    long initial_t1_dex = getDexFilePointer(Transform.class);
+    long initial_t2_dex = getDexFilePointer(Transform2.class);
+    if (initial_t2_dex != initial_t1_dex) {
+      throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+                          "have different initial dex files!");
+    }
+    checkDexFileInClassLoader(Transform.class);
+    checkDexFileInClassLoader(Transform2.class);
+
+    // Make sure they are loaded
+    t.sayHi();
+    t2.sayHi();
+    // Redefine both of the classes.
+    Redefinition.doMultiClassRedefinition(TRANSFORM_DEFINITION, TRANSFORM2_DEFINITION);
+    // Make sure we actually transformed them!
+    t.sayHi();
+    t2.sayHi();
+
+    long final_t1_dex = getDexFilePointer(Transform.class);
+    long final_t2_dex = getDexFilePointer(Transform2.class);
+    if (final_t2_dex == final_t1_dex) {
+      throw new Exception("The classes " + Transform.class + " and " + Transform2.class + " " +
+                          "have the same initial dex files!");
+    } else if (final_t1_dex == initial_t1_dex) {
+      throw new Exception("The class " + Transform.class + " did not get a new dex file!");
+    } else if (final_t2_dex == initial_t2_dex) {
+      throw new Exception("The class " + Transform2.class + " did not get a new dex file!");
+    }
+    // Check to make sure the new dex files are in the class loader.
+    checkDexFileInClassLoader(Transform.class);
+    checkDexFileInClassLoader(Transform2.class);
+  }
+
+  // Gets the 'long' (really a native pointer) that is stored in the ClassLoader representing the
+  // DexFile a class is loaded from. This is plucked out of the internal DexCache object associated
+  // with the class.
+  private static long getDexFilePointer(Class<?> target) throws Exception {
+    // If all the android BCP classes were available when compiling this test and access checks
+    // weren't a thing this function would be written as follows:
+    //
+    // java.lang.DexCache dexCacheObject = target.dexCache;
+    // if (dexCacheObject == null) {
+    //   return 0;
+    // }
+    // return dexCacheObject.dexFile;
+    Field dexCacheField = Class.class.getDeclaredField("dexCache");
+
+    Class<?> dexCacheClass = Class.forName("java.lang.DexCache");
+    Field dexFileField = dexCacheClass.getDeclaredField("dexFile");
+
+    AccessibleObject.setAccessible(new AccessibleObject[] { dexCacheField, dexFileField }, true);
+
+    Object dexCacheObject = dexCacheField.get(target);
+    if (dexCacheObject == null) {
+      return 0;
+    }
+    checkIsInstance(dexCacheClass, dexCacheObject);
+    return dexFileField.getLong(dexCacheObject);
+  }
+}
diff --git a/test/945-obsolete-native/obsolete_native.cc b/test/945-obsolete-native/obsolete_native.cc
index ee653a4..e3090f5 100644
--- a/test/945-obsolete-native/obsolete_native.cc
+++ b/test/945-obsolete-native/obsolete_native.cc
@@ -19,31 +19,20 @@
 #include <stdio.h>
 
 #include "android-base/stringprintf.h"
-
-#include "android-base/stringprintf.h"
-#include "base/logging.h"
-#include "base/macros.h"
 #include "jni.h"
 #include "jvmti.h"
-#include "scoped_local_ref.h"
 
 // Test infrastructure
 #include "jni_binder.h"
 #include "test_env.h"
+#include "scoped_local_ref.h"
 
 namespace art {
 namespace Test945ObsoleteNative {
 
-extern "C" JNIEXPORT void JNICALL Java_Main_bindTest945ObsoleteNative(
-    JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
-  BindFunctions(jvmti_env, env, "Transform");
-}
-
-extern "C" JNIEXPORT void JNICALL Java_Transform_doExecute(JNIEnv* env,
-                                                           jclass klass ATTRIBUTE_UNUSED,
-                                                           jobject runnable) {
+extern "C" JNIEXPORT void JNICALL Java_art_Test945_00024Transform_doExecute(
+    JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jobject runnable) {
   jclass runnable_klass = env->FindClass("java/lang/Runnable");
-  DCHECK(runnable_klass != nullptr);
   jmethodID run_method = env->GetMethodID(runnable_klass, "run", "()V");
   env->CallVoidMethod(runnable, run_method);
 }
diff --git a/test/945-obsolete-native/src/Main.java b/test/945-obsolete-native/src/Main.java
index a7901cd..c94bc22 100644
--- a/test/945-obsolete-native/src/Main.java
+++ b/test/945-obsolete-native/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,65 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     doExecute(r);
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  //
-  //   private static native void doExecute(Runnable r);
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAIgoACAASCQATABQIABUKABYAFwoABwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-    "KVYBAAlkb0V4ZWN1dGUBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAe" +
-    "AQATSGVsbG8gLSBUcmFuc2Zvcm1lZAcAHwwAIAAhDAAPAA4BABVHb29kYnllIC0gVHJhbnNmb3Jt" +
-    "ZWQBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291" +
-    "dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxu" +
-    "AQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABwAIAAAAAAADAAAACQAKAAEACwAAAB0AAQABAAAA" +
-    "BSq3AAGxAAAAAQAMAAAABgABAAAAEQABAA0ADgABAAsAAAA5AAIAAgAAABWyAAISA7YABCu4AAWy" +
-    "AAISBrYABLEAAAABAAwAAAASAAQAAAATAAgAFAAMABUAFAAWAQoADwAOAAAAAQAQAAAAAgAR");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQB1fZcJR/opPuXacK8mIla5shH0LSg72qJYAwAAcAAAAHhWNBIAAAAAAAAAALgCAAAR" +
-    "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAUAgAARAEAAKIB" +
-    "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAABuAgAAggIA" +
-    "AIcCAACQAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-    "lAEAAAsAAAAGAAAAnAEAAAUAAQAOAAAAAAAAAAAAAAAAAAEADAAAAAAAAQAQAAAAAQACAA8AAAAC" +
-    "AAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAKUCAAAAAAAAAQABAAEAAACXAgAABAAAAHAQ" +
-    "BAAAAA4ABAACAAIAAACcAgAAFAAAAGIAAAAbAQIAAABuIAMAEABxEAEAAwBiAAAAGwEBAAAAbiAD" +
-    "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-    "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-    "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-    "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAAJZG9FeGVjdXRlABJlbWl0" +
-    "dGVyOiBqYWNrLTQuMjUAA291dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAQAHDoc8hwAAAAIBAICA" +
-    "BMQCAYoCAAIB3AIADQAAAAAAAAABAAAAAAAAAAEAAAARAAAAcAAAAAIAAAAHAAAAtAAAAAMAAAAD" +
-    "AAAA0AAAAAQAAAABAAAA9AAAAAUAAAAFAAAA/AAAAAYAAAABAAAAJAEAAAEgAAACAAAARAEAAAEQ" +
-    "AAACAAAAlAEAAAIgAAARAAAAogEAAAMgAAACAAAAlwIAAAAgAAABAAAApQIAAAAQAAABAAAAuAIA" +
-    "AA==");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    bindTest945ObsoleteNative();
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test945.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-    t.sayHi(() -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-    });
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
-
-  private static native void bindTest945ObsoleteNative();
 }
diff --git a/test/945-obsolete-native/src/Transform.java b/test/945-obsolete-native/src/Transform.java
deleted file mode 100644
index 2b7cc1b..0000000
--- a/test/945-obsolete-native/src/Transform.java
+++ /dev/null
@@ -1,25 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(Runnable r) {
-    System.out.println("hello");
-    doExecute(r);
-    System.out.println("goodbye");
-  }
-
-  private static native void doExecute(Runnable r);
-}
diff --git a/test/945-obsolete-native/src/art/Redefinition.java b/test/945-obsolete-native/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/945-obsolete-native/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/945-obsolete-native/src/art/Test945.java b/test/945-obsolete-native/src/art/Test945.java
new file mode 100644
index 0000000..6cf31f6
--- /dev/null
+++ b/test/945-obsolete-native/src/art/Test945.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test945 {
+
+  static class Transform {
+    static {
+      art.Main.bindAgentJNIForClass(Transform.class);
+    }
+
+    public void sayHi(Runnable r) {
+      System.out.println("hello");
+      doExecute(r);
+      System.out.println("goodbye");
+    }
+
+    private static native void doExecute(Runnable r);
+  }
+
+  // static class Transform {
+  //   static { }
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     doExecute(r);
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  //
+  //   private static native void doExecute(Runnable r);
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAJwoACAATCQAUABUIABYKABcAGAoABwAZCAAaBwAcBwAfAQAGPGluaXQ+AQADKClW" +
+    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+    "KVYBAAlkb0V4ZWN1dGUBAAg8Y2xpbml0PgEAClNvdXJjZUZpbGUBAAxUZXN0OTQ1LmphdmEMAAkA" +
+    "CgcAIAwAIQAiAQATSGVsbG8gLSBUcmFuc2Zvcm1lZAcAIwwAJAAlDAAPAA4BABVHb29kYnllIC0g" +
+    "VHJhbnNmb3JtZWQHACYBABVhcnQvVGVzdDk0NSRUcmFuc2Zvcm0BAAlUcmFuc2Zvcm0BAAxJbm5l" +
+    "ckNsYXNzZXMBABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxq" +
+    "YXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExq" +
+    "YXZhL2xhbmcvU3RyaW5nOylWAQALYXJ0L1Rlc3Q5NDUAIAAHAAgAAAAAAAQAAAAJAAoAAQALAAAA" +
+    "HQABAAEAAAAFKrcAAbEAAAABAAwAAAAGAAEAAAAFAAEADQAOAAEACwAAADkAAgACAAAAFbIAAhID" +
+    "tgAEK7gABbIAAhIGtgAEsQAAAAEADAAAABIABAAAAAgACAAJAAwACgAUAAsBCgAPAA4AAAAIABAA" +
+    "CgABAAsAAAAZAAAAAAAAAAGxAAAAAQAMAAAABgABAAAABgACABEAAAACABIAHgAAAAoAAQAHABsA" +
+    "HQAI");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAFqcJFAAAAAAAAAAAAAAAAAAAAAAAAAAB8BAAAcAAAAHhWNBIAAAAAAAAAALgDAAAY" +
+    "AAAAcAAAAAoAAADQAAAAAwAAAPgAAAABAAAAHAEAAAYAAAAkAQAAAQAAAFQBAAAIAwAAdAEAAHQB" +
+    "AAB+AQAAhgEAAJ0BAACyAQAAywEAANoBAAD+AQAAHgIAADUCAABJAgAAXwIAAHMCAACHAgAAlQIA" +
+    "AKACAACjAgAApwIAALQCAAC/AgAAxQIAAMoCAADTAgAA2gIAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+    "CQAAAAoAAAALAAAADAAAAA8AAAAPAAAACQAAAAAAAAAQAAAACQAAAOQCAAAQAAAACQAAAOwCAAAI" +
+    "AAQAFAAAAAAAAAAAAAAAAAAAAAEAAAAAAAEAEgAAAAAAAQAWAAAABAACABUAAAAFAAAAAQAAAAAA" +
+    "AAAAAAAABQAAAAAAAAANAAAAqAMAAHQDAAAAAAAACDxjbGluaXQ+AAY8aW5pdD4AFUdvb2RieWUg" +
+    "LSBUcmFuc2Zvcm1lZAATSGVsbG8gLSBUcmFuc2Zvcm1lZAAXTGFydC9UZXN0OTQ1JFRyYW5zZm9y" +
+    "bTsADUxhcnQvVGVzdDk0NTsAIkxkYWx2aWsvYW5ub3RhdGlvbi9FbmNsb3NpbmdDbGFzczsAHkxk" +
+    "YWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJMamF2" +
+    "YS9sYW5nL09iamVjdDsAFExqYXZhL2xhbmcvUnVubmFibGU7ABJMamF2YS9sYW5nL1N0cmluZzsA" +
+    "EkxqYXZhL2xhbmcvU3lzdGVtOwAMVGVzdDk0NS5qYXZhAAlUcmFuc2Zvcm0AAVYAAlZMAAthY2Nl" +
+    "c3NGbGFncwAJZG9FeGVjdXRlAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAAB" +
+    "AAAABgAAAAEAAAAHAAAABQAHDgAFAAcOAAgBAAcOAQgPAQMPAQgPAAAAAAAAAAAAAAAA9AIAAAEA" +
+    "AAAOAAAAAQABAAEAAAD5AgAABAAAAHAQBQAAAA4ABAACAAIAAAD+AgAAFAAAAGIAAAAbAQMAAABu" +
+    "IAQAEABxEAIAAwBiAAAAGwECAAAAbiAEABAADgAAAAMBAIiABJAGAYCABKQGAYoCAAMBvAYCAgEX" +
+    "GAECAwIRBAgTFw4AAgAAAIwDAACSAwAAnAMAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAAB" +
+    "AAAAGAAAAHAAAAACAAAACgAAANAAAAADAAAAAwAAAPgAAAAEAAAAAQAAABwBAAAFAAAABgAAACQB" +
+    "AAAGAAAAAQAAAFQBAAACIAAAGAAAAHQBAAABEAAAAgAAAOQCAAADIAAAAwAAAPQCAAABIAAAAwAA" +
+    "ABADAAAAIAAAAQAAAHQDAAAEIAAAAgAAAIwDAAADEAAAAQAAAJwDAAAGIAAAAQAAAKgDAAAAEAAA" +
+    "AQAAALgDAAA=");
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_REDEFINE);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+    t.sayHi(() -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+    });
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/946-obsolete-throw/expected.txt b/test/946-obsolete-throw/expected.txt
index 71d5182..edf796e 100644
--- a/test/946-obsolete-throw/expected.txt
+++ b/test/946-obsolete-throw/expected.txt
@@ -5,10 +5,11 @@
 transforming calling function
 Received error : java.lang.Error: Throwing exception into an obsolete method!
 java.lang.Error: Throwing exception into an obsolete method!
-	at Main$DoRedefinitionClass.run(Main.java:65)
-	at Transform.sayHi(Transform.java:27)
-	at Main.doTest(Main.java:72)
-	at Main.main(Main.java:57)
+	at art.Test946$DoRedefinitionClass.run(Test946.java:81)
+	at art.Test946$Transform.sayHi(Test946.java:26)
+	at art.Test946.doTest(Test946.java:88)
+	at art.Test946.run(Test946.java:73)
+	at Main.main(Main.java:19)
 Hello - Transformed
 Not doing anything here
 Goodbye - Transformed
diff --git a/test/946-obsolete-throw/src/Main.java b/test/946-obsolete-throw/src/Main.java
index 077ad72..0b1f78d 100644
--- a/test/946-obsolete-throw/src/Main.java
+++ b/test/946-obsolete-throw/src/Main.java
@@ -14,71 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-    "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
-    "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
-    "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
-    "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
-    "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
-    "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
-    "AQAPAAAAAgAQ");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
-    "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
-    "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
-    "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-    "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-    "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
-    "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
-    "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-    "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-    "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-    "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
-    "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
-    "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
-    "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
-    "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test946.run();
   }
-
-  static class DoRedefinitionClass implements Runnable {
-    @Override
-    public void run() {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-      throw new Error("Throwing exception into an obsolete method!");
-    }
-  }
-
-  public static void doTest(Transform t) {
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-    try {
-      t.sayHi(new DoRedefinitionClass());
-    } catch (Throwable e) {
-      System.out.println("Received error : " + e);
-      e.printStackTrace(System.out);
-    }
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/946-obsolete-throw/src/Transform.java b/test/946-obsolete-throw/src/Transform.java
deleted file mode 100644
index 4f43086..0000000
--- a/test/946-obsolete-throw/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(Runnable r) {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Hello" < "LTransform;" < "hello".
-    System.out.println("hello");
-    r.run();
-    System.out.println("goodbye");
-  }
-}
diff --git a/test/946-obsolete-throw/src/art/Redefinition.java b/test/946-obsolete-throw/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/946-obsolete-throw/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/946-obsolete-throw/src/art/Test946.java b/test/946-obsolete-throw/src/art/Test946.java
new file mode 100644
index 0000000..9f0e57c
--- /dev/null
+++ b/test/946-obsolete-throw/src/art/Test946.java
@@ -0,0 +1,95 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+
+public class Test946 {
+
+  static class Transform {
+    public void sayHi(Runnable r) {
+      System.out.println("hello");
+      r.run();
+      System.out.println("goodbye");
+    }
+  }
+
+  // static class Transform {
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+    "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk0Ni5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+    "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+    "L1Rlc3Q5NDYkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+    "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+    "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+    "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTQ2ACAABwAIAAAAAAACAAAACQAK" +
+    "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+    "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+    "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQB0mzt6AAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+    "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+    "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+    "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+    "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+    "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+    "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+    "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5NDYkVHJhbnNmb3JtOwANTGFydC9UZXN0OTQ2OwAiTGRh" +
+    "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+    "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+    "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+    "ZXN0OTQ2LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+    "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+    "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+    "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+    "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+    "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+    "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+    "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+    "AA==");
+
+  public static void run() {
+    doTest(new Transform());
+  }
+
+  static class DoRedefinitionClass implements Runnable {
+    @Override
+    public void run() {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+      throw new Error("Throwing exception into an obsolete method!");
+    }
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+    try {
+      t.sayHi(new DoRedefinitionClass());
+    } catch (Throwable e) {
+      System.out.println("Received error : " + e);
+      e.printStackTrace(System.out);
+    }
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/947-reflect-method/src/Main.java b/test/947-reflect-method/src/Main.java
index da746ac..bc3f4b2 100644
--- a/test/947-reflect-method/src/Main.java
+++ b/test/947-reflect-method/src/Main.java
@@ -14,60 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-import java.lang.reflect.Method;
-
 public class Main {
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
-    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test947.run();
   }
-
-  public static void doTest(Transform t) {
-    try {
-      Method say_hi_method = t.getClass().getDeclaredMethod("sayHi");
-      say_hi_method.invoke(t);
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-      say_hi_method.invoke(t);
-    } catch (Exception e) {
-      e.printStackTrace();
-    }
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/947-reflect-method/src/Transform.java b/test/947-reflect-method/src/Transform.java
deleted file mode 100644
index b8fe34a..0000000
--- a/test/947-reflect-method/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/947-reflect-method/src/art/Redefinition.java b/test/947-reflect-method/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/947-reflect-method/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/947-reflect-method/src/art/Test947.java b/test/947-reflect-method/src/art/Test947.java
new file mode 100644
index 0000000..8cb515e
--- /dev/null
+++ b/test/947-reflect-method/src/art/Test947.java
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+import java.lang.reflect.Method;
+
+public class Test947 {
+
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAIAoABgAOCQAPABAIABEKABIAEwcAFQcAGAEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAAxUZXN0OTQ3LmphdmEMAAcA" +
+    "CAcAGQwAGgAbAQAHR29vZGJ5ZQcAHAwAHQAeBwAfAQAVYXJ0L1Rlc3Q5NDckVHJhbnNmb3JtAQAJ" +
+    "VHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5nL09iamVjdAEAEGphdmEvbGFuZy9T" +
+    "eXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZhL2lvL1ByaW50U3RyZWFt" +
+    "AQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEAC2FydC9UZXN0OTQ3ACAABQAGAAAA" +
+    "AAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAABQABAAsACAABAAkA" +
+    "AAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAHAAgACAACAAwAAAACAA0AFwAAAAoA" +
+    "AQAFABQAFgAI");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCEgoKcAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+    "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+    "TGFydC9UZXN0OTQ3JFRyYW5zZm9ybTsADUxhcnQvVGVzdDk0NzsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+    "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+    "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+    "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTQ3LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+    "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  public static void run() {
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    try {
+      Method say_hi_method = t.getClass().getDeclaredMethod("sayHi");
+      say_hi_method.invoke(t);
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+      say_hi_method.invoke(t);
+    } catch (Exception e) {
+      e.printStackTrace();
+    }
+  }
+}
diff --git a/test/948-change-annotations/src/Main.java b/test/948-change-annotations/src/Main.java
index a290396..5d3406d 100644
--- a/test/948-change-annotations/src/Main.java
+++ b/test/948-change-annotations/src/Main.java
@@ -14,6 +14,7 @@
  * limitations under the License.
  */
 
