Merge "Ensure Jack generates annotations for test 005-annotations"
diff --git a/Android.mk b/Android.mk
index a1479e1..cc18660 100644
--- a/Android.mk
+++ b/Android.mk
@@ -82,8 +82,6 @@
include $(art_path)/tools/dexfuzz/Android.mk
include $(art_path)/libart_fake/Android.mk
-
-# ART_HOST_DEPENDENCIES depends on Android.executable.mk above for ART_HOST_EXECUTABLES
ART_HOST_DEPENDENCIES := \
$(ART_HOST_EXECUTABLES) \
$(ART_HOST_DEX_DEPENDENCIES) \
@@ -328,8 +326,6 @@
$(hide) $(call ART_TEST_PREREQ_FINISHED,$@)
endif
-endif # art_test_bother
-
# Valgrind.
.PHONY: valgrind-test-art-target
valgrind-test-art-target: valgrind-test-art-target-gtest
@@ -343,6 +339,8 @@
valgrind-test-art-target64: valgrind-test-art-target-gtest64
$(hide) $(call ART_TEST_PREREQ_FINISHED,$@)
+endif # art_test_bother
+
########################################################################
# oat-target and oat-target-sync rules
diff --git a/build/Android.bp b/build/Android.bp
index 4be43ec..9156027 100644
--- a/build/Android.bp
+++ b/build/Android.bp
@@ -22,8 +22,6 @@
name: "art_defaults",
clang: true,
cflags: [
- "-O3",
-
// Base set of cflags used by all things ART.
"-fno-rtti",
"-ggdb3",
@@ -149,10 +147,9 @@
],
}
-cc_defaults {
+art_debug_defaults {
name: "art_debug_defaults",
cflags: [
- "-O2",
"-DDYNAMIC_ANNOTATIONS_ENABLED=1",
"-DVIXL_DEBUG",
"-UNDEBUG",
diff --git a/build/Android.common.mk b/build/Android.common.mk
index 6befec5..b0fa124 100644
--- a/build/Android.common.mk
+++ b/build/Android.common.mk
@@ -26,7 +26,6 @@
# Mac OS doesn't support low-4GB allocation in a 64-bit process. So we won't be able to create
# our heaps.
ART_HOST_SUPPORTED_ARCH := x86
- ART_MULTILIB_OVERRIDE_host := 32
endif
ART_COVERAGE := false
@@ -59,27 +58,19 @@
ifneq ($(filter %64,$(TARGET_ARCH)),)
ART_PHONY_TEST_TARGET_SUFFIX := 64
2ND_ART_PHONY_TEST_TARGET_SUFFIX := 32
- ART_TARGET_ARCH_32 := $(TARGET_2ND_ARCH)
- ART_TARGET_ARCH_64 := $(TARGET_ARCH)
else
# TODO: ???
$(warning Do not know what to do with this multi-target configuration!)
ART_PHONY_TEST_TARGET_SUFFIX := 32
2ND_ART_PHONY_TEST_TARGET_SUFFIX :=
- ART_TARGET_ARCH_32 := $(TARGET_ARCH)
- ART_TARGET_ARCH_64 :=
endif
else
ifneq ($(filter %64,$(TARGET_ARCH)),)
ART_PHONY_TEST_TARGET_SUFFIX := 64
2ND_ART_PHONY_TEST_TARGET_SUFFIX :=
- ART_TARGET_ARCH_32 :=
- ART_TARGET_ARCH_64 := $(TARGET_ARCH)
else
ART_PHONY_TEST_TARGET_SUFFIX := 32
2ND_ART_PHONY_TEST_TARGET_SUFFIX :=
- ART_TARGET_ARCH_32 := $(TARGET_ARCH)
- ART_TARGET_ARCH_64 :=
endif
endif
@@ -88,23 +79,17 @@
ifeq ($(HOST_PREFER_32_BIT),true)
ART_PHONY_TEST_HOST_SUFFIX := 32
2ND_ART_PHONY_TEST_HOST_SUFFIX :=
- ART_HOST_ARCH_32 := x86
- ART_HOST_ARCH_64 :=
ART_HOST_ARCH := x86
2ND_ART_HOST_ARCH :=
2ND_HOST_ARCH :=
- ART_HOST_LIBRARY_PATH := $(HOST_LIBRARY_PATH)
ART_HOST_OUT_SHARED_LIBRARIES := $(2ND_HOST_OUT_SHARED_LIBRARIES)
2ND_ART_HOST_OUT_SHARED_LIBRARIES :=
else
ART_PHONY_TEST_HOST_SUFFIX := 64
2ND_ART_PHONY_TEST_HOST_SUFFIX := 32
- ART_HOST_ARCH_32 := x86
- ART_HOST_ARCH_64 := x86_64
ART_HOST_ARCH := x86_64
2ND_ART_HOST_ARCH := x86
2ND_HOST_ARCH := x86
- ART_HOST_LIBRARY_PATH := $(HOST_LIBRARY_PATH)
ART_HOST_OUT_SHARED_LIBRARIES := $(HOST_OUT_SHARED_LIBRARIES)
2ND_ART_HOST_OUT_SHARED_LIBRARIES := $(2ND_HOST_OUT_SHARED_LIBRARIES)
endif
diff --git a/build/Android.common_build.mk b/build/Android.common_build.mk
index 7edc1cc..4c82506 100644
--- a/build/Android.common_build.mk
+++ b/build/Android.common_build.mk
@@ -18,7 +18,6 @@
ART_ANDROID_COMMON_BUILD_MK = true
include art/build/Android.common.mk
-include art/build/Android.common_utils.mk
# These can be overridden via the environment or by editing to
# enable/disable certain build configuration.
@@ -34,26 +33,6 @@
ART_BUILD_HOST_NDEBUG ?= true
ART_BUILD_HOST_DEBUG ?= true
-# Set this to change what opt level ART is built at.
-ART_DEBUG_OPT_FLAG ?= -O2
-ART_NDEBUG_OPT_FLAG ?= -O3
-
-# Enable the static builds only for checkbuilds.
-ifneq (,$(filter checkbuild,$(MAKECMDGOALS)))
- ART_BUILD_HOST_STATIC ?= true
-else
- ART_BUILD_HOST_STATIC ?= false
-endif
-
-# Asan does not support static linkage
-ifdef SANITIZE_HOST
- ART_BUILD_HOST_STATIC := false
-endif
-
-ifneq ($(HOST_OS),linux)
- ART_BUILD_HOST_STATIC := false
-endif
-
ifeq ($(ART_BUILD_TARGET_NDEBUG),false)
$(info Disabling ART_BUILD_TARGET_NDEBUG)
endif
@@ -66,375 +45,31 @@
ifeq ($(ART_BUILD_HOST_DEBUG),false)
$(info Disabling ART_BUILD_HOST_DEBUG)
endif
-ifeq ($(ART_BUILD_HOST_STATIC),true)
-$(info Enabling ART_BUILD_HOST_STATIC)
-endif
-
-ifeq ($(ART_TEST_DEBUG_GC),true)
- ART_DEFAULT_GC_TYPE := SS
- ART_USE_TLAB := true
-endif
-
-#
-# Used to change the default GC. Valid values are CMS, SS, GSS. The default is CMS.
-#
-ART_DEFAULT_GC_TYPE ?= CMS
-art_default_gc_type_cflags := -DART_DEFAULT_GC_TYPE_IS_$(ART_DEFAULT_GC_TYPE)
-
-ART_HOST_CLANG := true
-ART_TARGET_CLANG := true
ART_CPP_EXTENSION := .cc
-ART_C_INCLUDES := \
- external/icu/icu4c/source/common \
- external/lz4/lib \
- external/valgrind/include \
- external/valgrind \
- external/vixl/src \
- external/zlib \
-
-# We optimize Thread::Current() with a direct TLS access. This requires access to a private
-# Bionic header.
-# Note: technically we only need this on device, but this avoids the duplication of the includes.
-ART_C_INCLUDES += bionic/libc/private
-
-art_cflags :=
-
-# Warn about thread safety violations with clang.
-art_cflags += -Wthread-safety -Wthread-safety-negative
-
-# Warn if switch fallthroughs aren't annotated.
-art_cflags += -Wimplicit-fallthrough
-
-# Enable float equality warnings.
-art_cflags += -Wfloat-equal
-
-# Enable warning of converting ints to void*.
-art_cflags += -Wint-to-void-pointer-cast
-
-# Enable warning of wrong unused annotations.
-art_cflags += -Wused-but-marked-unused
-
-# Enable warning for deprecated language features.
-art_cflags += -Wdeprecated
-
-# Enable warning for unreachable break & return.
-art_cflags += -Wunreachable-code-break -Wunreachable-code-return
-
-# Bug: http://b/29823425 Disable -Wconstant-conversion and
-# -Wundefined-var-template for Clang update to r271374
-art_cflags += -Wno-constant-conversion -Wno-undefined-var-template
-
-# Enable missing-noreturn only on non-Mac. As lots of things are not implemented for Apple, it's
-# a pain.
-ifneq ($(HOST_OS),darwin)
- art_cflags += -Wmissing-noreturn
-endif
-
-# Base set of cflags used by all things ART.
-art_cflags += \
- -fno-rtti \
- -ggdb3 \
- -Wall \
- -Werror \
- -Wextra \
- -Wstrict-aliasing \
- -fstrict-aliasing \
- -Wunreachable-code \
- -Wredundant-decls \
- -Wshadow \
- -Wunused \
- -fvisibility=protected \
- $(art_default_gc_type_cflags)
-
-# The architectures the compiled tools are able to run on. Setting this to 'all' will cause all
-# architectures to be included.
-ART_TARGET_CODEGEN_ARCHS ?= svelte
-ART_HOST_CODEGEN_ARCHS ?= all
-
-ifeq ($(ART_TARGET_CODEGEN_ARCHS),all)
- ART_TARGET_CODEGEN_ARCHS := $(sort $(ART_TARGET_SUPPORTED_ARCH) $(ART_HOST_SUPPORTED_ARCH))
-else
- ifeq ($(ART_TARGET_CODEGEN_ARCHS),svelte)
- ART_TARGET_CODEGEN_ARCHS := $(sort $(ART_TARGET_ARCH_64) $(ART_TARGET_ARCH_32))
- endif
-endif
-ifeq ($(ART_HOST_CODEGEN_ARCHS),all)
- ART_HOST_CODEGEN_ARCHS := $(sort $(ART_TARGET_SUPPORTED_ARCH) $(ART_HOST_SUPPORTED_ARCH))
-else
- ifeq ($(ART_HOST_CODEGEN_ARCHS),svelte)
- ART_HOST_CODEGEN_ARCHS := $(sort $(ART_TARGET_CODEGEN_ARCHS) $(ART_HOST_ARCH_64) $(ART_HOST_ARCH_32))
- endif
-endif
-
-ifneq (,$(filter arm64,$(ART_TARGET_CODEGEN_ARCHS)))
- ART_TARGET_CODEGEN_ARCHS += arm
-endif
-ifneq (,$(filter mips64,$(ART_TARGET_CODEGEN_ARCHS)))
- ART_TARGET_CODEGEN_ARCHS += mips
-endif
-ifneq (,$(filter x86_64,$(ART_TARGET_CODEGEN_ARCHS)))
- ART_TARGET_CODEGEN_ARCHS += x86
-endif
-ART_TARGET_CODEGEN_ARCHS := $(sort $(ART_TARGET_CODEGEN_ARCHS))
-ifneq (,$(filter arm64,$(ART_HOST_CODEGEN_ARCHS)))
- ART_HOST_CODEGEN_ARCHS += arm
-endif
-ifneq (,$(filter mips64,$(ART_HOST_CODEGEN_ARCHS)))
- ART_HOST_CODEGEN_ARCHS += mips
-endif
-ifneq (,$(filter x86_64,$(ART_HOST_CODEGEN_ARCHS)))
- ART_HOST_CODEGEN_ARCHS += x86
-endif
-ART_HOST_CODEGEN_ARCHS := $(sort $(ART_HOST_CODEGEN_ARCHS))
-
-# Base set of cflags used by target build only
-art_target_cflags := \
- $(foreach target_arch,$(strip $(ART_TARGET_CODEGEN_ARCHS)), -DART_ENABLE_CODEGEN_$(target_arch))
-# Base set of cflags used by host build only
-art_host_cflags := \
- $(foreach host_arch,$(strip $(ART_HOST_CODEGEN_ARCHS)), -DART_ENABLE_CODEGEN_$(host_arch))
-
-# Base set of asflags used by all things ART.