+import art.Redefinition;
 import java.util.Arrays;
 import java.util.Base64;
 import java.util.Comparator;
@@ -85,7 +86,9 @@
   }
 
   // Transforms the class
-  public static native void doCommonClassRedefinition(Class<?> target,
-                                                      byte[] class_file,
-                                                      byte[] dex_file);
+  public static void doCommonClassRedefinition(Class<?> target,
+                                               byte[] class_file,
+                                               byte[] dex_file) {
+    Redefinition.doCommonClassRedefinition(target, class_file, dex_file);
+  }
 }
diff --git a/test/948-change-annotations/src/art/Redefinition.java b/test/948-change-annotations/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/948-change-annotations/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/949-in-memory-transform/src/Main.java b/test/949-in-memory-transform/src/Main.java
index 1a6b224..b49a93f 100644
--- a/test/949-in-memory-transform/src/Main.java
+++ b/test/949-in-memory-transform/src/Main.java
@@ -14,112 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-import java.lang.reflect.*;
-import java.nio.ByteBuffer;
-
 public class Main {
-  /**
-   * base64 encoded class/dex file for
-   * public class Transform {
-   *   public void sayHi() {
-   *    System.out.println("hello");
-   *   }
-   * }
-   */
-  private static final byte[] INITIAL_CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
-    "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAhAAUABgAA" +
-    "AAAAAgABAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
-    "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
-  private static final byte[] INITIAL_DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAJX3mZphwHJCT1qdTz/GS+jXOR+O/9e3fMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
-    "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
-    "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
-    "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
-    "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUABWhlbGxvAANvdXQA" +
-    "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCBgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
-
-
-  /**
-   * base64 encoded class/dex file for
-   * public class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] TRANSFORMED_CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
-    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
-    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
-    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
-    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACEABQAG" +
-    "AAAAAAACAAEABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
-    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAaAAgAGwABAAwAAAACAA0=");
-  private static final byte[] TRANSFORMED_DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAPXh6T3l1FObhHsKf1U2vi+0GmAvElxBLMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgAaAAcOhwAAAAEBAIGABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
   public static void main(String[] args) throws Exception {
-    art.Main.bindAgentJNIForClass(Main.class);
-    ClassLoader loader;
-    try {
-      // Art uses this classloader to do in-memory dex files. There is no support for defineClass
-      loader = (ClassLoader)Class.forName("dalvik.system.InMemoryDexClassLoader")
-                                 .getConstructor(ByteBuffer.class, ClassLoader.class)
-                                 .newInstance(ByteBuffer.wrap(INITIAL_DEX_BYTES),
-                                              ClassLoader.getSystemClassLoader());
-    } catch (ClassNotFoundException e) {
-      // Seem to be on RI. Just make a new ClassLoader that calls defineClass.
-      loader = new ClassLoader() {
-        public Class<?> findClass(String name) throws ClassNotFoundException {
-          if (name.equals("Transform")) {
-            return defineClass(name, INITIAL_CLASS_BYTES, 0, INITIAL_CLASS_BYTES.length);
-          } else {
-            throw new ClassNotFoundException("Couldn't find class: " + name);
-          }
-        }
-      };
-    }
-    doTest(loader);
+    art.Test949.run();
   }
-
-  public static void doTest(ClassLoader loader) throws Exception {
-    // Get the class
-    Class<?> transform_class = loader.loadClass("Transform");
-    Method say_hi_method = transform_class.getMethod("sayHi");
-    Object t = transform_class.newInstance();
-
-    // Run the actual test.
-    say_hi_method.invoke(t);
-    doCommonClassRedefinition(transform_class, TRANSFORMED_CLASS_BYTES, TRANSFORMED_DEX_BYTES);
-    say_hi_method.invoke(t);
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/949-in-memory-transform/src/art/Redefinition.java b/test/949-in-memory-transform/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/949-in-memory-transform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/949-in-memory-transform/src/art/Test949.java b/test/949-in-memory-transform/src/art/Test949.java
new file mode 100644
index 0000000..cd733b9
--- /dev/null
+++ b/test/949-in-memory-transform/src/art/Test949.java
@@ -0,0 +1,123 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import static art.Redefinition.doCommonClassRedefinition;
+
+import java.util.Base64;
+import java.lang.reflect.*;
+import java.nio.ByteBuffer;
+
+public class Test949 {
+  /**
+   * base64 encoded class/dex file for
+   * public class Transform {
+   *   public void sayHi() {
+   *    System.out.println("hello");
+   *   }
+   * }
+   */
+  private static final byte[] INITIAL_CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+    "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+    "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAhAAUABgAA" +
+    "AAAAAgABAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+    "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+  private static final byte[] INITIAL_DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAJX3mZphwHJCT1qdTz/GS+jXOR+O/9e3fMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+    "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+    "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+    "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+    "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUABWhlbGxvAANvdXQA" +
+    "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCBgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+
+  /**
+   * base64 encoded class/dex file for
+   * public class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] TRANSFORMED_CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACEABQAG" +
+    "AAAAAAACAAEABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAAaAAgAGwABAAwAAAACAA0=");
+  private static final byte[] TRANSFORMED_DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAPXh6T3l1FObhHsKf1U2vi+0GmAvElxBLMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAABAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjUAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgAaAAcOhwAAAAEBAIGABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void run() throws Exception {
+    ClassLoader loader;
+    try {
+      // Art uses this classloader to do in-memory dex files. There is no support for defineClass
+      loader = (ClassLoader)Class.forName("dalvik.system.InMemoryDexClassLoader")
+                                 .getConstructor(ByteBuffer.class, ClassLoader.class)
+                                 .newInstance(ByteBuffer.wrap(INITIAL_DEX_BYTES),
+                                              ClassLoader.getSystemClassLoader());
+    } catch (ClassNotFoundException e) {
+      // Seem to be on RI. Just make a new ClassLoader that calls defineClass.
+      loader = new ClassLoader() {
+        public Class<?> findClass(String name) throws ClassNotFoundException {
+          if (name.equals("Transform")) {
+            return defineClass(name, INITIAL_CLASS_BYTES, 0, INITIAL_CLASS_BYTES.length);
+          } else {
+            throw new ClassNotFoundException("Couldn't find class: " + name);
+          }
+        }
+      };
+    }
+    doTest(loader);
+  }
+
+  public static void doTest(ClassLoader loader) throws Exception {
+    // Get the class
+    Class<?> transform_class = loader.loadClass("Transform");
+    Method say_hi_method = transform_class.getMethod("sayHi");
+    Object t = transform_class.newInstance();
+
+    // Run the actual test.
+    say_hi_method.invoke(t);
+    doCommonClassRedefinition(transform_class, TRANSFORMED_CLASS_BYTES, TRANSFORMED_DEX_BYTES);
+    say_hi_method.invoke(t);
+  }
+}
diff --git a/test/950-redefine-intrinsic/src/Main.java b/test/950-redefine-intrinsic/src/Main.java
index 2578d6e..369a8f4 100644
--- a/test/950-redefine-intrinsic/src/Main.java
+++ b/test/950-redefine-intrinsic/src/Main.java
@@ -14,6 +14,7 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.doCommonClassRedefinition;
 import java.util.Base64;
 import java.util.Random;
 import java.util.function.*;
@@ -464,9 +465,4 @@
     }
     System.out.println("Finished!");
   }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/950-redefine-intrinsic/src/art/Redefinition.java b/test/950-redefine-intrinsic/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/950-redefine-intrinsic/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/951-threaded-obsolete/src/Main.java b/test/951-threaded-obsolete/src/Main.java
index a82090e..d245aa9 100644
--- a/test/951-threaded-obsolete/src/Main.java
+++ b/test/951-threaded-obsolete/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,84 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
-import java.util.concurrent.Semaphore;
-
 public class Main {
-  // class Transform {
-  //   public void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-    "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
-    "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
-    "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
-    "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
-    "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQABAA0ADgABAAsAAAA7AAIA" +
-    "AgAAABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
-    "AQAPAAAAAgAQ");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAYeAMMXgYWxoeSHAS9EWKCCtVRSAGpqZVQAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
-    "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
-    "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
-    "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-    "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-    "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
-    "AwAAAA4ABAACAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAwBiAAAAGwEBAAAAbiAC" +
-    "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-    "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-    "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-    "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
-    "LjEzAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAEBAICABMQCAQHc" +
-    "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
-    "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
-    "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    // Semaphores to let each thread know where the other is. We could use barriers but semaphores
-    // mean we don't need to have the worker thread be waiting around.
-    final Semaphore sem_redefine_start = new Semaphore(0);
-    final Semaphore sem_redefine_end = new Semaphore(0);
-    // Create a thread to do the actual redefinition. We will just communicate through an
-    // atomic-integer.
-    new Thread(() -> {
-      try {
-        // Wait for the other thread to ask for redefinition.
-        sem_redefine_start.acquire();
-        // Do the redefinition.
-        doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-        // Allow the other thread to wake up if it is waiting.
-        sem_redefine_end.release();
-      } catch (InterruptedException e) {
-        throw new Error("unable to do redefinition", e);
-      }
-    }).start();
-
-    Transform t = new Transform();
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
-    t.sayHi(() -> {
-      try {
-        System.out.println("transforming calling function");
-        // Wake up the waiting thread.
-        sem_redefine_start.release();
-        // Wait for the other thread to finish with redefinition.
-        sem_redefine_end.acquire();
-      } catch (InterruptedException e) {
-        throw new Error("unable to do redefinition", e);
-      }
-    });
-    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  public static void main(String[] args) throws Exception {
+    art.Test951.run();
   }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
 }
diff --git a/test/951-threaded-obsolete/src/Transform.java b/test/951-threaded-obsolete/src/Transform.java
deleted file mode 100644
index 8cda6cd..0000000
--- a/test/951-threaded-obsolete/src/Transform.java
+++ /dev/null
@@ -1,30 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi(Runnable r) {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Hello" < "LTransform;" < "hello".
-    System.out.println("hello");
-    r.run();
-    System.out.println("goodbye");
-  }
-}
diff --git a/test/951-threaded-obsolete/src/art/Redefinition.java b/test/951-threaded-obsolete/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/951-threaded-obsolete/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/951-threaded-obsolete/src/art/Test951.java b/test/951-threaded-obsolete/src/art/Test951.java
new file mode 100644
index 0000000..3628f4f
--- /dev/null
+++ b/test/951-threaded-obsolete/src/art/Test951.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+import java.util.concurrent.Semaphore;
+
+public class Test951 {
+
+  static class Transform {
+    public void sayHi(Runnable r) {
+      System.out.println("hello");
+      r.run();
+      System.out.println("goodbye");
+    }
+  }
+
+  // static class Transform {
+  //   public void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+    "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk1MS5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+    "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+    "L1Rlc3Q5NTEkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+    "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+    "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+    "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTUxACAABwAIAAAAAAACAAAACQAK" +
+    "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQABAA0ADgABAAsAAAA7AAIAAgAA" +
+    "ABeyAAISA7YABCu5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+    "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBom/JeAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+    "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+    "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+    "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+    "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+    "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+    "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+    "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5NTEkVHJhbnNmb3JtOwANTGFydC9UZXN0OTUxOwAiTGRh" +
+    "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+    "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+    "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+    "ZXN0OTUxLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+    "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+    "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAQAAgACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+    "biACABAAchAEAAMAYgAAABsBAQAAAG4gAgAQAA4AAAABAQCAgATsBQEBhAYAAAICARYYAQIDAhAE" +
+    "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+    "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+    "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+    "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+    "AA==");
+
+  public static void run() {
+    // Semaphores to let each thread know where the other is. We could use barriers but semaphores
+    // mean we don't need to have the worker thread be waiting around.
+    final Semaphore sem_redefine_start = new Semaphore(0);
+    final Semaphore sem_redefine_end = new Semaphore(0);
+    // Create a thread to do the actual redefinition. We will just communicate through an
+    // atomic-integer.
+    new Thread(() -> {
+      try {
+        // Wait for the other thread to ask for redefinition.
+        sem_redefine_start.acquire();
+        // Do the redefinition.
+        Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+        // Allow the other thread to wake up if it is waiting.
+        sem_redefine_end.release();
+      } catch (InterruptedException e) {
+        throw new Error("unable to do redefinition", e);
+      }
+    }).start();
+
+    Transform t = new Transform();
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+    t.sayHi(() -> {
+      try {
+        System.out.println("transforming calling function");
+        // Wake up the waiting thread.
+        sem_redefine_start.release();
+        // Wait for the other thread to finish with redefinition.
+        sem_redefine_end.acquire();
+      } catch (InterruptedException e) {
+        throw new Error("unable to do redefinition", e);
+      }
+    });
+    t.sayHi(() -> { System.out.println("Not doing anything here"); });
+  }
+}
diff --git a/test/980-redefine-object/check b/test/980-redefine-object/check
index 987066f..07b21b3 100755
--- a/test/980-redefine-object/check
+++ b/test/980-redefine-object/check
@@ -17,4 +17,4 @@
 # The number of paused background threads (and therefore InterruptedExceptions)
 # can change so we will just delete their lines from the log.
 
-sed "/Object allocated of type 'Ljava\/lang\/InterruptedException;'/d" "$2" | diff --strip-trailing-cr -q "$1" - >/dev/null
+sed "/Object allocated of type 'java\.lang\.InterruptedException'/d" "$2" | diff --strip-trailing-cr -q "$1" - >/dev/null
diff --git a/test/980-redefine-object/expected.txt b/test/980-redefine-object/expected.txt
index 6e9bce0..4c294bc 100644
--- a/test/980-redefine-object/expected.txt
+++ b/test/980-redefine-object/expected.txt
@@ -2,51 +2,31 @@
 	Allocating an j.l.Object before redefining Object class
 	Allocating a Transform before redefining Object class
 	Redefining the Object class to add a hook into the <init> method
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
 	Allocating an j.l.Object after redefining Object class
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
 	Allocating a Transform after redefining Object class
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'Transform'
 	Allocating an int[] after redefining Object class
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
 	Allocating an array list
-Object allocated of type 'Ljava/util/ArrayList;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.util.ArrayList'
 	Adding a bunch of stuff to the array list
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'Transform'
 	Allocating a linked list
-Object allocated of type 'Ljava/util/LinkedList;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.util.LinkedList'
 	Adding a bunch of stuff to the linked list
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/lang/Object;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'LTransform;'
-Object allocated of type 'Ljava/util/LinkedList$Node;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.lang.Object'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'java.util.LinkedList$Node'
+Object allocated of type 'Transform'
+Object allocated of type 'java.util.LinkedList$Node'
 	Throwing from down 4 stack frames
-Object allocated of type 'Ljava/lang/Exception;'
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
+Object allocated of type 'java.lang.Exception'
 	Exception caught.
-Object allocated of type 'Ljava/lang/StringBuilder;'
-Object allocated of type 'Ljava/nio/HeapCharBuffer;'
 	Finishing test!
diff --git a/test/980-redefine-object/redefine_object.cc b/test/980-redefine-object/redefine_object.cc
deleted file mode 100644
index 1faf1a1..0000000
--- a/test/980-redefine-object/redefine_object.cc
+++ /dev/null
@@ -1,58 +0,0 @@
-/*
- * Copyright (C) 2017 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include <inttypes.h>
-#include <iostream>
-
-#include "android-base/stringprintf.h"
-#include "base/logging.h"
-#include "base/macros.h"
-#include "jni.h"
-#include "jvmti.h"
-#include "scoped_utf_chars.h"
-
-// Test infrastructure
-#include "jni_binder.h"
-#include "jvmti_helper.h"
-#include "test_env.h"
-
-namespace art {
-namespace Test980RedefineObjects {
-
-extern "C" JNIEXPORT void JNICALL Java_Main_bindFunctionsForClass(
-    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jclass target) {
-  BindFunctionsOnClass(jvmti_env, env, target);
-}
-
-extern "C" JNIEXPORT void JNICALL Java_art_test_TestWatcher_NotifyConstructed(
-    JNIEnv* env, jclass TestWatcherClass ATTRIBUTE_UNUSED, jobject constructed) {
-  char* sig = nullptr;
-  char* generic_sig = nullptr;
-  if (JvmtiErrorToException(env,
-                            jvmti_env,
-                            jvmti_env->GetClassSignature(env->GetObjectClass(constructed),
-                                                         &sig,
-                                                         &generic_sig))) {
-    // Exception.
-    return;
-  }
-  std::cout << "Object allocated of type '" << sig << "'" << std::endl;
-  jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(sig));
-  jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(generic_sig));
-}
-
-}  // namespace Test980RedefineObjects
-}  // namespace art
diff --git a/test/980-redefine-object/src-ex/TestWatcher.java b/test/980-redefine-object/src-ex/TestWatcher.java
index d15e688..c38e07b 100644
--- a/test/980-redefine-object/src-ex/TestWatcher.java
+++ b/test/980-redefine-object/src-ex/TestWatcher.java
@@ -16,10 +16,60 @@
 
 package art.test;
 
+import java.util.concurrent.locks.ReentrantLock;
+
 public class TestWatcher {
-  // NB This function is native since it is called in the Object.<init> method and so cannot cause
-  // any java allocations at all. The normal System.out.print* functions will cause allocations to
-  // occur so we cannot use them. This means the easiest way to report the object as being created
-  // is to go into native code and do it there.
-  public static native void NotifyConstructed(Object o);
+  // Lock to synchronize access to the static state of this class.
+  private static final ReentrantLock lock = new ReentrantLock();
+  private static volatile boolean criticalFailure = false;
+  private static boolean reportingEnabled = true;
+  private static boolean doingReport = false;
+
+  private static void MonitorEnter() {
+    lock.lock();
+  }
+
+  private static void MonitorExit() {
+    // Need to do this manually since we need to notify critical failure but would deadlock if
+    // waited for the unlock.
+    if (!lock.isHeldByCurrentThread()) {
+      NotifyCriticalFailure();
+      throw new IllegalMonitorStateException("Locking error!");
+    } else {
+      lock.unlock();
+    }
+  }
+
+  // Stops reporting. Must be paired with an EnableReporting call.
+  public static void DisableReporting() {
+    MonitorEnter();
+    reportingEnabled = false;
+  }
+
+  // Stops reporting. Must be paired with a DisableReporting call.
+  public static void EnableReporting() {
+    reportingEnabled = true;
+    MonitorExit();
+  }
+
+  public static void NotifyCriticalFailure() {
+    criticalFailure = true;
+  }
+
+  public static void NotifyConstructed(Object o) {
+    if (criticalFailure) {
+      // Something went very wrong. We are probably trying to report it so don't get in the way.
+      return;
+    }
+    MonitorEnter();
+    // We could enter an infinite loop if println allocates (which it does) so we disable
+    // reporting while we are doing a report. Since we are synchronized we won't miss any
+    // allocations.
+    if (reportingEnabled && !doingReport) {
+      doingReport = true;
+      System.out.println("Object allocated of type '" + o.getClass().getName() + "'");
+      doingReport = false;
+    }
+    MonitorExit();
+  }
 }
diff --git a/test/980-redefine-object/src/Main.java b/test/980-redefine-object/src/Main.java
index a50215e..63c0cab 100644
--- a/test/980-redefine-object/src/Main.java
+++ b/test/980-redefine-object/src/Main.java
@@ -14,6 +14,9 @@
  * limitations under the License.
  */
 
+import static art.Redefinition.doCommonClassRedefinition;
+
+import java.lang.reflect.Method;
 import java.util.ArrayList;
 import java.util.Base64;
 import java.util.LinkedList;
@@ -287,6 +290,31 @@
   private static final String LISTENER_LOCATION =
       System.getenv("DEX_LOCATION") + "/980-redefine-object-ex.jar";
 
+  private static Method doEnableReporting;
+  private static Method doDisableReporting;
+
+  private static void DisableReporting() {
+    if (doDisableReporting == null) {
+      return;
+    }
+    try {
+      doDisableReporting.invoke(null);
+    } catch (Exception e) {
+      throw new Error("Unable to disable reporting!");
+    }
+  }
+
+  private static void EnableReporting() {
+    if (doEnableReporting == null) {
+      return;
+    }
+    try {
+      doEnableReporting.invoke(null);
+    } catch (Exception e) {
+      throw new Error("Unable to enable reporting!");
+    }
+  }
+
   public static void main(String[] args) {
     art.Main.bindAgentJNIForClass(Main.class);
     doTest();
@@ -298,8 +326,8 @@
       addToBootClassLoader(LISTENER_LOCATION);
       // Load TestWatcher from the bootclassloader and make sure it is initialized.
       Class<?> testwatcher_class = Class.forName("art.test.TestWatcher", true, null);
-      // Bind the native functions of testwatcher_class.
-      bindFunctionsForClass(testwatcher_class);
+      doEnableReporting = testwatcher_class.getDeclaredMethod("EnableReporting");
+      doDisableReporting = testwatcher_class.getDeclaredMethod("DisableReporting");
     } catch (Exception e) {
       throw new Error("Exception while making testwatcher", e);
     }
@@ -308,9 +336,9 @@
   // NB This function will cause 2 objects of type "Ljava/nio/HeapCharBuffer;" and
   // "Ljava/nio/HeapCharBuffer;" to be allocated each time it is called.
   private static void safePrintln(Object o) {
-    System.out.flush();
-    System.out.print("\t" + o + "\n");
-    System.out.flush();
+    DisableReporting();
+    System.out.println("\t" + o);
+    EnableReporting();
   }
 
   private static void throwFrom(int depth) throws Exception {
@@ -381,11 +409,4 @@
   }
 
   private static native void addToBootClassLoader(String s);
-
-  private static native void bindFunctionsForClass(Class<?> target);
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
 }
diff --git a/test/980-redefine-object/src/art/Redefinition.java b/test/980-redefine-object/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/980-redefine-object/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/981-dedup-original-dex/src/Main.java b/test/981-dedup-original-dex/src/Main.java
index 288f7ce..f90c15c 100644
--- a/test/981-dedup-original-dex/src/Main.java
+++ b/test/981-dedup-original-dex/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,190 +14,8 @@
  * limitations under the License.
  */
 