-art_asflags :=
-
-# Missing declarations: too many at the moment, as we use "extern" quite a bit.
-# -Wmissing-declarations \
-
-
-
-ifdef ART_IMT_SIZE
- art_cflags += -DIMT_SIZE=$(ART_IMT_SIZE)
-else
- # Default is 43
- art_cflags += -DIMT_SIZE=43
-endif
-
-ifeq ($(ART_HEAP_POISONING),true)
- art_cflags += -DART_HEAP_POISONING=1
- art_asflags += -DART_HEAP_POISONING=1
-endif
-
-#
-# Used to change the read barrier type. Valid values are BAKER, BROOKS, TABLELOOKUP.
-# The default is BAKER.
-#
-ART_READ_BARRIER_TYPE ?= BAKER
-
-ifeq ($(ART_USE_READ_BARRIER),true)
- art_cflags += -DART_USE_READ_BARRIER=1
- art_cflags += -DART_READ_BARRIER_TYPE_IS_$(ART_READ_BARRIER_TYPE)=1
- art_asflags += -DART_USE_READ_BARRIER=1
- art_asflags += -DART_READ_BARRIER_TYPE_IS_$(ART_READ_BARRIER_TYPE)=1
-
- # Temporarily override -fstack-protector-strong with -fstack-protector to avoid a major
- # slowdown with the read barrier config. b/26744236.
- art_cflags += -fstack-protector
-endif
-
-ifeq ($(ART_USE_TLAB),true)
- art_cflags += -DART_USE_TLAB=1
-endif
-
-# Are additional statically-linked ART host binaries (dex2oats,
-# oatdumps, etc.) getting built?
-ifeq ($(ART_BUILD_HOST_STATIC),true)
- art_cflags += -DART_BUILD_HOST_STATIC=1
-endif
-
-# Temporary flag allowing to disable recent changes in oat file management.
-ifneq ($(ART_ENABLE_VDEX),false)
- art_cflags += -DART_ENABLE_VDEX
-endif
-
-# Cflags for non-debug ART and ART tools.
-art_non_debug_cflags := \
- $(ART_NDEBUG_OPT_FLAG)
-
-# Cflags for debug ART and ART tools.
-art_debug_cflags := \
- $(ART_DEBUG_OPT_FLAG) \
- -DDYNAMIC_ANNOTATIONS_ENABLED=1 \
- -DVIXL_DEBUG \
- -UNDEBUG
-
-# Assembler flags for non-debug ART and ART tools.
-art_non_debug_asflags :=
-
-# Assembler flags for debug ART and ART tools.
-art_debug_asflags := -UNDEBUG
-
-art_host_non_debug_cflags := $(art_non_debug_cflags)
-art_target_non_debug_cflags := $(art_non_debug_cflags)
-
-###
-# Frame size
-###
-
-# Size of the stack-overflow gap.
-ART_STACK_OVERFLOW_GAP_arm := 8192
-ART_STACK_OVERFLOW_GAP_arm64 := 8192
-ART_STACK_OVERFLOW_GAP_mips := 16384
-ART_STACK_OVERFLOW_GAP_mips64 := 16384
-ART_STACK_OVERFLOW_GAP_x86 := 8192
-ART_STACK_OVERFLOW_GAP_x86_64 := 8192
-ART_COMMON_STACK_OVERFLOW_DEFINES := \
- -DART_STACK_OVERFLOW_GAP_arm=$(ART_STACK_OVERFLOW_GAP_arm) \
- -DART_STACK_OVERFLOW_GAP_arm64=$(ART_STACK_OVERFLOW_GAP_arm64) \
- -DART_STACK_OVERFLOW_GAP_mips=$(ART_STACK_OVERFLOW_GAP_mips) \
- -DART_STACK_OVERFLOW_GAP_mips64=$(ART_STACK_OVERFLOW_GAP_mips64) \
- -DART_STACK_OVERFLOW_GAP_x86=$(ART_STACK_OVERFLOW_GAP_x86) \
- -DART_STACK_OVERFLOW_GAP_x86_64=$(ART_STACK_OVERFLOW_GAP_x86_64) \
-
-# Keep these as small as possible. We have separate values as we have some host vs target
-# specific code (and previously GCC vs Clang).
-ART_HOST_FRAME_SIZE_LIMIT := 1736
-ART_TARGET_FRAME_SIZE_LIMIT := 1736
-
-# Frame size adaptations for instrumented builds.
-ifdef SANITIZE_TARGET
- ART_TARGET_FRAME_SIZE_LIMIT := 6400
-endif
-
-# Add frame-size checks for non-debug builds.
-ifeq ($(HOST_OS),linux)
- ifneq ($(ART_COVERAGE),true)
- ifneq ($(NATIVE_COVERAGE),true)
- art_host_non_debug_cflags += -Wframe-larger-than=$(ART_HOST_FRAME_SIZE_LIMIT)
- art_target_non_debug_cflags += -Wframe-larger-than=$(ART_TARGET_FRAME_SIZE_LIMIT)
- endif
- endif
-endif
-
-
-ART_HOST_CFLAGS := $(art_cflags)
-ART_TARGET_CFLAGS := $(art_cflags)
-
-ART_HOST_ASFLAGS := $(art_asflags)
-ART_TARGET_ASFLAGS := $(art_asflags)
-
-# Bug: 15446488. We don't omit the frame pointer to work around
-# clang/libunwind bugs that cause SEGVs in run-test-004-ThreadStress.
-ART_HOST_CFLAGS += -fno-omit-frame-pointer
-
ifndef LIBART_IMG_HOST_BASE_ADDRESS
$(error LIBART_IMG_HOST_BASE_ADDRESS unset)
endif
-ART_HOST_CFLAGS += -DART_BASE_ADDRESS=$(LIBART_IMG_HOST_BASE_ADDRESS)
-ART_HOST_CFLAGS += $(art_host_cflags)
-
-ART_HOST_CFLAGS += -DART_FRAME_SIZE_LIMIT=$(ART_HOST_FRAME_SIZE_LIMIT) \
- $(ART_COMMON_STACK_OVERFLOW_DEFINES)
-
ifndef LIBART_IMG_TARGET_BASE_ADDRESS
$(error LIBART_IMG_TARGET_BASE_ADDRESS unset)
endif
-ART_TARGET_CFLAGS += -DART_TARGET \
- -DART_BASE_ADDRESS=$(LIBART_IMG_TARGET_BASE_ADDRESS) \
-
-ART_TARGET_CFLAGS += -DART_FRAME_SIZE_LIMIT=$(ART_TARGET_FRAME_SIZE_LIMIT) \
- $(ART_COMMON_STACK_OVERFLOW_DEFINES)
-
-ifeq ($(ART_TARGET_LINUX),true)
-# Setting ART_TARGET_LINUX to true compiles art/ assuming that the target device
-# will be running linux rather than android.
-ART_TARGET_CFLAGS += -DART_TARGET_LINUX
-else
-# The ART_TARGET_ANDROID macro is passed to target builds, which check
-# against it instead of against __ANDROID__ (which is provided by target
-# toolchains).
-ART_TARGET_CFLAGS += -DART_TARGET_ANDROID
-endif
-
-ART_TARGET_CFLAGS += $(art_target_cflags)
-
-ART_HOST_NON_DEBUG_CFLAGS := $(art_host_non_debug_cflags)
-ART_TARGET_NON_DEBUG_CFLAGS := $(art_target_non_debug_cflags)
-ART_HOST_DEBUG_CFLAGS := $(art_debug_cflags)
-ART_TARGET_DEBUG_CFLAGS := $(art_debug_cflags)
-
-ART_HOST_NON_DEBUG_ASFLAGS := $(art_non_debug_asflags)
-ART_TARGET_NON_DEBUG_ASFLAGS := $(art_non_debug_asflags)
-ART_HOST_DEBUG_ASFLAGS := $(art_debug_asflags)
-ART_TARGET_DEBUG_ASFLAGS := $(art_debug_asflags)
-
-ifndef LIBART_IMG_HOST_MIN_BASE_ADDRESS_DELTA
- LIBART_IMG_HOST_MIN_BASE_ADDRESS_DELTA=-0x1000000
-endif
-ifndef LIBART_IMG_HOST_MAX_BASE_ADDRESS_DELTA
- LIBART_IMG_HOST_MAX_BASE_ADDRESS_DELTA=0x1000000
-endif
-ART_HOST_CFLAGS += -DART_BASE_ADDRESS_MIN_DELTA=$(LIBART_IMG_HOST_MIN_BASE_ADDRESS_DELTA)
-ART_HOST_CFLAGS += -DART_BASE_ADDRESS_MAX_DELTA=$(LIBART_IMG_HOST_MAX_BASE_ADDRESS_DELTA)
-
-ifndef LIBART_IMG_TARGET_MIN_BASE_ADDRESS_DELTA
- LIBART_IMG_TARGET_MIN_BASE_ADDRESS_DELTA=-0x1000000
-endif
-ifndef LIBART_IMG_TARGET_MAX_BASE_ADDRESS_DELTA
- LIBART_IMG_TARGET_MAX_BASE_ADDRESS_DELTA=0x1000000
-endif
-ART_TARGET_CFLAGS += -DART_BASE_ADDRESS_MIN_DELTA=$(LIBART_IMG_TARGET_MIN_BASE_ADDRESS_DELTA)
-ART_TARGET_CFLAGS += -DART_BASE_ADDRESS_MAX_DELTA=$(LIBART_IMG_TARGET_MAX_BASE_ADDRESS_DELTA)
-
-# To use oprofile_android --callgraph, uncomment this and recompile with "mmm art -B -j16"
-# ART_TARGET_CFLAGS += -fno-omit-frame-pointer -marm -mapcs
-
-# Clear locals now they've served their purpose.