-import java.lang.reflect.Field;
-import java.util.Base64;
-import java.nio.ByteBuffer;
-
-import dalvik.system.ClassExt;
-import dalvik.system.InMemoryDexClassLoader;
-
 public class Main {
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye");
-   *   }
-   * }
-   */
-  private static final byte[] DEX_BYTES_1 = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
-    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
-    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
-    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
-    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
-    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
-    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
-    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
-    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform2 {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye2");
-   *   }
-   * }
-   */
-  private static final byte[] DEX_BYTES_2 = Base64.getDecoder().decode(
-    "ZGV4CjAzNQAjXDED2iflQ3NXbPtBRVjQVMqoDU9nDz/QAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
-    "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
-    "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTIADExUcmFuc2Zvcm0yOwAVTGphdmEvaW8vUHJp" +
-    "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
-    "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
-    "A291dAAHcHJpbnRsbgAFc2F5SGkAAQAHDgADAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
-    "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
-    "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
-    "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
-
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform3 {
-   *   public void sayHi() {
-   *    System.out.println("hello3");
-   *   }
-   * }
-   */
-  private static final byte[] DEX_BYTES_3_INITIAL = Base64.getDecoder().decode(
-    "ZGV4CjAzNQC2W2fBsAeLNAwWYlG8FVigzfsV7nBWITzQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
-    "AABqAQAAeAEAAI8BAACjAQAAtwEAAMsBAADcAQAA3wEAAOMBAAD3AQAA/wEAAAQCAAANAgAAAQAA" +
-    "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAAB8CAAAA" +
-    "AAAAAQABAAEAAAAUAgAABAAAAHAQAwAAAA4AAwABAAIAAAAZAgAACQAAAGIAAAAbAQoAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAMTFRyYW5zZm9ybTM7ABVMamF2YS9pby9QcmludFN0cmVhbTsA" +
-    "EkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
-    "bTsAD1RyYW5zZm9ybTMuamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4zMAAGaGVsbG8zAANv" +
-    "dXQAB3ByaW50bG4ABXNheUhpAAIABw4ABAAHDocAAAABAQCAgASgAgEBuAIAAAANAAAAAAAAAAEA" +
-    "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
-    "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
-    "AyAAAAIAAAAUAgAAACAAAAEAAAAfAgAAABAAAAEAAAAwAgAA");
-
-  /**
-   * base64 encoded class/dex file for
-   * class Transform3 {
-   *   public void sayHi() {
-   *    System.out.println("Goodbye3");
-   *   }
-   * }
-   */
-  private static final byte[] DEX_BYTES_3_FINAL = Base64.getDecoder().decode(
-    "ZGV4CjAzNQBAXE5GthgMydaFBuinf+ZBfXcBYIw2UlXQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
-    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
-    "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
-    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
-    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
-    "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
-    "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTMADExUcmFuc2Zvcm0zOwAVTGphdmEvaW8vUHJp" +
-    "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
-    "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0zLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
-    "A291dAAHcHJpbnRsbgAFc2F5SGkAAgAHDgAEAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
-    "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
-    "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
-    "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    try {
-      doTest();
-    } catch (Exception e) {
-      e.printStackTrace();
-    }
+  public static void main(String[] args) throws Exception {
+    art.Test981.run();
   }
-
-  private static void assertSame(Object a, Object b) throws Exception {
-    if (a != b) {
-      throw new AssertionError("'" + (a != null ? a.toString() : "null") + "' is not the same as " +
-                               "'" + (b != null ? b.toString() : "null") + "'");
-    }
-  }
-
-  private static Object getObjectField(Object o, String name) throws Exception {
-    return getObjectField(o, o.getClass(), name);
-  }
-
-  private static Object getObjectField(Object o, Class<?> type, String name) throws Exception {
-    Field f = type.getDeclaredField(name);
-    f.setAccessible(true);
-    return f.get(o);
-  }
-
-  private static Object getOriginalDexFile(Class<?> k) throws Exception {
-    ClassExt ext_data_object = (ClassExt) getObjectField(k, "extData");
-    if (ext_data_object == null) {
-      return null;
-    }
-
-    return getObjectField(ext_data_object, "originalDexFile");
-  }
-
-  public static void doTest() throws Exception {
-    // Make sure both of these are loaded prior to transformations being added so they have the same
-    // original dex files.
-    Transform t1 = new Transform();
-    Transform2 t2 = new Transform2();
-
-    assertSame(null, getOriginalDexFile(t1.getClass()));
-    assertSame(null, getOriginalDexFile(t2.getClass()));
-    assertSame(null, getOriginalDexFile(Main.class));
-
-    addCommonTransformationResult("Transform", new byte[0], DEX_BYTES_1);
-    addCommonTransformationResult("Transform2", new byte[0], DEX_BYTES_2);
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class, Transform2.class);
-
-    assertSame(getOriginalDexFile(t1.getClass()), getOriginalDexFile(t2.getClass()));
-    assertSame(null, getOriginalDexFile(Main.class));
-    // Make sure that the original dex file is a DexCache object.
-    assertSame(getOriginalDexFile(t1.getClass()).getClass(), Class.forName("java.lang.DexCache"));
-
-    // Check that we end up with a byte[] if we do a direct RedefineClasses
-    enableCommonRetransformation(false);
-    doCommonClassRedefinition(Transform.class, new byte[0], DEX_BYTES_1);
-    assertSame((new byte[0]).getClass(), getOriginalDexFile(t1.getClass()).getClass());
-
-    // Check we don't have anything if we don't have any originalDexFile if the onload
-    // transformation doesn't do anything.
-    enableCommonRetransformation(true);
-    Class<?> transform3Class = new InMemoryDexClassLoader(
-        ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Main.class.getClassLoader()).loadClass("Transform3");
-    assertSame(null, getOriginalDexFile(transform3Class));
-
-    // Check that we end up with a java.lang.Long pointer if we do an 'on-load' redefinition.
-    addCommonTransformationResult("Transform3", new byte[0], DEX_BYTES_3_FINAL);
-    enableCommonRetransformation(true);
-    Class<?> transform3ClassTransformed = new InMemoryDexClassLoader(
-        ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Main.class.getClassLoader()).loadClass("Transform3");
-    assertSame(Long.class, getOriginalDexFile(transform3ClassTransformed).getClass());
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] class_file,
-                                                       byte[] dex_file);
-  private static native void enableCommonRetransformation(boolean enable);
-  private static native void addCommonTransformationResult(String target_name,
-                                                           byte[] class_bytes,
-                                                           byte[] dex_bytes);
 }
diff --git a/test/981-dedup-original-dex/src/Transform.java b/test/981-dedup-original-dex/src/Transform.java
deleted file mode 100644
index 3c97907..0000000
--- a/test/981-dedup-original-dex/src/Transform.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    System.out.println("hello");
-  }
-}
diff --git a/test/981-dedup-original-dex/src/Transform2.java b/test/981-dedup-original-dex/src/Transform2.java
deleted file mode 100644
index eb22842..0000000
--- a/test/981-dedup-original-dex/src/Transform2.java
+++ /dev/null
@@ -1,21 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform2 {
-  public void sayHi() {
-    System.out.println("hello2");
-  }
-}
diff --git a/test/981-dedup-original-dex/src/art/Redefinition.java b/test/981-dedup-original-dex/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/981-dedup-original-dex/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/981-dedup-original-dex/src/art/Test981.java b/test/981-dedup-original-dex/src/art/Test981.java
new file mode 100644
index 0000000..3a97268
--- /dev/null
+++ b/test/981-dedup-original-dex/src/art/Test981.java
@@ -0,0 +1,210 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Field;
+import java.util.Base64;
+import java.nio.ByteBuffer;
+
+import dalvik.system.ClassExt;
+import dalvik.system.InMemoryDexClassLoader;
+
+public class Test981 {
+
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+  static class Transform2 {
+    public void sayHi() {
+      System.out.println("hello2");
+    }
+  }
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] DEX_BYTES_1 = Base64.getDecoder().decode(
+    "ZGV4CjAzNQB+giqQAAAAAAAAAAAAAAAAAAAAAAAAAAC4AwAAcAAAAHhWNBIAAAAAAAAAAPQCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB0AgAARAEAAEQB" +
+    "AABMAQAAVQEAAG4BAAB9AQAAoQEAAMEBAADYAQAA7AEAAAACAAAUAgAAIgIAAC0CAAAwAgAANAIA" +
+    "AEECAABHAgAATAIAAFUCAABcAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABkAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA5AIAALgCAAAAAAAABjxpbml0PgAHR29vZGJ5ZQAX" +
+    "TGFydC9UZXN0OTgxJFRyYW5zZm9ybTsADUxhcnQvVGVzdDk4MTsAIkxkYWx2aWsvYW5ub3RhdGlv" +
+    "bi9FbmNsb3NpbmdDbGFzczsAHkxkYWx2aWsvYW5ub3RhdGlvbi9Jbm5lckNsYXNzOwAVTGphdmEv" +
+    "aW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAS" +
+    "TGphdmEvbGFuZy9TeXN0ZW07AAxUZXN0OTgxLmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vz" +
+    "c0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAQAAAAYAAAAFAAcOAAcA" +
+    "Bw4BCA8AAAAAAQABAAEAAABsAgAABAAAAHAQAwAAAA4AAwABAAIAAABxAgAACQAAAGIAAAAbAQEA" +
+    "AABuIAIAEAAOAAAAAAABAQCAgAT8BAEBlAUAAAICARMYAQIDAg4ECA8XCwACAAAAyAIAAM4CAADY" +
+    "AgAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAUAAAAcAAAAAIAAAAJAAAAwAAAAAMA" +
+    "AAACAAAA5AAAAAQAAAABAAAA/AAAAAUAAAAEAAAABAEAAAYAAAABAAAAJAEAAAIgAAAUAAAARAEA" +
+    "AAEQAAABAAAAZAIAAAMgAAACAAAAbAIAAAEgAAACAAAAfAIAAAAgAAABAAAAuAIAAAQgAAACAAAA" +
+    "yAIAAAMQAAABAAAA2AIAAAYgAAABAAAA5AIAAAAQAAABAAAA9AIAAA==");
+
+  /**
+   * base64 encoded class/dex file for
+   * static class Transform2 {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye2");
+   *   }
+   * }
+   */
+  private static final byte[] DEX_BYTES_2 = Base64.getDecoder().decode(
+    "ZGV4CjAzNQAhg+RVAAAAAAAAAAAAAAAAAAAAAAAAAAC8AwAAcAAAAHhWNBIAAAAAAAAAAPgCAAAU" +
+    "AAAAcAAAAAkAAADAAAAAAgAAAOQAAAABAAAA/AAAAAQAAAAEAQAAAQAAACQBAAB4AgAARAEAAEQB" +
+    "AABMAQAAVgEAAHABAAB/AQAAowEAAMMBAADaAQAA7gEAAAICAAAWAgAAJAIAADACAAAzAgAANwIA" +
+    "AEQCAABKAgAATwIAAFgCAABfAgAAAgAAAAMAAAAEAAAABQAAAAYAAAAHAAAACAAAAAkAAAAMAAAA" +
+    "DAAAAAgAAAAAAAAADQAAAAgAAABoAgAABwAEABAAAAAAAAAAAAAAAAAAAAASAAAABAABABEAAAAF" +
+    "AAAAAAAAAAAAAAAAAAAABQAAAAAAAAAKAAAA6AIAALwCAAAAAAAABjxpbml0PgAIR29vZGJ5ZTIA" +
+    "GExhcnQvVGVzdDk4MSRUcmFuc2Zvcm0yOwANTGFydC9UZXN0OTgxOwAiTGRhbHZpay9hbm5vdGF0" +
+    "aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVyQ2xhc3M7ABVMamF2" +
+    "YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7" +
+    "ABJMamF2YS9sYW5nL1N5c3RlbTsADFRlc3Q5ODEuamF2YQAKVHJhbnNmb3JtMgABVgACVkwAC2Fj" +
+    "Y2Vzc0ZsYWdzAARuYW1lAANvdXQAB3ByaW50bG4ABXNheUhpAAV2YWx1ZQAAAAEAAAAGAAAACgAH" +
+    "DgAMAAcOAQgPAAAAAAEAAQABAAAAcAIAAAQAAABwEAMAAAAOAAMAAQACAAAAdQIAAAkAAABiAAAA" +
+    "GwEBAAAAbiACABAADgAAAAAAAQEAgIAEgAUBAZgFAAACAgETGAECAwIOBAgPFwsAAgAAAMwCAADS" +
+    "AgAA3AIAAAAAAAAAAAAAAAAAABAAAAAAAAAAAQAAAAAAAAABAAAAFAAAAHAAAAACAAAACQAAAMAA" +
+    "AAADAAAAAgAAAOQAAAAEAAAAAQAAAPwAAAAFAAAABAAAAAQBAAAGAAAAAQAAACQBAAACIAAAFAAA" +
+    "AEQBAAABEAAAAQAAAGgCAAADIAAAAgAAAHACAAABIAAAAgAAAIACAAAAIAAAAQAAALwCAAAEIAAA" +
+    "AgAAAMwCAAADEAAAAQAAANwCAAAGIAAAAQAAAOgCAAAAEAAAAQAAAPgCAAA=");
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform3 {
+   *   public void sayHi() {
+   *    System.out.println("hello3");
+   *   }
+   * }
+   */
+  private static final byte[] DEX_BYTES_3_INITIAL = Base64.getDecoder().decode(
+    "ZGV4CjAzNQC2W2fBsAeLNAwWYlG8FVigzfsV7nBWITzQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+    "AABqAQAAeAEAAI8BAACjAQAAtwEAAMsBAADcAQAA3wEAAOMBAAD3AQAA/wEAAAQCAAANAgAAAQAA" +
+    "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAAB8CAAAA" +
+    "AAAAAQABAAEAAAAUAgAABAAAAHAQAwAAAA4AAwABAAIAAAAZAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAMTFRyYW5zZm9ybTM7ABVMamF2YS9pby9QcmludFN0cmVhbTsA" +
+    "EkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEvbGFuZy9TdHJpbmc7ABJMamF2YS9sYW5nL1N5c3Rl" +
+    "bTsAD1RyYW5zZm9ybTMuamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4zMAAGaGVsbG8zAANv" +
+    "dXQAB3ByaW50bG4ABXNheUhpAAIABw4ABAAHDocAAAABAQCAgASgAgEBuAIAAAANAAAAAAAAAAEA" +
+    "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+    "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+    "AyAAAAIAAAAUAgAAACAAAAEAAAAfAgAAABAAAAEAAAAwAgAA");
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform3 {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye3");
+   *   }
+   * }
+   */
+  private static final byte[] DEX_BYTES_3_FINAL = Base64.getDecoder().decode(
+    "ZGV4CjAzNQBAXE5GthgMydaFBuinf+ZBfXcBYIw2UlXQAgAAcAAAAHhWNBIAAAAAAAAAADACAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACwAQAAIAEAAGIB" +
+    "AABqAQAAdAEAAIIBAACZAQAArQEAAMEBAADVAQAA5gEAAOkBAADtAQAAAQIAAAYCAAAPAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAACECAAAA" +
+    "AAAAAQABAAEAAAAWAgAABAAAAHAQAwAAAA4AAwABAAIAAAAbAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAIR29vZGJ5ZTMADExUcmFuc2Zvcm0zOwAVTGphdmEvaW8vUHJp" +
+    "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+    "bGFuZy9TeXN0ZW07AA9UcmFuc2Zvcm0zLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMzAA" +
+    "A291dAAHcHJpbnRsbgAFc2F5SGkAAgAHDgAEAAcOhwAAAAEBAICABKACAQG4AgANAAAAAAAAAAEA" +
+    "AAAAAAAAAQAAAA4AAABwAAAAAgAAAAYAAACoAAAAAwAAAAIAAADAAAAABAAAAAEAAADYAAAABQAA" +
+    "AAQAAADgAAAABgAAAAEAAAAAAQAAASAAAAIAAAAgAQAAARAAAAEAAABcAQAAAiAAAA4AAABiAQAA" +
+    "AyAAAAIAAAAWAgAAACAAAAEAAAAhAgAAABAAAAEAAAAwAgAA");
+
+  public static void run() throws Exception {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+    doTest();
+  }
+
+  private static void assertSame(Object a, Object b) throws Exception {
+    if (a != b) {
+      throw new AssertionError("'" + (a != null ? a.toString() : "null") + "' is not the same as " +
+                               "'" + (b != null ? b.toString() : "null") + "'");
+    }
+  }
+
+  private static Object getObjectField(Object o, String name) throws Exception {
+    return getObjectField(o, o.getClass(), name);
+  }
+
+  private static Object getObjectField(Object o, Class<?> type, String name) throws Exception {
+    Field f = type.getDeclaredField(name);
+    f.setAccessible(true);
+    return f.get(o);
+  }
+
+  private static Object getOriginalDexFile(Class<?> k) throws Exception {
+    ClassExt ext_data_object = (ClassExt) getObjectField(k, "extData");
+    if (ext_data_object == null) {
+      return null;
+    }
+
+    return getObjectField(ext_data_object, "originalDexFile");
+  }
+
+  public static void doTest() throws Exception {
+    // Make sure both of these are loaded prior to transformations being added so they have the same
+    // original dex files.
+    Transform t1 = new Transform();
+    Transform2 t2 = new Transform2();
+
+    assertSame(null, getOriginalDexFile(t1.getClass()));
+    assertSame(null, getOriginalDexFile(t2.getClass()));
+    assertSame(null, getOriginalDexFile(Test981.class));
+
+    Redefinition.addCommonTransformationResult("art/Test981$Transform", new byte[0], DEX_BYTES_1);
+    Redefinition.addCommonTransformationResult("art/Test981$Transform2", new byte[0], DEX_BYTES_2);
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class, Transform2.class);
+
+    assertSame(getOriginalDexFile(t1.getClass()), getOriginalDexFile(t2.getClass()));
+    assertSame(null, getOriginalDexFile(Test981.class));
+    // Make sure that the original dex file is a DexCache object.
+    assertSame(getOriginalDexFile(t1.getClass()).getClass(), Class.forName("java.lang.DexCache"));
+
+    // Check that we end up with a byte[] if we do a direct RedefineClasses
+    Redefinition.enableCommonRetransformation(false);
+    Redefinition.doCommonClassRedefinition(Transform.class, new byte[0], DEX_BYTES_1);
+    assertSame((new byte[0]).getClass(), getOriginalDexFile(t1.getClass()).getClass());
+
+    // Check we don't have anything if we don't have any originalDexFile if the onload
+    // transformation doesn't do anything.
+    Redefinition.enableCommonRetransformation(true);
+    Class<?> transform3Class = new InMemoryDexClassLoader(
+        ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Test981.class.getClassLoader()).loadClass("Transform3");
+    assertSame(null, getOriginalDexFile(transform3Class));
+
+    // Check that we end up with a java.lang.Long pointer if we do an 'on-load' redefinition.
+    Redefinition.addCommonTransformationResult("Transform3", new byte[0], DEX_BYTES_3_FINAL);
+    Redefinition.enableCommonRetransformation(true);
+    Class<?> transform3ClassTransformed = new InMemoryDexClassLoader(
+        ByteBuffer.wrap(DEX_BYTES_3_INITIAL), Test981.class.getClassLoader()).loadClass("Transform3");
+    assertSame(Long.class, getOriginalDexFile(transform3ClassTransformed).getClass());
+  }
+}
diff --git a/test/982-ok-no-retransform/src/Main.java b/test/982-ok-no-retransform/src/Main.java
index 33e50d7..bd73e81 100644
--- a/test/982-ok-no-retransform/src/Main.java
+++ b/test/982-ok-no-retransform/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,22 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest(new Transform());
+  public static void main(String[] args) throws Exception {
+    art.Test982.run();
   }
-
-  public static void doTest(Transform t) {
-    t.sayHi();
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class);
-    t.sayHi();
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void enableCommonRetransformation(boolean enable);
 }
diff --git a/test/982-ok-no-retransform/src/Transform.java b/test/982-ok-no-retransform/src/Transform.java
deleted file mode 100644
index 8e8af35..0000000
--- a/test/982-ok-no-retransform/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/982-ok-no-retransform/src/art/Redefinition.java b/test/982-ok-no-retransform/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/982-ok-no-retransform/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/982-ok-no-retransform/src/art/Test982.java b/test/982-ok-no-retransform/src/art/Test982.java
new file mode 100644
index 0000000..080d47f
--- /dev/null
+++ b/test/982-ok-no-retransform/src/art/Test982.java
@@ -0,0 +1,39 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test982 {
+
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+  public static void run() {
+    Redefinition.setTestConfiguration(Redefinition.Config.COMMON_RETRANSFORM);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+}
diff --git a/test/983-source-transform-verify/expected.txt b/test/983-source-transform-verify/expected.txt
index 0a94212..abcdf3a 100644
--- a/test/983-source-transform-verify/expected.txt
+++ b/test/983-source-transform-verify/expected.txt
@@ -1,2 +1,2 @@
-Dex file hook for Transform
+Dex file hook for art/Test983$Transform
 Dex file hook for java/lang/Object
diff --git a/test/983-source-transform-verify/src/Main.java b/test/983-source-transform-verify/src/Main.java
index ad081a2..e1d20f6 100644
--- a/test/983-source-transform-verify/src/Main.java
+++ b/test/983-source-transform-verify/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,23 +14,8 @@
  * limitations under the License.
  */
 
-import java.util.Base64;
 public class Main {
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest();
+  public static void main(String[] args) throws Exception {
+    art.Test983.run();
   }
-
-  public static void doTest() {
-    Transform abc = new Transform();
-    enableCommonRetransformation(true);
-    doCommonClassRetransformation(Transform.class);
-    doCommonClassRetransformation(Object.class);
-    enableCommonRetransformation(false);
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRetransformation(Class<?>... target);
-  private static native void enableCommonRetransformation(boolean enable);
 }
diff --git a/test/983-source-transform-verify/src/Transform.java b/test/983-source-transform-verify/src/Transform.java
deleted file mode 100644
index 8e8af35..0000000
--- a/test/983-source-transform-verify/src/Transform.java
+++ /dev/null
@@ -1,28 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  public void sayHi() {
-    // Use lower 'h' to make sure the string will have a different string id
-    // than the transformation (the transformation code is the same except
-    // the actual printed String, which was making the test inacurately passing
-    // in JIT mode when loading the string from the dex cache, as the string ids
-    // of the two different strings were the same).
-    // We know the string ids will be different because lexicographically:
-    // "Goodbye" < "LTransform;" < "hello".
-    System.out.println("hello");
-  }
-}
diff --git a/test/983-source-transform-verify/src/art/Redefinition.java b/test/983-source-transform-verify/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/983-source-transform-verify/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/983-source-transform-verify/src/art/Test983.java b/test/983-source-transform-verify/src/art/Test983.java
new file mode 100644
index 0000000..b81e7f4
--- /dev/null
+++ b/test/983-source-transform-verify/src/art/Test983.java
@@ -0,0 +1,38 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.Base64;
+public class Test983 {
+  static class Transform {
+    public void sayHi() {
+      System.out.println("hello");
+    }
+  }
+
+  public static void run() {
+    doTest();
+  }
+
+  public static void doTest() {
+    Transform abc = new Transform();
+    Redefinition.enableCommonRetransformation(true);
+    Redefinition.doCommonClassRetransformation(Transform.class);
+    Redefinition.doCommonClassRetransformation(Object.class);
+    Redefinition.enableCommonRetransformation(false);
+  }
+}
diff --git a/test/984-obsolete-invoke/obsolete_invoke.cc b/test/984-obsolete-invoke/obsolete_invoke.cc
index 27e36ba..ab2499a 100644
--- a/test/984-obsolete-invoke/obsolete_invoke.cc
+++ b/test/984-obsolete-invoke/obsolete_invoke.cc
@@ -17,20 +17,20 @@
 #include "android-base/macros.h"
 #include "jni.h"
 #include "jvmti.h"
-#include "mirror/class-inl.h"
-#include "scoped_local_ref.h"
 
 // Test infrastructure
 #include "test_env.h"
 
 #include "jvmti_helper.h"
+#include "scoped_local_ref.h"
 
 namespace art {
 namespace Test984ObsoleteInvoke {
 
 static constexpr size_t kNumFrames = 30;
 
-extern "C" JNIEXPORT jobject JNICALL Java_Main_getFirstObsoleteMethod984(JNIEnv* env, jclass) {
+extern "C" JNIEXPORT jobject JNICALL Java_art_Test984_getFirstObsoleteMethod984(JNIEnv* env,
+                                                                                jclass) {
   jthread cur;
   jint frame_count;
   jvmtiFrameInfo frames[kNumFrames];
diff --git a/test/984-obsolete-invoke/src/Main.java b/test/984-obsolete-invoke/src/Main.java
index 418d64d..04a368dc 100644
--- a/test/984-obsolete-invoke/src/Main.java
+++ b/test/984-obsolete-invoke/src/Main.java
@@ -1,5 +1,5 @@
 /*
- * Copyright (C) 2016 The Android Open Source Project
+ * Copyright (C) 2017 The Android Open Source Project
  *
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
@@ -14,96 +14,8 @@
  * limitations under the License.
  */
 