-art_cflags :=
-art_asflags :=
-art_host_cflags :=
-art_target_cflags :=
-art_debug_cflags :=
-art_non_debug_cflags :=
-art_debug_asflags :=
-art_non_debug_asflags :=
-art_host_non_debug_cflags :=
-art_target_non_debug_cflags :=
-art_default_gc_type_cflags :=
-
-ART_TARGET_LDFLAGS :=
-
-# $(1): ndebug_or_debug
-define set-target-local-cflags-vars
- LOCAL_CFLAGS += $(ART_TARGET_CFLAGS)
- LOCAL_ASFLAGS += $(ART_TARGET_ASFLAGS)
- LOCAL_LDFLAGS += $(ART_TARGET_LDFLAGS)
- art_target_cflags_ndebug_or_debug := $(1)
- ifeq ($$(art_target_cflags_ndebug_or_debug),debug)
- LOCAL_CFLAGS += $(ART_TARGET_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_TARGET_DEBUG_ASFLAGS)
- else
- LOCAL_CFLAGS += $(ART_TARGET_NON_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_TARGET_NON_DEBUG_ASFLAGS)
- endif
-
- # Clear locally used variables.
- art_target_cflags_ndebug_or_debug :=
-endef
-
# Support for disabling certain builds.
ART_BUILD_TARGET := false
ART_BUILD_HOST := false
-ART_BUILD_NDEBUG := false
-ART_BUILD_DEBUG := false
ifeq ($(ART_BUILD_TARGET_NDEBUG),true)
ART_BUILD_TARGET := true
- ART_BUILD_NDEBUG := true
endif
ifeq ($(ART_BUILD_TARGET_DEBUG),true)
ART_BUILD_TARGET := true
- ART_BUILD_DEBUG := true
endif
ifeq ($(ART_BUILD_HOST_NDEBUG),true)
ART_BUILD_HOST := true
- ART_BUILD_NDEBUG := true
endif
ifeq ($(ART_BUILD_HOST_DEBUG),true)
ART_BUILD_HOST := true
- ART_BUILD_DEBUG := true
endif
endif # ART_ANDROID_COMMON_BUILD_MK
diff --git a/build/Android.common_path.mk b/build/Android.common_path.mk
index 00d29b9..e568ce2 100644
--- a/build/Android.common_path.mk
+++ b/build/Android.common_path.mk
@@ -35,13 +35,6 @@
ART_TARGET_TEST_DIR := /data/art-test
ART_TARGET_TEST_OUT := $(TARGET_OUT_DATA)/art-test
-# Directory used for temporary test files on the host.
-ifneq ($(TMPDIR),)
-ART_HOST_TEST_DIR := $(TMPDIR)/test-art-$(shell echo $$PPID)
-else
-ART_HOST_TEST_DIR := /tmp/$(USER)/test-art-$(shell echo $$PPID)
-endif
-
# core.oat location on the device.
TARGET_CORE_OAT := $(ART_TARGET_TEST_DIR)/$(DEX2OAT_TARGET_ARCH)/core.oat
ifdef TARGET_2ND_ARCH
diff --git a/build/Android.common_test.mk b/build/Android.common_test.mk
index 6b7dc09..449502c 100644
--- a/build/Android.common_test.mk
+++ b/build/Android.common_test.mk
@@ -19,9 +19,12 @@
include art/build/Android.common_path.mk
-# We need to set a define for the nativetest dir so that common_runtime_test will know the right
-# path. (The problem is being a 32b test on 64b device, which is still located in nativetest64).
-ART_TARGET_CFLAGS += -DART_TARGET_NATIVETEST_DIR=${ART_TARGET_NATIVETEST_DIR}
+# Directory used for temporary test files on the host.
+ifneq ($(TMPDIR),)
+ART_HOST_TEST_DIR := $(TMPDIR)/test-art-$(shell echo $$PPID)
+else
+ART_HOST_TEST_DIR := /tmp/$(USER)/test-art-$(shell echo $$PPID)
+endif
# List of known broken tests that we won't attempt to execute. The test name must be the full
# rule name such as test-art-host-oat-optimizing-HelloWorld64.
diff --git a/build/Android.common_utils.mk b/build/Android.common_utils.mk
deleted file mode 100644
index 8069c3a..0000000
--- a/build/Android.common_utils.mk
+++ /dev/null
@@ -1,26 +0,0 @@
-#
-# Copyright (C) 2014 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-ifndef ART_ANDROID_COMMON_UTILS_MK
-ART_ANDROID_COMMON_UTILS_MK = true
-
-#
-# Convert a string into an uppercase string.
-#
-# $(1): a string which should be made uppercase
-art-string-to-uppercase = $(shell echo $(1) | tr '[:lower:]' '[:upper:]')
-
-endif # ART_ANDROID_COMMON_UTILS_MK
diff --git a/build/Android.executable.mk b/build/Android.executable.mk
deleted file mode 100644
index f38a14d..0000000
--- a/build/Android.executable.mk
+++ /dev/null
@@ -1,251 +0,0 @@
-#
-# Copyright (C) 2011 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-include art/build/Android.common_build.mk
-
-ART_EXECUTABLES_CFLAGS :=
-
-# $(1): executable ("d" will be appended for debug version, "s" will be appended for static version)
-# $(2): source
-# $(3): extra shared libraries
-# $(4): extra include directories
-# $(5): target or host
-# $(6): ndebug or debug
-# $(7): value for LOCAL_MULTILIB (empty means default)
-# $(8): static or shared (empty means shared, applies only for host)
-define build-art-executable
- ifneq ($(5),target)
- ifneq ($(5),host)
- $$(error expected target or host for argument 5, received $(5))
- endif
- endif
- ifneq ($(6),ndebug)
- ifneq ($(6),debug)
- $$(error expected ndebug or debug for argument 6, received $(6))
- endif
- endif
-
- art_executable := $(1)
- art_source := $(2)
- art_libraries := $(3)
- art_c_includes := $(4)
- art_target_or_host := $(5)
- art_ndebug_or_debug := $(6)
- art_multilib := $(7)
- art_static_or_shared := $(8)
- art_out_binary_name :=
-
- include $(CLEAR_VARS)
- LOCAL_CPP_EXTENSION := $(ART_CPP_EXTENSION)
- LOCAL_MODULE_TAGS := optional
- LOCAL_SRC_FILES := $$(art_source)
- LOCAL_C_INCLUDES += $(ART_C_INCLUDES) art/runtime art/cmdline $$(art_c_includes)
-
- ifeq ($$(art_static_or_shared),static)
- LOCAL_STATIC_LIBRARIES += $$(art_libraries)
- else
- LOCAL_SHARED_LIBRARIES += $$(art_libraries)
- endif
-
- ifeq ($$(art_ndebug_or_debug),ndebug)
- LOCAL_MODULE := $$(art_executable)
- else #debug
- LOCAL_MODULE := $$(art_executable)d
- endif
-
- ifeq ($$(art_static_or_shared),static)
- LOCAL_MODULE := $$(LOCAL_MODULE)s
- endif
-
- LOCAL_CFLAGS := $(ART_EXECUTABLES_CFLAGS)
- # Mac OS linker doesn't understand --export-dynamic.
- ifneq ($$(HOST_OS)-$$(art_target_or_host),darwin-host)
- LOCAL_LDFLAGS := -Wl,--export-dynamic
- endif
-
- ifeq ($$(art_target_or_host),target)
- LOCAL_CLANG := $(ART_TARGET_CLANG)
- $(call set-target-local-cflags-vars,$(6))
- LOCAL_SHARED_LIBRARIES += libdl
- else # host
- LOCAL_CLANG := $(ART_HOST_CLANG)
- LOCAL_CFLAGS += $(ART_HOST_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_ASFLAGS)
- ifeq ($$(art_ndebug_or_debug),debug)
- LOCAL_CFLAGS += $(ART_HOST_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_DEBUG_ASFLAGS)
- else
- LOCAL_CFLAGS += $(ART_HOST_NON_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_NON_DEBUG_ASFLAGS)
- endif
- LOCAL_LDLIBS += -lpthread -ldl
- ifeq ($$(art_static_or_shared),static)
- LOCAL_LDFLAGS += -static
- # We need this because GC stress mode makes use of _Unwind_GetIP and _Unwind_Backtrace and
- # the symbols are also defined in libgcc_eh.a(unwind-dw2.o)
- # TODO: Having this is not ideal as it might obscure errors. Try to get rid of it.
- LOCAL_LDFLAGS += -z muldefs
- ifeq ($$(HOST_OS),linux)
- LOCAL_LDLIBS += -lrt -lncurses -ltinfo
- endif
- ifeq ($$(HOST_OS),darwin)
- LOCAL_LDLIBS += -lncurses -ltinfo
- endif
- endif
-
- endif
-
- # If dynamically linked add libart by default. Statically linked executables
- # needs to specify it in art_libraries to ensure proper ordering.
- ifeq ($$(art_ndebug_or_debug),ndebug)
- ifneq ($$(art_static_or_shared),static)
- LOCAL_SHARED_LIBRARIES += libart
- endif
- else # debug
- ifneq ($$(art_static_or_shared),static)
- LOCAL_SHARED_LIBRARIES += libartd
- endif
- endif
-
- LOCAL_ADDITIONAL_DEPENDENCIES := art/build/Android.common_build.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += art/build/Android.common_utils.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += art/build/Android.executable.mk
-
- ifeq ($$(art_target_or_host),target)
- LOCAL_MODULE_TARGET_ARCH := $(ART_SUPPORTED_ARCH)
- endif
-
- ifdef ART_MULTILIB_OVERRIDE_$$(art_target_or_host)
- art_multilib := $$(ART_MULTILIB_OVERRIDE_$$(art_target_or_host))
- endif
-
- LOCAL_MULTILIB := $$(art_multilib)
- art_out_binary_name := $$(LOCAL_MODULE)
-
- # If multilib=both (potentially building both 32-bit and 64-bit), need to provide stem.
- ifeq ($$(art_multilib),both)
- # Set up a 32-bit/64-bit stem if we are building both binaries.
- # In this case, the 32-bit binary has an additional 32-bit suffix.
- LOCAL_MODULE_STEM_32 := $$(LOCAL_MODULE)32
- LOCAL_MODULE_STEM_64 := $$(LOCAL_MODULE)
-
- # Remember the binary names so we can add them to the global art executables list later.
- art_out_binary_name := $$(LOCAL_MODULE_STEM_32) $$(LOCAL_MODULE_STEM_64)
-
- # For single-architecture targets, remove any binary name suffixes.
- ifeq ($$(art_target_or_host),target)
- ifeq (,$(TARGET_2ND_ARCH))
- LOCAL_MODULE_STEM_32 := $$(LOCAL_MODULE)
- art_out_binary_name := $$(LOCAL_MODULE)
- endif
- endif
-
- # For single-architecture hosts, remove any binary name suffixes.