-import java.lang.reflect.Method;
-import java.util.Base64;
-
 public class Main {
-  // class Transform {
-  //   public static void sayHi(Runnable r) {
-  //     System.out.println("Hello - Transformed");
-  //     r.run();
-  //     System.out.println("Goodbye - Transformed");
-  //   }
-  // }
-  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
-    "yv66vgAAADQAJAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAaBwAbAQAGPGluaXQ+AQADKClW" +
-    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
-    "KVYBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkACgcAHAwAHQAeAQATSGVsbG8gLSBU" +
-    "cmFuc2Zvcm1lZAcAHwwAIAAhBwAiDAAjAAoBABVHb29kYnllIC0gVHJhbnNmb3JtZWQBAAlUcmFu" +
-    "c2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZh" +
-    "L2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZh" +
-    "L2xhbmcvU3RyaW5nOylWAQASamF2YS9sYW5nL1J1bm5hYmxlAQADcnVuACAABwAIAAAAAAACAAAA" +
-    "CQAKAAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAAAQAJAA0ADgABAAsAAAA7AAIA" +
-    "AQAAABeyAAISA7YABCq5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAMACAAEAA4ABQAWAAYA" +
-    "AQAPAAAAAgAQ");
-  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
-    "ZGV4CjAzNQCMekj2NPwzrEp/v+2yzzSg8xZvBtU1bC1QAwAAcAAAAHhWNBIAAAAAAAAAALACAAAR" +
-    "AAAAcAAAAAcAAAC0AAAAAwAAANAAAAABAAAA9AAAAAUAAAD8AAAAAQAAACQBAAAMAgAARAEAAKIB" +
-    "AACqAQAAwQEAANYBAADjAQAA+gEAAA4CAAAkAgAAOAIAAEwCAABcAgAAXwIAAGMCAAB3AgAAfAIA" +
-    "AIUCAACKAgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACgAAAAoAAAAGAAAAAAAAAAsAAAAGAAAA" +
-    "lAEAAAsAAAAGAAAAnAEAAAUAAQANAAAAAAAAAAAAAAAAAAEAEAAAAAEAAgAOAAAAAgAAAAAAAAAD" +
-    "AAAADwAAAAAAAAAAAAAAAgAAAAAAAAAJAAAAAAAAAJ8CAAAAAAAAAQABAAEAAACRAgAABAAAAHAQ" +
-    "AwAAAA4AAwABAAIAAACWAgAAFAAAAGIAAAAbAQIAAABuIAIAEAByEAQAAgBiAAAAGwEBAAAAbiAC" +
-    "ABAADgABAAAAAwAAAAEAAAAEAAY8aW5pdD4AFUdvb2RieWUgLSBUcmFuc2Zvcm1lZAATSGVsbG8g" +
-    "LSBUcmFuc2Zvcm1lZAALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwASTGphdmEv" +
-    "bGFuZy9PYmplY3Q7ABRMamF2YS9sYW5nL1J1bm5hYmxlOwASTGphdmEvbGFuZy9TdHJpbmc7ABJM" +
-    "amF2YS9sYW5nL1N5c3RlbTsADlRyYW5zZm9ybS5qYXZhAAFWAAJWTAASZW1pdHRlcjogamFjay00" +
-    "LjMxAANvdXQAB3ByaW50bG4AA3J1bgAFc2F5SGkAAQAHDgADAQAHDoc8hwAAAAIAAICABMQCAQnc" +
-    "AgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEQAAAHAAAAACAAAABwAAALQAAAADAAAAAwAAANAAAAAE" +
-    "AAAAAQAAAPQAAAAFAAAABQAAAPwAAAAGAAAAAQAAACQBAAABIAAAAgAAAEQBAAABEAAAAgAAAJQB" +
-    "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
-
-  public static void main(String[] args) {
-    art.Main.bindAgentJNIForClass(Main.class);
-    doTest();
+  public static void main(String[] args) throws Exception {
+    art.Test984.run();
   }
-
-  // The Method that holds an obsolete method pointer. We will fill it in by getting a jmethodID
-  // from a stack with an obsolete method in it. There should be no other ways to obtain an obsolete
-  // jmethodID in ART without unsafe casts.
-  public static Method obsolete_method = null;
-
-  public static void doTest() {
-    // Capture the obsolete method.
-    //
-    // NB The obsolete method must be direct so that we will not look in the receiver type to get
-    // the actual method.
-    Transform.sayHi(() -> {
-      System.out.println("transforming calling function");
-      doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
-      System.out.println("Retrieving obsolete method from current stack");
-      // This should get the obsolete sayHi method (as the only obsolete method on the current
-      // threads stack).
-      Main.obsolete_method = getFirstObsoleteMethod984();
-    });
-
-    // Prove we did actually redefine something.
-    System.out.println("Invoking redefined version of method.");
-    Transform.sayHi(() -> { System.out.println("Not doing anything here"); });
-
-    System.out.println("invoking obsolete method");
-    try {
-      obsolete_method.invoke(null, (Runnable)() -> {
-        throw new Error("Unexpected code running from invoke of obsolete method!");
-      });
-      throw new Error("Running obsolete method did not throw exception");
-    } catch (Throwable e) {
-      if (e instanceof InternalError || e.getCause() instanceof InternalError) {
-        System.out.println("Caught expected error from attempting to invoke an obsolete method.");
-      } else {
-        System.out.println("Unexpected error type for calling obsolete method! Expected either "
-            + "an InternalError or something that is caused by an InternalError.");
-        throw new Error("Unexpected error caught: ", e);
-      }
-    }
-  }
-
-  // Transforms the class
-  private static native void doCommonClassRedefinition(Class<?> target,
-                                                       byte[] classfile,
-                                                       byte[] dexfile);
-
-  // Gets the first obsolete method on the current threads stack (NB only looks through the first 30
-  // stack frames).
-  private static native Method getFirstObsoleteMethod984();
 }
diff --git a/test/984-obsolete-invoke/src/Transform.java b/test/984-obsolete-invoke/src/Transform.java
deleted file mode 100644
index 536de84..0000000
--- a/test/984-obsolete-invoke/src/Transform.java
+++ /dev/null
@@ -1,25 +0,0 @@
-/*
- * Copyright (C) 2016 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-class Transform {
-  // This method must be 'static' so that when we try to invoke it through a j.l.r.Method we will
-  // simply use the jmethodID directly and not do any lookup in any receiver object.
-  public static void sayHi(Runnable r) {
-    System.out.println("hello");
-    r.run();
-    System.out.println("goodbye");
-  }
-}
diff --git a/test/984-obsolete-invoke/src/art/Redefinition.java b/test/984-obsolete-invoke/src/art/Redefinition.java
new file mode 100644
index 0000000..0350ab4
--- /dev/null
+++ b/test/984-obsolete-invoke/src/art/Redefinition.java
@@ -0,0 +1,96 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.util.ArrayList;
+// Common Redefinition functions. Placed here for use by CTS
+public class Redefinition {
+  // Bind native functions.
+  static {
+    Main.bindAgentJNIForClass(Redefinition.class);
+  }
+
+  public static final class CommonClassDefinition {
+    public final Class<?> target;
+    public final byte[] class_file_bytes;
+    public final byte[] dex_file_bytes;
+
+    public CommonClassDefinition(Class<?> target, byte[] class_file_bytes, byte[] dex_file_bytes) {
+      this.target = target;
+      this.class_file_bytes = class_file_bytes;
+      this.dex_file_bytes = dex_file_bytes;
+    }
+  }
+
+  // A set of possible test configurations. Test should set this if they need to.
+  // This must be kept in sync with the defines in ti-agent/common_helper.cc
+  public static enum Config {
+    COMMON_REDEFINE(0),
+    COMMON_RETRANSFORM(1),
+    COMMON_TRANSFORM(2);
+
+    private final int val;
+    private Config(int val) {
+      this.val = val;
+    }
+  }
+
+  public static void setTestConfiguration(Config type) {
+    nativeSetTestConfiguration(type.val);
+  }
+
+  private static native void nativeSetTestConfiguration(int type);
+
+  // Transforms the class
+  public static native void doCommonClassRedefinition(Class<?> target,
+                                                      byte[] classfile,
+                                                      byte[] dexfile);
+
+  public static void doMultiClassRedefinition(CommonClassDefinition... defs) {
+    ArrayList<Class<?>> classes = new ArrayList<>();
+    ArrayList<byte[]> class_files = new ArrayList<>();
+    ArrayList<byte[]> dex_files = new ArrayList<>();
+
+    for (CommonClassDefinition d : defs) {
+      classes.add(d.target);
+      class_files.add(d.class_file_bytes);
+      dex_files.add(d.dex_file_bytes);
+    }
+    doCommonMultiClassRedefinition(classes.toArray(new Class<?>[0]),
+                                   class_files.toArray(new byte[0][]),
+                                   dex_files.toArray(new byte[0][]));
+  }
+
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
+  public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
+                                                           byte[][] classfiles,
+                                                           byte[][] dexfiles);
+  public static native void doCommonClassRetransformation(Class<?>... target);
+  public static native void setPopRetransformations(boolean pop);
+  public static native void popTransformationFor(String name);
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
+}
diff --git a/test/984-obsolete-invoke/src/art/Test984.java b/test/984-obsolete-invoke/src/art/Test984.java
new file mode 100644
index 0000000..3fe66f6
--- /dev/null
+++ b/test/984-obsolete-invoke/src/art/Test984.java
@@ -0,0 +1,122 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Method;
+import java.util.Base64;
+
+public class Test984 {
+
+  static class Transform {
+    // This method must be 'static' so that when we try to invoke it through a j.l.r.Method we will
+    // simply use the jmethodID directly and not do any lookup in any receiver object.
+    public static void sayHi(Runnable r) {
+      System.out.println("hello");
+      r.run();
+      System.out.println("goodbye");