- ifeq ($$(art_target_or_host),host)
- ifeq (,$(HOST_2ND_ARCH))
- LOCAL_MODULE_STEM_32 := $$(LOCAL_MODULE)
- art_out_binary_name := $$(LOCAL_MODULE)
- endif
- endif
- endif
-
- LOCAL_NATIVE_COVERAGE := $(ART_COVERAGE)
-
- ifeq ($$(art_target_or_host),target)
- include $(BUILD_EXECUTABLE)
- else # host
- LOCAL_IS_HOST_MODULE := true
- include $(BUILD_HOST_EXECUTABLE)
- endif
-
- # Clear out local variables now that we're done with them.
- art_executable :=
- art_source :=
- art_libraries :=
- art_c_includes :=
- art_target_or_host :=
- art_ndebug_or_debug :=
- art_multilib :=
- art_static_or_shared :=
- art_out_binary_name :=
-
-endef
-
-#
-# Build many art executables from multiple variations (debug/ndebug, host/target, 32/64bit).
-# By default only either 32-bit or 64-bit is built (but not both -- see multilib arg).
-# All other variations are gated by ANDROID_BUILD_(TARGET|HOST)_[N]DEBUG.
-# The result must be eval-uated.
-#
-# $(1): executable name
-# $(2): source files
-# $(3): library dependencies (common); debug prefix is added on as necessary automatically.
-# $(4): library dependencies (target only)
-# $(5): library dependencies (host only)
-# $(6): extra include directories
-# $(7): multilib (default: empty), valid values: {,32,64,both})
-# $(8): host prefer 32-bit: {true, false} (default: false). If argument
-# `multilib` is explicitly set to 64, ignore the "host prefer 32-bit"
-# setting and only build a 64-bit executable on host.
-define build-art-multi-executable
- $(foreach debug_flavor,ndebug debug,
- $(foreach target_flavor,host target,
- art-multi-binary-name := $(1)
- art-multi-source-files := $(2)
- art-multi-lib-dependencies := $(3)
- art-multi-lib-dependencies-target := $(4)
- art-multi-lib-dependencies-host := $(5)
- art-multi-include-extra := $(6)
- art-multi-multilib := $(7)
- art-multi-host-prefer-32-bit := $(8)
-
- # Add either -host or -target specific lib dependencies to the lib dependencies.
- art-multi-lib-dependencies += $$(art-multi-lib-dependencies-$(target_flavor))
-
- # Replace libart- prefix with libartd- for debug flavor.
- ifeq ($(debug_flavor),debug)
- art-multi-lib-dependencies := $$(subst libart-,libartd-,$$(art-multi-lib-dependencies))
- endif
-
- # Build the env guard var name, e.g. ART_BUILD_HOST_NDEBUG.
- art-multi-env-guard := $$(call art-string-to-uppercase,ART_BUILD_$(target_flavor)_$(debug_flavor))
-
- ifeq ($(target_flavor),host)
- ifeq ($$(art-multi-host-prefer-32-bit),true)
- ifneq ($$(art-multi-multilib),64)
- art-multi-multilib := 32
- endif
- endif
- endif
-
- # Build the art executable only if the corresponding env guard was set.
- ifeq ($$($$(art-multi-env-guard)),true)
- $$(eval $$(call build-art-executable,$$(art-multi-binary-name),$$(art-multi-source-files),$$(art-multi-lib-dependencies),$$(art-multi-include-extra),$(target_flavor),$(debug_flavor),$$(art-multi-multilib)))
- endif
-
- # Clear locals now they've served their purpose.
- art-multi-binary-name :=
- art-multi-source-files :=
- art-multi-lib-dependencies :=
- art-multi-lib-dependencies-target :=
- art-multi-lib-dependencies-host :=
- art-multi-include-extra :=
- art-multi-multilib :=
- art-multi-host-prefer-32-bit :=
- art-multi-env-guard :=
- )
- )
-endef
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index db18661..07ff611 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -67,10 +67,14 @@
ART_TEST_GTEST_VerifierDeps_SRC := $(abspath $(wildcard $(LOCAL_PATH)/VerifierDeps/*.smali))
ART_TEST_HOST_GTEST_VerifierDeps_DEX := $(dir $(ART_TEST_HOST_GTEST_Main_DEX))$(subst Main,VerifierDeps,$(basename $(notdir $(ART_TEST_HOST_GTEST_Main_DEX))))$(suffix $(ART_TEST_HOST_GTEST_Main_DEX))
+ART_TEST_TARGET_GTEST_VerifierDeps_DEX := $(dir $(ART_TEST_TARGET_GTEST_Main_DEX))$(subst Main,VerifierDeps,$(basename $(notdir $(ART_TEST_TARGET_GTEST_Main_DEX))))$(suffix $(ART_TEST_TARGET_GTEST_Main_DEX))
$(ART_TEST_HOST_GTEST_VerifierDeps_DEX): $(ART_TEST_GTEST_VerifierDeps_SRC) $(HOST_OUT_EXECUTABLES)/smali
$(HOST_OUT_EXECUTABLES)/smali --output=$@ $(filter %.smali,$^)
+$(ART_TEST_TARGET_GTEST_VerifierDeps_DEX): $(ART_TEST_GTEST_VerifierDeps_SRC) $(HOST_OUT_EXECUTABLES)/smali
+ $(HOST_OUT_EXECUTABLES)/smali --output=$@ $(filter %.smali,$^)
+
# Dex file dependencies for each gtest.
ART_GTEST_dex2oat_environment_tests_DEX_DEPS := Main MainStripped MultiDex MultiDexModifiedSecondary Nested
@@ -173,7 +177,8 @@
ART_GTEST_oatdump_test_HOST_DEPS := \
$(HOST_CORE_IMAGE_optimizing_no-pic_64) \
$(HOST_CORE_IMAGE_optimizing_no-pic_32) \
- $(HOST_OUT_EXECUTABLES)/oatdumpd
+ $(HOST_OUT_EXECUTABLES)/oatdumpd \
+ $(HOST_OUT_EXECUTABLES)/oatdumpds
ART_GTEST_oatdump_test_TARGET_DEPS := \
$(TARGET_CORE_IMAGE_optimizing_no-pic_64) \
$(TARGET_CORE_IMAGE_optimizing_no-pic_32) \
@@ -205,10 +210,18 @@
ART_TARGET_GTEST_FILES := $(foreach m,$(ART_TEST_MODULES),\
$(ART_TEST_LIST_device_$(TARGET_ARCH)_$(m)))
+ifdef TARGET_2ND_ARCH
+2ND_ART_TARGET_GTEST_FILES := $(foreach m,$(ART_TEST_MODULES),\
+ $(ART_TEST_LIST_device_$(2ND_TARGET_ARCH)_$(m)))
+endif
+
ART_HOST_GTEST_FILES := $(foreach m,$(ART_TEST_MODULES),\
$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_$(m)))
-ART_TEST_CFLAGS :=
+ifneq ($(HOST_PREFER_32_BIT),true)
+2ND_ART_HOST_GTEST_FILES += $(foreach m,$(ART_TEST_MODULES),\
+ $(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_$(m)))
+endif
# Variables holding collections of gtest pre-requisits used to run a number of gtests.
ART_TEST_HOST_GTEST$(ART_PHONY_TEST_HOST_SUFFIX)_RULES :=
@@ -378,43 +391,64 @@
endef # define-art-gtest-rule-host
# Define the rules to build and run host and target gtests.
-# $(1): target or host
-# $(2): file name
-define define-art-gtest
- ifneq ($(1),target)
- ifneq ($(1),host)
- $$(error expected target or host for argument 1, received $(1))
- endif
- endif
-
- art_target_or_host := $(1)
- art_gtest_filename := $(2)
+# $(1): file name
+# $(2): 2ND_ or undefined - used to differentiate between the primary and secondary architecture.
+define define-art-gtest-target
+ art_gtest_filename := $(1)
include $$(CLEAR_VARS)
art_gtest_name := $$(notdir $$(basename $$(art_gtest_filename)))
- ifeq ($$(art_target_or_host),target)
- library_path :=
- 2nd_library_path :=
- ifneq ($$(ART_TEST_ANDROID_ROOT),)
- ifdef TARGET_2ND_ARCH
- 2nd_library_path := $$(ART_TEST_ANDROID_ROOT)/lib
+ library_path :=
+ 2ND_library_path :=
+ ifneq ($$(ART_TEST_ANDROID_ROOT),)
+ ifdef TARGET_2ND_ARCH
+ 2ND_library_path := $$(ART_TEST_ANDROID_ROOT)/lib
+ library_path := $$(ART_TEST_ANDROID_ROOT)/lib64
+ else
+ ifneq ($(filter %64,$(TARGET_ARCH)),)
library_path := $$(ART_TEST_ANDROID_ROOT)/lib64
else
- ifneq ($(filter %64,$(TARGET_ARCH)),)
- library_path := $$(ART_TEST_ANDROID_ROOT)/lib64
- else
- library_path := $$(ART_TEST_ANDROID_ROOT)/lib
- endif
+ library_path := $$(ART_TEST_ANDROID_ROOT)/lib
endif
endif
+ endif
+ ifndef ART_TEST_TARGET_GTEST_$$(art_gtest_name)_RULES
ART_TEST_TARGET_GTEST_$$(art_gtest_name)_RULES :=
ART_TEST_TARGET_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
- ifdef TARGET_2ND_ARCH
- $$(eval $$(call define-art-gtest-rule-target,$$(art_gtest_name),$$(art_gtest_filename),2ND_,$$(2nd_library_path)))
- endif
- $$(eval $$(call define-art-gtest-rule-target,$$(art_gtest_name),$$(art_gtest_filename),,$$(library_path)))
+ endif
+ $$(eval $$(call define-art-gtest-rule-target,$$(art_gtest_name),$$(art_gtest_filename),$(2),$$($(2)library_path)))
+
+ # Clear locally defined variables.
+ art_gtest_filename :=
+ art_gtest_name :=
+ library_path :=
+ 2ND_library_path :=
+endef # define-art-gtest-target
+
+# $(1): file name
+# $(2): 2ND_ or undefined - used to differentiate between the primary and secondary architecture.
+define define-art-gtest-host
+ art_gtest_filename := $(1)
+
+ include $$(CLEAR_VARS)
+ art_gtest_name := $$(notdir $$(basename $$(art_gtest_filename)))
+ ifndef ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES
+ ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES :=
+ ART_TEST_HOST_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
+ endif
+ $$(eval $$(call define-art-gtest-rule-host,$$(art_gtest_name),$$(art_gtest_filename),$(2)))
+
+ # Clear locally defined variables.
+ art_gtest_filename :=
+ art_gtest_name :=
+endef # define-art-gtest-host
+
+# Define the rules to build and run gtests for both archs on target.
+# $(1): test name
+define define-art-gtest-target-both
+ art_gtest_name := $(1)
# A rule to run the different architecture versions of the gtest.
.PHONY: test-art-target-gtest-$$(art_gtest_name)
@@ -425,18 +459,17 @@
valgrind-test-art-target-gtest-$$(art_gtest_name): $$(ART_TEST_TARGET_VALGRIND_GTEST_$$(art_gtest_name)_RULES)
$$(hide) $$(call ART_TEST_PREREQ_FINISHED,$$@)
- # Clear locally defined variables.