+    }
+  }
+  // static class Transform {
+  //   public static void sayHi(Runnable r) {
+  //     System.out.println("Hello - Transformed");
+  //     r.run();
+  //     System.out.println("Goodbye - Transformed");
+  //   }
+  // }
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAKAoACAARCQASABMIABQKABUAFgsAFwAYCAAZBwAbBwAeAQAGPGluaXQ+AQADKClW" +
+    "AQAEQ29kZQEAD0xpbmVOdW1iZXJUYWJsZQEABXNheUhpAQAXKExqYXZhL2xhbmcvUnVubmFibGU7" +
+    "KVYBAApTb3VyY2VGaWxlAQAMVGVzdDk4NC5qYXZhDAAJAAoHAB8MACAAIQEAE0hlbGxvIC0gVHJh" +
+    "bnNmb3JtZWQHACIMACMAJAcAJQwAJgAKAQAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkBwAnAQAVYXJ0" +
+    "L1Rlc3Q5ODQkVHJhbnNmb3JtAQAJVHJhbnNmb3JtAQAMSW5uZXJDbGFzc2VzAQAQamF2YS9sYW5n" +
+    "L09iamVjdAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsB" +
+    "ABNqYXZhL2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgEA" +
+    "EmphdmEvbGFuZy9SdW5uYWJsZQEAA3J1bgEAC2FydC9UZXN0OTg0ACAABwAIAAAAAAACAAAACQAK" +
+    "AAEACwAAAB0AAQABAAAABSq3AAGxAAAAAQAMAAAABgABAAAABQAJAA0ADgABAAsAAAA7AAIAAQAA" +
+    "ABeyAAISA7YABCq5AAUBALIAAhIGtgAEsQAAAAEADAAAABIABAAAAAcACAAIAA4ACQAWAAoAAgAP" +
+    "AAAAAgAQAB0AAAAKAAEABwAaABwACA==");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQB/mxSMAAAAAAAAAAAAAAAAAAAAAAAAAAA8BAAAcAAAAHhWNBIAAAAAAAAAAHgDAAAX" +
+    "AAAAcAAAAAoAAADMAAAAAwAAAPQAAAABAAAAGAEAAAUAAAAgAQAAAQAAAEgBAADUAgAAaAEAAGgB" +
+    "AABwAQAAhwEAAJwBAAC1AQAAxAEAAOgBAAAIAgAAHwIAADMCAABJAgAAXQIAAHECAAB/AgAAigIA" +
+    "AI0CAACRAgAAngIAAKQCAACpAgAAsgIAALcCAAC+AgAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAA" +
+    "CQAAAAoAAAALAAAADgAAAA4AAAAJAAAAAAAAAA8AAAAJAAAAyAIAAA8AAAAJAAAA0AIAAAgABAAS" +
+    "AAAAAAAAAAAAAAAAAAEAFQAAAAQAAgATAAAABQAAAAAAAAAGAAAAFAAAAAAAAAAAAAAABQAAAAAA" +
+    "AAAMAAAAaAMAADwDAAAAAAAABjxpbml0PgAVR29vZGJ5ZSAtIFRyYW5zZm9ybWVkABNIZWxsbyAt" +
+    "IFRyYW5zZm9ybWVkABdMYXJ0L1Rlc3Q5ODQkVHJhbnNmb3JtOwANTGFydC9UZXN0OTg0OwAiTGRh" +
+    "bHZpay9hbm5vdGF0aW9uL0VuY2xvc2luZ0NsYXNzOwAeTGRhbHZpay9hbm5vdGF0aW9uL0lubmVy" +
+    "Q2xhc3M7ABVMamF2YS9pby9QcmludFN0cmVhbTsAEkxqYXZhL2xhbmcvT2JqZWN0OwAUTGphdmEv" +
+    "bGFuZy9SdW5uYWJsZTsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AAxU" +
+    "ZXN0OTg0LmphdmEACVRyYW5zZm9ybQABVgACVkwAC2FjY2Vzc0ZsYWdzAARuYW1lAANvdXQAB3By" +
+    "aW50bG4AA3J1bgAFc2F5SGkABXZhbHVlAAAAAAEAAAAGAAAAAQAAAAcAAAAFAAcOAAcBAAcOAQgP" +
+    "AQMPAQgPAAEAAQABAAAA2AIAAAQAAABwEAMAAAAOAAMAAQACAAAA3QIAABQAAABiAAAAGwECAAAA" +
+    "biACABAAchAEAAIAYgAAABsBAQAAAG4gAgAQAA4AAAACAACAgATsBQEJhAYAAAICARYYAQIDAhAE" +
+    "CBEXDQACAAAATAMAAFIDAABcAwAAAAAAAAAAAAAAAAAAEAAAAAAAAAABAAAAAAAAAAEAAAAXAAAA" +
+    "cAAAAAIAAAAKAAAAzAAAAAMAAAADAAAA9AAAAAQAAAABAAAAGAEAAAUAAAAFAAAAIAEAAAYAAAAB" +
+    "AAAASAEAAAIgAAAXAAAAaAEAAAEQAAACAAAAyAIAAAMgAAACAAAA2AIAAAEgAAACAAAA7AIAAAAg" +
+    "AAABAAAAPAMAAAQgAAACAAAATAMAAAMQAAABAAAAXAMAAAYgAAABAAAAaAMAAAAQAAABAAAAeAMA" +
+    "AA==");
+
+  public static void run() {
+    art.Main.bindAgentJNIForClass(Test984.class);
+    doTest();
+  }
+
+  // The Method that holds an obsolete method pointer. We will fill it in by getting a jmethodID
+  // from a stack with an obsolete method in it. There should be no other ways to obtain an obsolete
+  // jmethodID in ART without unsafe casts.
+  public static Method obsolete_method = null;
+
+  public static void doTest() {
+    // Capture the obsolete method.
+    //
+    // NB The obsolete method must be direct so that we will not look in the receiver type to get
+    // the actual method.
+    Transform.sayHi(() -> {
+      System.out.println("transforming calling function");
+      Redefinition.doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+      System.out.println("Retrieving obsolete method from current stack");
+      // This should get the obsolete sayHi method (as the only obsolete method on the current
+      // threads stack).
+      Test984.obsolete_method = getFirstObsoleteMethod984();
+    });
+
+    // Prove we did actually redefine something.
+    System.out.println("Invoking redefined version of method.");
+    Transform.sayHi(() -> { System.out.println("Not doing anything here"); });
+
+    System.out.println("invoking obsolete method");
+    try {
+      obsolete_method.invoke(null, (Runnable)() -> {
+        throw new Error("Unexpected code running from invoke of obsolete method!");
+      });
+      throw new Error("Running obsolete method did not throw exception");
+    } catch (Throwable e) {
+      if (e instanceof InternalError || e.getCause() instanceof InternalError) {
+        System.out.println("Caught expected error from attempting to invoke an obsolete method.");
+      } else {
+        System.out.println("Unexpected error type for calling obsolete method! Expected either "
+            + "an InternalError or something that is caused by an InternalError.");
+        throw new Error("Unexpected error caught: ", e);
+      }
+    }
+  }
+
+  // Gets the first obsolete method on the current threads stack (NB only looks through the first 30
+  // stack frames).
+  private static native Method getFirstObsoleteMethod984();
+}
diff --git a/test/Android.bp b/test/Android.bp
index 8059a2f..c5d96da 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -250,6 +250,7 @@
         "ti-agent/jni_binder.cc",
         "ti-agent/jvmti_helper.cc",
         "ti-agent/test_env.cc",
+        "ti-agent/common_helper.cc",
         // This is the list of non-special OnLoad things and excludes BCI and anything that depends
         // on ART internals.
         "903-hello-tagging/tagging.cc",
@@ -260,6 +261,7 @@
         "908-gc-start-finish/gc_callbacks.cc",
         "910-methods/methods.cc",
         "911-get-stack-trace/stack_trace.cc",
+        "913-heaps/heaps.cc",
         "918-fields/fields.cc",
         "920-objects/objects.cc",
         "922-properties/properties.cc",
@@ -271,6 +273,8 @@
         "929-search/search.cc",
         "931-agent-thread/agent_thread.cc",
         "933-misc-events/misc_events.cc",
+        "945-obsolete-native/obsolete_native.cc",
+        "984-obsolete-invoke/obsolete_invoke.cc",
     ],
     shared_libs: [
         "libbase",
@@ -286,20 +290,14 @@
         // This is to get the IsInterpreted native method.
         "common/stack_inspect.cc",
         "common/runtime_state.cc",
+        "ti-agent/common_load.cc",
         // This includes the remaining test functions. We should try to refactor things to
         // make this list smaller.
-        "ti-agent/common_helper.cc",
-        "ti-agent/common_load.cc",
         "901-hello-ti-agent/basics.cc",
         "909-attach-agent/attach.cc",
         "912-classes/classes.cc",
-        "913-heaps/heaps.cc",
         "936-search-onload/search_onload.cc",
-        "944-transform-classloaders/classloader.cc",
-        "945-obsolete-native/obsolete_native.cc",
-        "980-redefine-object/redefine_object.cc",
         "983-source-transform-verify/source_transform.cc",
-        "984-obsolete-invoke/obsolete_invoke.cc",
     ],
 }
 
diff --git a/test/Android.run-test-jvmti-java-library.mk b/test/Android.run-test-jvmti-java-library.mk
index b6da92b..dcb238c 100644
--- a/test/Android.run-test-jvmti-java-library.mk
+++ b/test/Android.run-test-jvmti-java-library.mk
@@ -18,13 +18,17 @@
 
 include $(CLEAR_VARS)
 
-# Main shim classes. We use one that exposes the tagging common functionality.
-LOCAL_MAIN_SHIM := 903-hello-tagging/src/art/Main.java
-LOCAL_SRC_FILES := $(LOCAL_MAIN_SHIM)
+# shim classes. We use one that exposes the common functionality.
+LOCAL_SHIM_CLASSES := \
+  902-hello-transformation/src/art/Redefinition.java \
+  903-hello-tagging/src/art/Main.java \
+
+LOCAL_SRC_FILES := $(LOCAL_SHIM_CLASSES)
 
 # Actual test classes.
 LOCAL_SRC_FILES += \
   901-hello-ti-agent/src/art/Test901.java \
+  902-hello-transformation/src/art/Test902.java \
   903-hello-tagging/src/art/Test903.java \
   904-object-allocation/src/art/Test904.java \
   905-object-free/src/art/Test905.java \
@@ -42,19 +46,36 @@
     911-get-stack-trace/src/art/SameThread.java \
     911-get-stack-trace/src/art/ThreadListTraces.java \
   913-heaps/src/art/Test913.java \
+  914-hello-obsolescence/src/art/Test914.java \
+  915-obsolete-2/src/art/Test915.java \
+  917-fields-transformation/src/art/Test917.java \
   918-fields/src/art/Test918.java \
+  919-obsolete-fields/src/art/Test919.java \
   920-objects/src/art/Test920.java \
   922-properties/src/art/Test922.java \
   923-monitors/src/art/Test923.java \
   924-threads/src/art/Test924.java \
   925-threadgroups/src/art/Test925.java \
+  926-multi-obsolescence/src/art/Test926.java \
   927-timers/src/art/Test927.java \
   928-jni-table/src/art/Test928.java \
+  930-hello-retransform/src/art/Test930.java \
   931-agent-thread/src/art/Test931.java \
+  932-transform-saves/src/art/Test932.java \
   933-misc-events/src/art/Test933.java \
+  940-recursive-obsolete/src/art/Test940.java \
+  942-private-recursive/src/art/Test942.java \
+  944-transform-classloaders/src/art/Test944.java \
+  945-obsolete-native/src/art/Test945.java \
+  947-reflect-method/src/art/Test947.java \
+  951-threaded-obsolete/src/art/Test951.java \
+  981-dedup-original-dex/src/art/Test981.java \
+  982-ok-no-retransform/src/art/Test982.java \
+  984-obsolete-invoke/src/art/Test984.java \
 