- ART_TEST_TARGET_GTEST_$$(art_gtest_name)_RULES :=
- ART_TEST_TARGET_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
- else # host
- ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES :=
- ART_TEST_HOST_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
- ifneq ($$(HOST_PREFER_32_BIT),true)
- $$(eval $$(call define-art-gtest-rule-host,$$(art_gtest_name),$$(art_gtest_filename),2ND_))
- endif
- $$(eval $$(call define-art-gtest-rule-host,$$(art_gtest_name),$$(art_gtest_filename),))
+ # Clear now unused variables.
+ ART_TEST_TARGET_GTEST_$$(art_gtest_name)_RULES :=
+ ART_TEST_TARGET_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
+ art_gtest_name :=
+endef # define-art-gtest-target-both
- # Rules to run the different architecture versions of the gtest.
+# Define the rules to build and run gtests for both archs on host.
+# $(1): test name
+define define-art-gtest-host-both
+ art_gtest_name := $(1)
+
.PHONY: test-art-host-gtest-$$(art_gtest_name)
test-art-host-gtest-$$(art_gtest_name): $$(ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES)
$$(hide) $$(call ART_TEST_PREREQ_FINISHED,$$@)
@@ -445,25 +478,27 @@
valgrind-test-art-host-gtest-$$(art_gtest_name): $$(ART_TEST_HOST_VALGRIND_GTEST_$$(art_gtest_name)_RULES)
$$(hide) $$(call ART_TEST_PREREQ_FINISHED,$$@)
- # Clear locally defined variables.
- ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES :=
- ART_TEST_HOST_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
- endif # host_or_target
-
- # Clear locally defined variables.
- art_target_or_host :=
- art_gtest_filename :=
+ # Clear now unused variables.
+ ART_TEST_HOST_GTEST_$$(art_gtest_name)_RULES :=
+ ART_TEST_HOST_VALGRIND_GTEST_$$(art_gtest_name)_RULES :=
art_gtest_name :=
- library_path :=
- 2nd_library_path :=
-endef # define-art-gtest
-
+endef # define-art-gtest-host-both
ifeq ($(ART_BUILD_TARGET),true)
- $(foreach file,$(ART_TARGET_GTEST_FILES), $(eval $(call define-art-gtest,target,$(file))))
+ $(foreach file,$(ART_TARGET_GTEST_FILES), $(eval $(call define-art-gtest-target,$(file),)))
+ ifdef TARGET_2ND_ARCH
+ $(foreach file,$(2ND_ART_TARGET_GTEST_FILES), $(eval $(call define-art-gtest-target,$(file),2ND_)))
+ endif
+ # Rules to run the different architecture versions of the gtest.
+ $(foreach file,$(ART_TARGET_GTEST_FILES), $(eval $(call define-art-gtest-target-both,$$(notdir $$(basename $$(file))))))
endif
ifeq ($(ART_BUILD_HOST),true)
- $(foreach file,$(ART_HOST_GTEST_FILES), $(eval $(call define-art-gtest,host,$(file))))
+ $(foreach file,$(ART_HOST_GTEST_FILES), $(eval $(call define-art-gtest-host,$(file),)))
+ ifneq ($(HOST_PREFER_32_BIT),true)
+ $(foreach file,$(2ND_ART_HOST_GTEST_FILES), $(eval $(call define-art-gtest-host,$(file),2ND_)))
+ endif
+ # Rules to run the different architecture versions of the gtest.
+ $(foreach file,$(ART_HOST_GTEST_FILES), $(eval $(call define-art-gtest-host-both,$$(notdir $$(basename $$(file))))))
endif
# Used outside the art project to get a list of the current tests
@@ -535,7 +570,6 @@
RUNTIME_GTEST_HOST_SRC_FILES :=
COMPILER_GTEST_TARGET_SRC_FILES :=
COMPILER_GTEST_HOST_SRC_FILES :=
-ART_TEST_CFLAGS :=
ART_TEST_HOST_GTEST$(ART_PHONY_TEST_HOST_SUFFIX)_RULES :=
ART_TEST_HOST_GTEST$(2ND_ART_PHONY_TEST_HOST_SUFFIX)_RULES :=
ART_TEST_HOST_GTEST_RULES :=
@@ -578,5 +612,6 @@
ART_TEST_TARGET_GTEST_MainStripped_DEX :=
ART_TEST_GTEST_VerifierDeps_SRC :=
ART_TEST_HOST_GTEST_VerifierDeps_DEX :=
+ART_TEST_TARGET_GTEST_VerifierDeps_DEX :=
GTEST_DEX_DIRECTORIES :=
LOCAL_PATH :=
diff --git a/build/art.go b/build/art.go
index f2efbfe..0ae6c8f 100644
--- a/build/art.go
+++ b/build/art.go
@@ -30,6 +30,9 @@
var cflags []string
var asflags []string
+ opt := envDefault(ctx, "ART_NDEBUG_OPT_FLAG", "-O3")
+ cflags = append(cflags, opt)
+
tlab := false
gcType := envDefault(ctx, "ART_DEFAULT_GC_TYPE", "CMS")
@@ -72,15 +75,18 @@
cflags = append(cflags, "-fstack-protector")
}
- // Are additional statically-linked ART host binaries
- // (dex2oats, oatdumps, etc.) getting built?
- if envTrue(ctx, "ART_BUILD_HOST_STATIC") {
- cflags = append(cflags, "-DART_BUILD_HOST_STATIC=1")
- }
-
return cflags, asflags
}
+func debugFlags(ctx android.BaseContext) []string {
+ var cflags []string
+
+ opt := envDefault(ctx, "ART_DEBUG_OPT_FLAG", "-O2")
+ cflags = append(cflags, opt)
+
+ return cflags
+}
+
func deviceFlags(ctx android.BaseContext) []string {
var cflags []string
deviceFrameSizeLimit := 1736
@@ -109,6 +115,11 @@
func hostFlags(ctx android.BaseContext) []string {
var cflags []string
hostFrameSizeLimit := 1736
+ if len(ctx.AConfig().SanitizeHost()) > 0 {
+ // art/test/137-cfi/cfi.cc
+ // error: stack frame size of 1944 bytes in function 'Java_Main_unwindInProcess'
+ hostFrameSizeLimit = 6400
+ }
cflags = append(cflags,
fmt.Sprintf("-Wframe-larger-than=%d", hostFrameSizeLimit),
fmt.Sprintf("-DART_FRAME_SIZE_LIMIT=%d", hostFrameSizeLimit),
@@ -144,6 +155,16 @@
ctx.AppendProperties(p)
}
+func debugDefaults(ctx android.LoadHookContext) {
+ type props struct {
+ Cflags []string
+ }
+
+ p := &props{}
+ p.Cflags = debugFlags(ctx)
+ ctx.AppendProperties(p)
+}
+
func customLinker(ctx android.LoadHookContext) {
linker := envDefault(ctx, "CUSTOM_TARGET_LINKER", "")
if linker != "" {
@@ -204,8 +225,10 @@
soong.RegisterModuleType("art_cc_library", artLibrary)
soong.RegisterModuleType("art_cc_binary", artBinary)
soong.RegisterModuleType("art_cc_test", artTest)
+ soong.RegisterModuleType("art_cc_test_library", artTestLibrary)
soong.RegisterModuleType("art_cc_defaults", artDefaultsFactory)
soong.RegisterModuleType("art_global_defaults", artGlobalDefaultsFactory)
+ soong.RegisterModuleType("art_debug_defaults", artDebugDefaultsFactory)
}
func artGlobalDefaultsFactory() (blueprint.Module, []interface{}) {
@@ -215,6 +238,13 @@
return module, props
}
+func artDebugDefaultsFactory() (blueprint.Module, []interface{}) {
+ module, props := artDefaultsFactory()
+ android.AddLoadHook(module, debugDefaults)
+
+ return module, props
+}
+
func artDefaultsFactory() (blueprint.Module, []interface{}) {
c := &codegenProperties{}
module, props := cc.DefaultsFactory(c)
@@ -253,6 +283,17 @@
return module, props
}
+func artTestLibrary() (blueprint.Module, []interface{}) {
+ test := cc.NewTestLibrary(android.HostAndDeviceSupported)
+ module, props := test.Init()
+
+ props = installCodegenCustomizer(module, props, false)
+
+ android.AddLoadHook(module, prefer32Bit)
+ android.AddInstallHook(module, testInstall)
+ return module, props
+}
+
func envDefault(ctx android.BaseContext, key string, defaultValue string) string {
ret := ctx.AConfig().Getenv(key)
if ret == "" {
diff --git a/cmdline/Android.bp b/cmdline/Android.bp
index c9cd9dc..c811cbd 100644
--- a/cmdline/Android.bp
+++ b/cmdline/Android.bp
@@ -17,7 +17,7 @@
art_cc_test {
name: "art_cmdline_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["cmdline_parser_test.cc"],
}
diff --git a/compiler/Android.bp b/compiler/Android.bp
index 4af43cc..8a2c94a 100644
--- a/compiler/Android.bp
+++ b/compiler/Android.bp
@@ -293,7 +293,7 @@
art_cc_test {
name: "art_compiler_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: [
"compiled_method_test.cc",
@@ -392,7 +392,7 @@
name: "art_compiler_host_tests",
device_supported: false,
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
codegen: {
arm: {
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index 3ce786e..c902d28 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -90,7 +90,7 @@
// Compiles a virtual method invocation into a quick virtual method invocation.
// The method index is replaced by the vtable index where the corresponding
- // AbstractMethod can be found. Therefore, this does not involve any resolution
+ // Executable can be found. Therefore, this does not involve any resolution
// at runtime.
// Since the method index is encoded with 16 bits, we can replace it only if the
// vtable index can be encoded with 16 bits too.
diff --git a/compiler/image_test.cc b/compiler/image_test.cc
index a18935f..421a1d5 100644
--- a/compiler/image_test.cc
+++ b/compiler/image_test.cc
@@ -56,35 +56,67 @@
compiler_options_->SetInlineMaxCodeUnits(CompilerOptions::kDefaultInlineMaxCodeUnits);
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ const std::vector<const DexFile*>& boot_class_path = class_linker->GetBootClassPath();
+ const size_t num_images = boot_class_path.size();
+
// Enable write for dex2dex.
- for (const DexFile* dex_file : class_linker->GetBootClassPath()) {
+ for (const DexFile* dex_file : boot_class_path) {
dex_file->EnableWrite();
}
// Create a generic location tmp file, to be the base of the .art and .oat temporary files.
- ScratchFile location;
- ScratchFile image_location(location, ".art");
+ std::vector<ScratchFile> image_locations;
+ {
+ ScratchFile location;
+ for (int i = 0; i < static_cast<int>(num_images); ++i) {
+ std::string cur_location(StringPrintf("%s-%d.art", location.GetFilename().c_str(), i));
+ image_locations.push_back(ScratchFile(cur_location));
+ }
+ }
+ std::vector<std::string> image_filenames;
+ std::vector<ScratchFile> image_files;
+ std::string image_dir;
+ for (ScratchFile& file : image_locations) {
+ std::string image_filename(GetSystemImageFilename(file.GetFilename().c_str(), kRuntimeISA));
+ image_filenames.push_back(image_filename);
+ size_t pos = image_filename.rfind('/');
+ CHECK_NE(pos, std::string::npos) << image_filename;
+ if (image_dir.empty()) {
+ image_dir = image_filename.substr(0, pos);
+ int mkdir_result = mkdir(image_dir.c_str(), 0700);
+ CHECK_EQ(0, mkdir_result) << image_dir;
+ }
+ image_files.push_back(ScratchFile(OS::CreateEmptyFile(image_filename.c_str())));
+ }
- std::string image_filename(GetSystemImageFilename(image_location.GetFilename().c_str(),
- kRuntimeISA));
- size_t pos = image_filename.rfind('/');
- CHECK_NE(pos, std::string::npos) << image_filename;
- std::string image_dir(image_filename, 0, pos);
- int mkdir_result = mkdir(image_dir.c_str(), 0700);
- CHECK_EQ(0, mkdir_result) << image_dir;
- ScratchFile image_file(OS::CreateEmptyFile(image_filename.c_str()));
-
- std::string oat_filename = ReplaceFileExtension(image_filename, "oat");
- ScratchFile oat_file(OS::CreateEmptyFile(oat_filename.c_str()));
-
- std::string vdex_filename = ReplaceFileExtension(image_filename, "vdex");
- ScratchFile vdex_file(OS::CreateEmptyFile(vdex_filename.c_str()));
+ std::vector<std::string> oat_filenames;
+ std::vector<ScratchFile> oat_files;
+ std::vector<std::string> vdex_filenames;
+ std::vector<ScratchFile> vdex_files;
+ for (const std::string& image_filename : image_filenames) {
+ std::string oat_filename = ReplaceFileExtension(image_filename, "oat");
+ oat_files.push_back(ScratchFile(OS::CreateEmptyFile(oat_filename.c_str())));
+ oat_filenames.push_back(oat_filename);
+ std::string vdex_filename = ReplaceFileExtension(image_filename, "vdex");
+ vdex_files.push_back(ScratchFile(OS::CreateEmptyFile(vdex_filename.c_str())));
+ vdex_filenames.push_back(vdex_filename);
+ }
const uintptr_t requested_image_base = ART_BASE_ADDRESS;
std::unordered_map<const DexFile*, size_t> dex_file_to_oat_index_map;
- std::vector<const char*> oat_filename_vector(1, oat_filename.c_str());
- for (const DexFile* dex_file : class_linker->GetBootClassPath()) {
- dex_file_to_oat_index_map.emplace(dex_file, 0);
+ std::vector<const char*> oat_filename_vector;
+ for (const std::string& file : oat_filenames) {
+ oat_filename_vector.push_back(file.c_str());
}
+ std::vector<const char*> image_filename_vector;
+ for (const std::string& file : image_filenames) {
+ image_filename_vector.push_back(file.c_str());
+ }
+ size_t image_idx = 0;
+ for (const DexFile* dex_file : boot_class_path) {
+ dex_file_to_oat_index_map.emplace(dex_file, image_idx);
+ ++image_idx;
+ }
+ // TODO: compile_pic should be a test argument.
std::unique_ptr<ImageWriter> writer(new ImageWriter(*compiler_driver_,
requested_image_base,
/*compile_pic*/false,
@@ -92,7 +124,6 @@
storage_mode,
oat_filename_vector,
dex_file_to_oat_index_map));
- // TODO: compile_pic should be a test argument.
{
{
jobject class_loader = nullptr;
@@ -103,97 +134,128 @@
t.NewTiming("WriteElf");
SafeMap<std::string, std::string> key_value_store;
+ std::vector<const char*> dex_filename_vector;
+ for (size_t i = 0; i < boot_class_path.size(); ++i) {
+ dex_filename_vector.push_back("");
+ }
+ key_value_store.Put(OatHeader::kBootClassPathKey,
+ gc::space::ImageSpace::GetMultiImageBootClassPath(
+ dex_filename_vector,
+ oat_filename_vector,
+ image_filename_vector));
+
const std::vector<const DexFile*>& dex_files = class_linker->GetBootClassPath();
- std::unique_ptr<ElfWriter> elf_writer = CreateElfWriterQuick(
- compiler_driver_->GetInstructionSet(),
- compiler_driver_->GetInstructionSetFeatures(),
- &compiler_driver_->GetCompilerOptions(),
- oat_file.GetFile());
- elf_writer->Start();
- OatWriter oat_writer(/*compiling_boot_image*/true, &timings);
- OutputStream* oat_rodata = elf_writer->StartRoData();
- for (const DexFile* dex_file : dex_files) {
+ std::vector<std::unique_ptr<ElfWriter>> elf_writers;
+ std::vector<std::unique_ptr<OatWriter>> oat_writers;
+ for (ScratchFile& oat_file : oat_files) {
+ elf_writers.emplace_back(CreateElfWriterQuick(compiler_driver_->GetInstructionSet(),
+ compiler_driver_->GetInstructionSetFeatures(),
+ &compiler_driver_->GetCompilerOptions(),
+ oat_file.GetFile()));
+ elf_writers.back()->Start();
+ oat_writers.emplace_back(new OatWriter(/*compiling_boot_image*/true, &timings));
+ }
+
+ std::vector<OutputStream*> rodata;
+ std::vector<std::unique_ptr<MemMap>> opened_dex_files_map;
+ std::vector<std::unique_ptr<const DexFile>> opened_dex_files;
+ // Now that we have finalized key_value_store_, start writing the oat file.
+ for (size_t i = 0, size = oat_writers.size(); i != size; ++i) {
+ const DexFile* dex_file = dex_files[i];
+ rodata.push_back(elf_writers[i]->StartRoData());
ArrayRef<const uint8_t> raw_dex_file(
reinterpret_cast<const uint8_t*>(&dex_file->GetHeader()),
dex_file->GetHeader().file_size_);
- oat_writer.AddRawDexFileSource(raw_dex_file,
- dex_file->GetLocation().c_str(),
- dex_file->GetLocationChecksum());
- }
- std::unique_ptr<MemMap> opened_dex_files_map;
- std::vector<std::unique_ptr<const DexFile>> opened_dex_files;
- {
- bool dex_files_ok = oat_writer.WriteAndOpenDexFiles(
- kIsVdexEnabled ? vdex_file.GetFile() : oat_file.GetFile(),
- oat_rodata,
+ oat_writers[i]->AddRawDexFileSource(raw_dex_file,
+ dex_file->GetLocation().c_str(),
+ dex_file->GetLocationChecksum());
+
+ std::unique_ptr<MemMap> cur_opened_dex_files_map;
+ std::vector<std::unique_ptr<const DexFile>> cur_opened_dex_files;
+ bool dex_files_ok = oat_writers[i]->WriteAndOpenDexFiles(
+ kIsVdexEnabled ? vdex_files[i].GetFile() : oat_files[i].GetFile(),
+ rodata.back(),
compiler_driver_->GetInstructionSet(),
compiler_driver_->GetInstructionSetFeatures(),
&key_value_store,
/* verify */ false, // Dex files may be dex-to-dex-ed, don't verify.
- &opened_dex_files_map,
- &opened_dex_files);
+ &cur_opened_dex_files_map,
+ &cur_opened_dex_files);
ASSERT_TRUE(dex_files_ok);
- }
+ if (cur_opened_dex_files_map != nullptr) {
+ opened_dex_files_map.push_back(std::move(cur_opened_dex_files_map));
+ for (std::unique_ptr<const DexFile>& cur_dex_file : cur_opened_dex_files) {
+ // dex_file_oat_index_map_.emplace(dex_file.get(), i);
+ opened_dex_files.push_back(std::move(cur_dex_file));
+ }
+ } else {
+ ASSERT_TRUE(cur_opened_dex_files.empty());
+ }
+ }
bool image_space_ok = writer->PrepareImageAddressSpace();
ASSERT_TRUE(image_space_ok);
- linker::MultiOatRelativePatcher patcher(compiler_driver_->GetInstructionSet(),
- instruction_set_features_.get());
- oat_writer.PrepareLayout(compiler_driver_.get(), writer.get(), dex_files, &patcher);
- size_t rodata_size = oat_writer.GetOatHeader().GetExecutableOffset();
- size_t text_size = oat_writer.GetOatSize() - rodata_size;
- elf_writer->SetLoadedSectionSizes(rodata_size, text_size, oat_writer.GetBssSize());
+ for (size_t i = 0, size = oat_files.size(); i != size; ++i) {
+ linker::MultiOatRelativePatcher patcher(compiler_driver_->GetInstructionSet(),
+ instruction_set_features_.get());
+ OatWriter* const oat_writer = oat_writers[i].get();
+ ElfWriter* const elf_writer = elf_writers[i].get();
+ std::vector<const DexFile*> cur_dex_files(1u, dex_files[i]);
+ oat_writer->PrepareLayout(compiler_driver_.get(), writer.get(), cur_dex_files, &patcher);
+ size_t rodata_size = oat_writer->GetOatHeader().GetExecutableOffset();
+ size_t text_size = oat_writer->GetOatSize() - rodata_size;
+ elf_writer->SetLoadedSectionSizes(rodata_size, text_size, oat_writer->GetBssSize());
- writer->UpdateOatFileLayout(/* oat_index */ 0u,
- elf_writer->GetLoadedSize(),
- oat_writer.GetOatDataOffset(),
- oat_writer.GetOatSize());
+ writer->UpdateOatFileLayout(i,
+ elf_writer->GetLoadedSize(),
+ oat_writer->GetOatDataOffset(),
+ oat_writer->GetOatSize());
- bool rodata_ok = oat_writer.WriteRodata(oat_rodata);
- ASSERT_TRUE(rodata_ok);
- elf_writer->EndRoData(oat_rodata);
+ bool rodata_ok = oat_writer->WriteRodata(rodata[i]);
+ ASSERT_TRUE(rodata_ok);
+ elf_writer->EndRoData(rodata[i]);
- OutputStream* text = elf_writer->StartText();
- bool text_ok = oat_writer.WriteCode(text);
- ASSERT_TRUE(text_ok);
- elf_writer->EndText(text);
+ OutputStream* text = elf_writer->StartText();
+ bool text_ok = oat_writer->WriteCode(text);
+ ASSERT_TRUE(text_ok);
+ elf_writer->EndText(text);
- bool header_ok = oat_writer.WriteHeader(elf_writer->GetStream(), 0u, 0u, 0u);
- ASSERT_TRUE(header_ok);
+ bool header_ok = oat_writer->WriteHeader(elf_writer->GetStream(), 0u, 0u, 0u);
+ ASSERT_TRUE(header_ok);
- writer->UpdateOatFileHeader(/* oat_index */ 0u, oat_writer.GetOatHeader());
+ writer->UpdateOatFileHeader(i, oat_writer->GetOatHeader());
- elf_writer->WriteDynamicSection();
- elf_writer->WriteDebugInfo(oat_writer.GetMethodDebugInfo());
- elf_writer->WritePatchLocations(oat_writer.GetAbsolutePatchLocations());
+ elf_writer->WriteDynamicSection();
+ elf_writer->WriteDebugInfo(oat_writer->GetMethodDebugInfo());
+ elf_writer->WritePatchLocations(oat_writer->GetAbsolutePatchLocations());
- bool success = elf_writer->End();
- ASSERT_TRUE(success);
+ bool success = elf_writer->End();
+ ASSERT_TRUE(success);
+ }
}
}
- // Workound bug that mcld::Linker::emit closes oat_file by reopening as dup_oat.