 JVMTI_RUN_TEST_GENERATED_NUMBERS := \
   901 \
+  902 \
   903 \
   904 \
   905 \
@@ -64,16 +85,32 @@
   910 \
   911 \
   913 \
+  914 \
+  915 \
+  917 \
   918 \
+  919 \
   920 \
   922 \
   923 \
   924 \
   925 \
+  926 \
   927 \
   928 \
+  930 \
   931 \
+  932 \
   933 \
+  940 \
+  942 \
+  944 \
+  945 \
+  947 \
+  951 \
+  981 \
+  982 \
+  984 \
 
 # Try to enforce that the directories correspond to the Java files we pull in.
 JVMTI_RUN_TEST_DIR_CHECK := $(sort $(foreach DIR,$(JVMTI_RUN_TEST_GENERATED_NUMBERS), \
diff --git a/test/etc/default-build b/test/etc/default-build
index d74b24d..744c38b 100755
--- a/test/etc/default-build
+++ b/test/etc/default-build
@@ -91,7 +91,7 @@
 JAVAC_EXPERIMENTAL_ARGS["lambdas"]="-source 1.8 -target 1.8"
 JAVAC_EXPERIMENTAL_ARGS["method-handles"]="-source 1.8 -target 1.8"
 # We need to leave javac at default 1.7 so that dx will continue to work
-JAVAC_EXPERIMENTAL_ARGS[${DEFAULT_EXPERIMENT}]="-source 1.7 -target 1.7"
+JAVAC_EXPERIMENTAL_ARGS[${DEFAULT_EXPERIMENT}]="-source 1.8 -target 1.8"
 JAVAC_EXPERIMENTAL_ARGS["agents"]="-source 1.8 -target 1.8"
 
 while true; do
diff --git a/test/knownfailures.json b/test/knownfailures.json
index 54786bb..29c1e8b 100644
--- a/test/knownfailures.json
+++ b/test/knownfailures.json
@@ -601,20 +601,20 @@
     },
     {
         "tests": [
-            "008-exceptions",
             "031-class-attributes",
-            "034-call-null",
-            "038-inner-null",
-            "054-uncaught",
-            "122-npe",
-            "439-npe",
-            "911-get-stack-trace",
-            "946-obsolete-throw"
+            "911-get-stack-trace"
         ],
         "description": [
             "Tests that use annotations and debug data that is not kept around by dexter."
         ],
-        "bug": "b/37240685 & b/37239009",
+        "bug": "b/37239009",
         "variant": "jvmti-stress"
+    },
+    {
+        "tests": "160-read-barrier-stress",
+        "description": ["Disable 160-read-barrier-stress temporarily until we find ",
+                        "a fix to avoid the OOME with Jack. Note that it cannot be compiled ",
+                        "by javac either ('error: code too large')"],
+        "bug": "http://b/37335480"
     }
 ]
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index ab5dbcc..bfd4d25 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -17,18 +17,15 @@
 #include "common_helper.h"
 
 #include <dlfcn.h>
+#include <map>
 #include <stdio.h>
 #include <sstream>
 #include <deque>
+#include <vector>
 
 #include "android-base/stringprintf.h"
-#include "art_method.h"
 #include "jni.h"
-#include "jni_internal.h"
 #include "jvmti.h"
-#include "scoped_thread_state_change-inl.h"
-#include "stack.h"
-#include "utils.h"
 
 #include "jni_binder.h"
 #include "jvmti_helper.h"
@@ -37,6 +34,10 @@
 
 namespace art {
 
+static void SetupCommonRetransform();
+static void SetupCommonRedefine();
+static void SetupCommonTransform();
+
 template <bool is_redefine>
 static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
                                          JNIEnv* env,
@@ -108,18 +109,15 @@
 
 // Magic JNI export that classes can use for redefining classes.
 // To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env,
-                                                                      jclass,
-                                                                      jclass target,
-                                                                      jbyteArray class_file_bytes,
-                                                                      jbyteArray dex_file_bytes) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonClassRedefinition(
+    JNIEnv* env, jclass, jclass target, jbyteArray class_file_bytes, jbyteArray dex_file_bytes) {
   DoClassRedefine(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
 }
 
 // Magic JNI export that classes can use for redefining classes.
 // To use classes should declare this as a native function with signature
 // ([Ljava/lang/Class;[[B[[B)V
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonMultiClassRedefinition(
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonMultiClassRedefinition(
     JNIEnv* env,
     jclass,
     jobjectArray targets,
@@ -155,11 +153,7 @@
     printf("Unable to get jvmti env!\n");
     return 1;
   }
-  jvmtiCapabilities caps;
-  jvmti_env->GetPotentialCapabilities(&caps);
-  caps.can_retransform_classes = 0;
-  caps.can_retransform_any_class = 0;
-  jvmti_env->AddCapabilities(&caps);
+  SetupCommonRedefine();
   return 0;
 }
 
@@ -183,11 +177,8 @@
 std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
 bool gPopTransformations = true;
 
-extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
-                                                                          jclass,
-                                                                          jstring class_name,
-                                                                          jbyteArray class_array,
-                                                                          jbyteArray dex_array) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_addCommonTransformationResult(
+    JNIEnv* env, jclass, jstring class_name, jbyteArray class_array, jbyteArray dex_array) {
   const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
   std::string name_str(name_chrs);
   env->ReleaseStringUTFChars(class_name, name_chrs);
@@ -244,15 +235,15 @@
   }
 }
 
-extern "C" JNIEXPORT void Java_Main_setPopRetransformations(JNIEnv*,
-                                                            jclass,
-                                                            jboolean enable) {
+extern "C" JNIEXPORT void Java_art_Redefinition_setPopRetransformations(JNIEnv*,
+                                                                        jclass,
+                                                                        jboolean enable) {
   gPopTransformations = enable;
 }
 
-extern "C" JNIEXPORT void Java_Main_popTransformationFor(JNIEnv* env,
-                                                         jclass,
-                                                         jstring class_name) {
+extern "C" JNIEXPORT void Java_art_Redefinition_popTransformationFor(JNIEnv* env,
+                                                                         jclass,
+                                                                         jstring class_name) {
   const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
   std::string name_str(name_chrs);
   env->ReleaseStringUTFChars(class_name, name_chrs);
@@ -267,9 +258,9 @@
   }
 }
 
-extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
-                                                                 jclass,
-                                                                 jboolean enable) {
+extern "C" JNIEXPORT void Java_art_Redefinition_enableCommonRetransformation(JNIEnv* env,
+                                                                                 jclass,
+                                                                                 jboolean enable) {
   jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
                                                        JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
                                                        nullptr);
@@ -298,9 +289,8 @@
   }
 }
 
-extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
-                                                                          jclass,
-                                                                          jobjectArray targets) {
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_doCommonClassRetransformation(
+    JNIEnv* env, jclass, jobjectArray targets) {
   jvmtiCapabilities caps;
   jvmtiError caps_err = jvmti_env->GetCapabilities(&caps);
   if (caps_err != JVMTI_ERROR_NONE) {
@@ -338,14 +328,7 @@
     printf("Unable to get jvmti env!\n");
     return 1;
   }
-  SetAllCapabilities(jvmti_env);
-  jvmtiEventCallbacks cb;
-  memset(&cb, 0, sizeof(cb));
-  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
-  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
-    printf("Unable to set class file load hook cb!\n");
-    return 1;
-  }
+  SetupCommonRetransform();
   return 0;
 }
 
@@ -353,8 +336,6 @@
 
 namespace common_transform {
 
-using art::common_retransform::CommonClassFileLoadHookRetransformable;
-
 // Get all capabilities except those related to retransformation.
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
@@ -363,6 +344,35 @@
     printf("Unable to get jvmti env!\n");
     return 1;
   }
+  SetupCommonTransform();
+  return 0;
+}
+
+}  // namespace common_transform
+
+#define CONFIGURATION_COMMON_REDEFINE 0
+#define CONFIGURATION_COMMON_RETRANSFORM 1
+#define CONFIGURATION_COMMON_TRANSFORM 2
+
+static void SetupCommonRedefine() {
+  jvmtiCapabilities caps;
+  jvmti_env->GetPotentialCapabilities(&caps);
+  caps.can_retransform_classes = 0;
+  caps.can_retransform_any_class = 0;
+  jvmti_env->AddCapabilities(&caps);
+}
+
+static void SetupCommonRetransform() {
+  SetAllCapabilities(jvmti_env);
+  jvmtiEventCallbacks cb;
+  memset(&cb, 0, sizeof(cb));
+  cb.ClassFileLoadHook = common_retransform::CommonClassFileLoadHookRetransformable;
+  jvmtiError res = jvmti_env->SetEventCallbacks(&cb, sizeof(cb));
+  CHECK_EQ(res, JVMTI_ERROR_NONE);
+  common_retransform::gTransformations.clear();
+}
+
+static void SetupCommonTransform() {
   // Don't set the retransform caps
   jvmtiCapabilities caps;
   jvmti_env->GetPotentialCapabilities(&caps);
@@ -373,14 +383,31 @@
   // Use the same callback as the retransform test.
   jvmtiEventCallbacks cb;
   memset(&cb, 0, sizeof(cb));
-  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
-  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
-    printf("Unable to set class file load hook cb!\n");
-    return 1;
-  }
-  return 0;
+  cb.ClassFileLoadHook = common_retransform::CommonClassFileLoadHookRetransformable;
+  jvmtiError res = jvmti_env->SetEventCallbacks(&cb, sizeof(cb));
+  CHECK_EQ(res, JVMTI_ERROR_NONE);
+  common_retransform::gTransformations.clear();
 }
 
-}  // namespace common_transform
-
+extern "C" JNIEXPORT void JNICALL Java_art_Redefinition_nativeSetTestConfiguration(JNIEnv*,
+                                                                                   jclass,
+                                                                                   jint type) {
+  switch (type) {
+    case CONFIGURATION_COMMON_REDEFINE: {
+      SetupCommonRedefine();
+      return;
+    }
+    case CONFIGURATION_COMMON_RETRANSFORM: {
+      SetupCommonRetransform();
+      return;
+    }
+    case CONFIGURATION_COMMON_TRANSFORM: {
+      SetupCommonTransform();
+      return;
+    }
+    default: {
+      LOG(FATAL) << "Unknown test configuration: " << type;
+    }
+  }
+}
 }  // namespace art
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 9e7b75d..3455409 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -60,31 +60,17 @@
 // MinimalOnLoad.
 static AgentLib agents[] = {
   { "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
-  { "902-hello-transformation", common_redefine::OnLoad, nullptr },
   { "909-attach-agent", nullptr, Test909AttachAgent::OnAttach },
-  { "914-hello-obsolescence", common_redefine::OnLoad, nullptr },
-  { "915-obsolete-2", common_redefine::OnLoad, nullptr },
   { "916-obsolete-jit", common_redefine::OnLoad, nullptr },
-  { "917-fields-transformation", common_redefine::OnLoad, nullptr },
-  { "919-obsolete-fields", common_redefine::OnLoad, nullptr },
   { "921-hello-failure", common_retransform::OnLoad, nullptr },
-  { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
-  { "930-hello-retransform", common_retransform::OnLoad, nullptr },
-  { "932-transform-saves", common_retransform::OnLoad, nullptr },
   { "934-load-transform", common_retransform::OnLoad, nullptr },
   { "935-non-retransformable", common_transform::OnLoad, nullptr },
   { "936-search-onload", Test936SearchOnload::OnLoad, nullptr },
   { "937-hello-retransform-package", common_retransform::OnLoad, nullptr },
   { "938-load-transform-bcp", common_retransform::OnLoad, nullptr },
   { "939-hello-transformation-bcp", common_redefine::OnLoad, nullptr },
-  { "940-recursive-obsolete", common_redefine::OnLoad, nullptr },
   { "941-recursive-obsolete-jit", common_redefine::OnLoad, nullptr },
-  { "942-private-recursive", common_redefine::OnLoad, nullptr },
   { "943-private-recursive-jit", common_redefine::OnLoad, nullptr },
-  { "944-transform-classloaders", common_redefine::OnLoad, nullptr },
-  { "945-obsolete-native", common_redefine::OnLoad, nullptr },
-  { "981-dedup-original-dex", common_retransform::OnLoad, nullptr },
-  { "982-ok-no-retransform", common_retransform::OnLoad, nullptr },
   { "983-source-transform-verify", Test983SourceTransformVerify::OnLoad, nullptr },
 };