- std::unique_ptr<File> dup_oat(OS::OpenFileReadWrite(oat_file.GetFilename().c_str()));
- ASSERT_TRUE(dup_oat.get() != nullptr);
{
- std::vector<const char*> dup_oat_filename(1, dup_oat->GetPath().c_str());
- std::vector<const char*> dup_image_filename(1, image_file.GetFilename().c_str());
bool success_image = writer->Write(kInvalidFd,
- dup_image_filename,
- dup_oat_filename);
+ image_filename_vector,
+ oat_filename_vector);
ASSERT_TRUE(success_image);
- bool success_fixup = ElfWriter::Fixup(dup_oat.get(),
- writer->GetOatDataBegin(0));
- ASSERT_TRUE(success_fixup);
- ASSERT_EQ(dup_oat->FlushCloseOrErase(), 0) << "Could not flush and close oat file "
- << oat_file.GetFilename();
+ for (size_t i = 0, size = oat_filenames.size(); i != size; ++i) {
+ const char* oat_filename = oat_filenames[i].c_str();
+ std::unique_ptr<File> oat_file(OS::OpenFileReadWrite(oat_filename));
+ ASSERT_TRUE(oat_file != nullptr);
+ bool success_fixup = ElfWriter::Fixup(oat_file.get(),
+ writer->GetOatDataBegin(i));
+ ASSERT_TRUE(success_fixup);
+ ASSERT_EQ(oat_file->FlushCloseOrErase(), 0) << "Could not flush and close oat file "
+ << oat_filename;
+ }
}
- uint64_t image_file_size;
- size_t image_size;
- {
+ std::vector<uint64_t> image_file_sizes;
+ for (ScratchFile& image_file : image_files) {
std::unique_ptr<File> file(OS::OpenFileForReading(image_file.GetFilename().c_str()));
ASSERT_TRUE(file.get() != nullptr);
ImageHeader image_header;
@@ -209,9 +271,7 @@
ASSERT_FALSE(space->IsImageSpace());
ASSERT_TRUE(space != nullptr);
ASSERT_TRUE(space->IsMallocSpace());
-
- image_file_size = file->GetLength();
- image_size = image_header.GetImageSize();
+ image_file_sizes.push_back(file->GetLength());
}
ASSERT_TRUE(compiler_driver_->GetImageClasses() != nullptr);
@@ -231,11 +291,10 @@
java_lang_dex_file_ = nullptr;
MemMap::Init();
- std::unique_ptr<const DexFile> dex(LoadExpectSingleDexFile(GetLibCoreDexFileNames()[0].c_str()));
RuntimeOptions options;
std::string image("-Ximage:");
- image.append(image_location.GetFilename());
+ image.append(image_locations[0].GetFilename());
options.push_back(std::make_pair(image.c_str(), static_cast<void*>(nullptr)));
// By default the compiler this creates will not include patch information.
options.push_back(std::make_pair("-Xnorelocate", nullptr));
@@ -257,39 +316,54 @@
ASSERT_TRUE(heap->GetNonMovingSpace()->IsMallocSpace());
// We loaded the runtime with an explicit image, so it must exist.
- gc::space::ImageSpace* image_space = heap->GetBootImageSpaces()[0];
- ASSERT_TRUE(image_space != nullptr);
- if (storage_mode == ImageHeader::kStorageModeUncompressed) {
- // Uncompressed, image should be smaller than file.
- ASSERT_LE(image_size, image_file_size);
- } else {
- // Compressed, file should be smaller than image.
- ASSERT_LE(image_file_size, image_size);
- }
-
- image_space->VerifyImageAllocations();
- uint8_t* image_begin = image_space->Begin();
- uint8_t* image_end = image_space->End();
- CHECK_EQ(requested_image_base, reinterpret_cast<uintptr_t>(image_begin));
- for (size_t i = 0; i < dex->NumClassDefs(); ++i) {
- const DexFile::ClassDef& class_def = dex->GetClassDef(i);
- const char* descriptor = dex->GetClassDescriptor(class_def);
- mirror::Class* klass = class_linker_->FindSystemClass(soa.Self(), descriptor);
- EXPECT_TRUE(klass != nullptr) << descriptor;
- if (image_classes.find(descriptor) != image_classes.end()) {
- // Image classes should be located inside the image.
- EXPECT_LT(image_begin, reinterpret_cast<uint8_t*>(klass)) << descriptor;
- EXPECT_LT(reinterpret_cast<uint8_t*>(klass), image_end) << descriptor;
+ ASSERT_EQ(heap->GetBootImageSpaces().size(), image_file_sizes.size());
+ for (size_t i = 0; i < image_file_sizes.size(); ++i) {
+ std::unique_ptr<const DexFile> dex(
+ LoadExpectSingleDexFile(GetLibCoreDexFileNames()[i].c_str()));
+ uint64_t image_file_size = image_file_sizes[i];
+ gc::space::ImageSpace* image_space = heap->GetBootImageSpaces()[i];
+ ASSERT_TRUE(image_space != nullptr);
+ if (storage_mode == ImageHeader::kStorageModeUncompressed) {
+ // Uncompressed, image should be smaller than file.
+ ASSERT_LE(image_space->GetImageHeader().GetImageSize(), image_file_size);
} else {
- EXPECT_TRUE(reinterpret_cast<uint8_t*>(klass) >= image_end ||
- reinterpret_cast<uint8_t*>(klass) < image_begin) << descriptor;
+ // Compressed, file should be smaller than image.
+ ASSERT_LE(image_file_size, image_space->GetImageHeader().GetImageSize());
}
- EXPECT_TRUE(Monitor::IsValidLockWord(klass->GetLockWord(false)));
+
+ image_space->VerifyImageAllocations();
+ uint8_t* image_begin = image_space->Begin();
+ uint8_t* image_end = image_space->End();
+ if (i == 0) {
+ // This check is only valid for image 0.
+ CHECK_EQ(requested_image_base, reinterpret_cast<uintptr_t>(image_begin));
+ }
+ for (size_t j = 0; j < dex->NumClassDefs(); ++j) {
+ const DexFile::ClassDef& class_def = dex->GetClassDef(j);
+ const char* descriptor = dex->GetClassDescriptor(class_def);
+ mirror::Class* klass = class_linker_->FindSystemClass(soa.Self(), descriptor);
+ EXPECT_TRUE(klass != nullptr) << descriptor;
+ if (image_classes.find(descriptor) == image_classes.end()) {
+ EXPECT_TRUE(reinterpret_cast<uint8_t*>(klass) >= image_end ||
+ reinterpret_cast<uint8_t*>(klass) < image_begin) << descriptor;
+ } else {
+ // Image classes should be located inside the image.
+ EXPECT_LT(image_begin, reinterpret_cast<uint8_t*>(klass)) << descriptor;
+ EXPECT_LT(reinterpret_cast<uint8_t*>(klass), image_end) << descriptor;
+ }
+ EXPECT_TRUE(Monitor::IsValidLockWord(klass->GetLockWord(false)));
+ }
}
- image_file.Unlink();
- oat_file.Unlink();
- vdex_file.Unlink();
+ for (ScratchFile& image_file : image_files) {
+ image_file.Unlink();
+ }
+ for (ScratchFile& oat_file : oat_files) {
+ oat_file.Unlink();
+ }
+ for (ScratchFile& vdex_file : vdex_files) {
+ vdex_file.Unlink();
+ }
int rmdir_result = rmdir(image_dir.c_str());
CHECK_EQ(0, rmdir_result);
}
@@ -306,7 +380,6 @@
TestWriteRead(ImageHeader::kStorageModeLZ4HC);
}
-
TEST_F(ImageTest, ImageHeaderIsValid) {
uint32_t image_begin = ART_BASE_ADDRESS;
uint32_t image_size_ = 16 * KB;
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index 6d86f7d..cdb57a9 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -48,12 +48,12 @@
#include "intern_table.h"
#include "linear_alloc.h"
#include "lock_word.h"
-#include "mirror/abstract_method.h"
#include "mirror/array-inl.h"
#include "mirror/class-inl.h"
#include "mirror/class_loader.h"
#include "mirror/dex_cache.h"
#include "mirror/dex_cache-inl.h"
+#include "mirror/executable.h"
#include "mirror/method.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
@@ -1989,14 +1989,10 @@
} else {
if (klass == mirror::Method::StaticClass() || klass == mirror::Constructor::StaticClass()) {
// Need to go update the ArtMethod.
- auto* dest = down_cast<mirror::AbstractMethod*>(copy);
- auto* src = down_cast<mirror::AbstractMethod*>(orig);
+ auto* dest = down_cast<mirror::Executable*>(copy);
+ auto* src = down_cast<mirror::Executable*>(orig);
ArtMethod* src_method = src->GetArtMethod();
- auto it = native_object_relocations_.find(src_method);
- CHECK(it != native_object_relocations_.end())
- << "Missing relocation for AbstractMethod.artMethod " << PrettyMethod(src_method);
- dest->SetArtMethod(
- reinterpret_cast<ArtMethod*>(global_image_begin_ + it->second.offset));
+ dest->SetArtMethod(GetImageMethodAddress(src_method));
} else if (!klass->IsArrayClass()) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
if (klass == class_linker->GetClassRoot(ClassLinker::kJavaLangDexCache)) {
diff --git a/compiler/jni/jni_compiler_test.cc b/compiler/jni/jni_compiler_test.cc
index cdd4c68..b692c6d 100644
--- a/compiler/jni/jni_compiler_test.cc
+++ b/compiler/jni/jni_compiler_test.cc
@@ -391,12 +391,12 @@
// 3) synchronized keyword
// -- TODO: We can support (1) if we remove the mutator lock assert during stub lookup.
# define JNI_TEST_NORMAL_ONLY(TestName) \
- TEST_F(JniCompilerTest, TestName ## Default) { \
+ TEST_F(JniCompilerTest, TestName ## NormalCompiler) { \
SCOPED_TRACE("Normal JNI with compiler"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kNormal); \
TestName ## Impl(); \
} \
- TEST_F(JniCompilerTest, TestName ## Generic) { \
+ TEST_F(JniCompilerTest, TestName ## NormalGeneric) { \
SCOPED_TRACE("Normal JNI with generic"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kNormal); \
TEST_DISABLED_FOR_MIPS(); \
@@ -404,45 +404,40 @@
TestName ## Impl(); \
}
-// Test normal compiler, @FastNative compiler, and normal/@FastNative generic for normal natives.
+// Test (normal, @FastNative) x (compiler, generic).
#define JNI_TEST(TestName) \
JNI_TEST_NORMAL_ONLY(TestName) \
- TEST_F(JniCompilerTest, TestName ## Fast) { \
+ TEST_F(JniCompilerTest, TestName ## FastCompiler) { \
SCOPED_TRACE("@FastNative JNI with compiler"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kFast); \
TestName ## Impl(); \
} \
- \
-
-// TODO: maybe. @FastNative generic JNI support?
-#if 0
+ \
TEST_F(JniCompilerTest, TestName ## FastGeneric) { \
+ SCOPED_TRACE("@FastNative JNI with generic"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kFast); \
TEST_DISABLED_FOR_MIPS(); \
SetCheckGenericJni(true); \
TestName ## Impl(); \
}
-#endif
+// Test (@CriticalNative) x (compiler, generic) only.
#define JNI_TEST_CRITICAL_ONLY(TestName) \
- TEST_F(JniCompilerTest, TestName ## DefaultCritical) { \
+ TEST_F(JniCompilerTest, TestName ## CriticalCompiler) { \
SCOPED_TRACE("@CriticalNative JNI with compiler"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kCritical); \
TestName ## Impl(); \
- }
-
-// Test everything above and also the @CriticalNative compiler, and @CriticalNative generic JNI.
-#define JNI_TEST_CRITICAL(TestName) \
- JNI_TEST(TestName) \
- JNI_TEST_CRITICAL_ONLY(TestName) \
-
-// TODO: maybe, more likely since calling convention changed. @Criticalnative generic JNI support?
-#if 0
- TEST_F(JniCompilerTest, TestName ## GenericCritical) { \
+ } \
+ TEST_F(JniCompilerTest, TestName ## CriticalGeneric) { \
+ SCOPED_TRACE("@CriticalNative JNI with generic"); \
gCurrentJni = static_cast<uint32_t>(JniKind::kCritical); \
TestName ## Impl(); \
}
-#endif
+
+// Test everything: (normal, @FastNative, @CriticalNative) x (compiler, generic).
+#define JNI_TEST_CRITICAL(TestName) \
+ JNI_TEST(TestName) \
+ JNI_TEST_CRITICAL_ONLY(TestName) \
static void expectValidThreadState() {
// Normal JNI always transitions to "Native". Other JNIs stay in the "Runnable" state.
@@ -506,6 +501,7 @@
// Temporarily disable the EXPECT_NUM_STACK_REFERENCES check (for a single test).
struct ScopedDisableCheckNumStackReferences {
ScopedDisableCheckNumStackReferences() {
+ CHECK(sCheckNumStackReferences); // No nested support.
sCheckNumStackReferences = false;
}
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index 5e0c64b..9045817 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -55,6 +55,7 @@
#include "utils/dex_cache_arrays_layout-inl.h"
#include "vdex_file.h"
#include "verifier/method_verifier.h"
+#include "verifier/verifier_deps.h"
#include "zip_archive.h"
namespace art {
@@ -259,7 +260,16 @@
// Data to write to a separate section.
dchecked_vector<uint32_t> class_offsets_;
+ void InitTypeLookupTable(const DexFile& dex_file, uint8_t* storage) const {
+ lookup_table_.reset(TypeLookupTable::Create(dex_file, storage));
+ }
+
+ TypeLookupTable* GetTypeLookupTable() const {
+ return lookup_table_.get();
+ }
+
private:
+ mutable std::unique_ptr<TypeLookupTable> lookup_table_;
size_t GetClassOffsetsRawSize() const {
return class_offsets_.size() * sizeof(class_offsets_[0]);
}
@@ -288,6 +298,7 @@
dex_files_(nullptr),
vdex_size_(0u),
vdex_dex_files_offset_(0u),
+ vdex_verifier_deps_offset_(0u),
oat_size_(0u),
bss_size_(0u),
oat_data_offset_(0u),
@@ -298,6 +309,8 @@
size_oat_header_(0),
size_oat_header_key_value_store_(0),
size_dex_file_(0),
+ size_verifier_deps_(0),
+ size_verifier_deps_alignment_(0),
size_interpreter_to_interpreter_bridge_(0),
size_interpreter_to_compiled_code_bridge_(0),
size_jni_dlsym_lookup_(0),
@@ -467,11 +480,6 @@
!OpenDexFiles(vdex_file, verify, &dex_files_map, &dex_files)) {
return false;
}
-
- // VDEX is finalized. Seek to the beginning of the file and write the header.
- if (!WriteVdexHeader(vdex_out.get())) {
- return false;
- }
} else {
// Write DEX files into OAT, mmap and open them.
if (!WriteDexFiles(oat_rodata, vdex_file) ||
@@ -1586,6 +1594,52 @@
return true;
}
+bool OatWriter::WriteVerifierDeps(OutputStream* vdex_out, verifier::VerifierDeps* verifier_deps) {
+ if (!kIsVdexEnabled) {
+ return true;
+ }
+
+ if (verifier_deps == nullptr) {
+ // Nothing to write. Record the offset, but no need
+ // for alignment.
+ vdex_verifier_deps_offset_ = vdex_size_;
+ return true;
+ }
+
+ size_t initial_offset = vdex_size_;
+ size_t start_offset = RoundUp(initial_offset, 4u);
+
+ vdex_size_ = start_offset;
+ vdex_verifier_deps_offset_ = vdex_size_;
+ size_verifier_deps_alignment_ = start_offset - initial_offset;
+
+ off_t actual_offset = vdex_out->Seek(start_offset, kSeekSet);
+ if (actual_offset != static_cast<off_t>(start_offset)) {
+ PLOG(ERROR) << "Failed to seek to verifier deps section. Actual: " << actual_offset
+ << " Expected: " << start_offset
+ << " Output: " << vdex_out->GetLocation();
+ return false;
+ }
+
+ std::vector<uint8_t> buffer;
+ verifier_deps->Encode(&buffer);
+
+ if (!vdex_out->WriteFully(buffer.data(), buffer.size())) {
+ PLOG(ERROR) << "Failed to write verifier deps."
+ << " File: " << vdex_out->GetLocation();
+ return false;
+ }
+ if (!vdex_out->Flush()) {
+ PLOG(ERROR) << "Failed to flush stream after writing verifier deps."
+ << " File: " << vdex_out->GetLocation();
+ return false;
+ }
+
+ size_verifier_deps_ = buffer.size();
+ vdex_size_ += size_verifier_deps_;
+ return true;
+}
+
bool OatWriter::WriteCode(OutputStream* out) {
CHECK(write_state_ == WriteState::kWriteText);
@@ -1629,6 +1683,8 @@
DO_STAT(size_oat_header_);
DO_STAT(size_oat_header_key_value_store_);
DO_STAT(size_dex_file_);
+ DO_STAT(size_verifier_deps_);
+ DO_STAT(size_verifier_deps_alignment_);
DO_STAT(size_interpreter_to_interpreter_bridge_);
DO_STAT(size_interpreter_to_compiled_code_bridge_);
DO_STAT(size_jni_dlsym_lookup_);
@@ -2285,9 +2341,9 @@
}
// Create the lookup table. When `nullptr` is given as the storage buffer,
- // TypeLookupTable allocates its own and DexFile takes ownership.
- opened_dex_files[i]->CreateTypeLookupTable(/* storage */ nullptr);
- TypeLookupTable* table = opened_dex_files[i]->GetTypeLookupTable();
+ // TypeLookupTable allocates its own and OatDexFile takes ownership.
+ oat_dex_file->InitTypeLookupTable(*opened_dex_files[i], /* storage */ nullptr);
+ TypeLookupTable* table = oat_dex_file->GetTypeLookupTable();
// Type tables are required to be 4 byte aligned.
size_t initial_offset = oat_size_;
@@ -2332,6 +2388,9 @@
}
bool OatWriter::WriteVdexHeader(OutputStream* vdex_out) {
+ if (!kIsVdexEnabled) {
+ return true;
+ }
off_t actual_offset = vdex_out->Seek(0, kSeekSet);
if (actual_offset != 0) {
PLOG(ERROR) << "Failed to seek to the beginning of vdex file. Actual: " << actual_offset
@@ -2339,12 +2398,24 @@
return false;
}
- VdexFile::Header vdex_header;
+ DCHECK_NE(vdex_dex_files_offset_, 0u);
+ DCHECK_NE(vdex_verifier_deps_offset_, 0u);
+
+ size_t dex_section_size = vdex_verifier_deps_offset_ - vdex_dex_files_offset_;
+ size_t verifier_deps_section_size = vdex_size_ - vdex_verifier_deps_offset_;
+
+ VdexFile::Header vdex_header(dex_section_size, verifier_deps_section_size);
if (!vdex_out->WriteFully(&vdex_header, sizeof(VdexFile::Header))) {
PLOG(ERROR) << "Failed to write vdex header. File: " << vdex_out->GetLocation();
return false;
}
+ if (!vdex_out->Flush()) {
+ PLOG(ERROR) << "Failed to flush stream after writing to vdex file."
+ << " File: " << vdex_out->GetLocation();
+ return false;
+ }
+
return true;
}
diff --git a/compiler/oat_writer.h b/compiler/oat_writer.h
index dd7d699..670accb 100644
--- a/compiler/oat_writer.h
+++ b/compiler/oat_writer.h
@@ -50,6 +50,10 @@
class MultiOatRelativePatcher;
} // namespace linker
+namespace verifier {
+ class VerifierDeps;
+} // namespace verifier
+
// OatHeader variable length with count of D OatDexFiles
//
// OatDexFile[0] one variable sized OatDexFile with offsets to Dex and OatClasses
@@ -149,6 +153,9 @@
bool verify,
/*out*/ std::unique_ptr<MemMap>* opened_dex_files_map,
/*out*/ std::vector<std::unique_ptr<const DexFile>>* opened_dex_files);
+ bool WriteVerifierDeps(OutputStream* vdex_out, verifier::VerifierDeps* verifier_deps);
+ bool WriteVdexHeader(OutputStream* vdex_out);
+
// Prepare layout of remaining data.
void PrepareLayout(const CompilerDriver* compiler,
ImageWriter* image_writer,
@@ -232,8 +239,6 @@
// with a given DexMethodVisitor.
bool VisitDexMethods(DexMethodVisitor* visitor);
- bool WriteVdexHeader(OutputStream* vdex_out);
-
bool WriteDexFiles(OutputStream* out, File* file);
bool WriteDexFile(OutputStream* out, File* file, OatDexFile* oat_dex_file);
bool SeekToDexFile(OutputStream* out, File* file, OatDexFile* oat_dex_file);
@@ -311,6 +316,9 @@
// Offset of section holding Dex files inside Vdex.
size_t vdex_dex_files_offset_;
+ // Offset of section holding VerifierDeps inside Vdex.
+ size_t vdex_verifier_deps_offset_;
+
// Size required for Oat data structures.
size_t oat_size_;
@@ -341,6 +349,8 @@
uint32_t size_oat_header_;
uint32_t size_oat_header_key_value_store_;
uint32_t size_dex_file_;
+ uint32_t size_verifier_deps_;
+ uint32_t size_verifier_deps_alignment_;
uint32_t size_interpreter_to_interpreter_bridge_;
uint32_t size_interpreter_to_compiled_code_bridge_;
uint32_t size_jni_dlsym_lookup_;
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index 6732670..137cd21 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -1117,7 +1117,8 @@
}
}
-LocationSummary* CodeGenerator::CreateNullCheckLocations(HNullCheck* null_check) {
+LocationSummary* CodeGenerator::CreateThrowingSlowPathLocations(HInstruction* instruction,
+ RegisterSet caller_saves) {
// Note: Using kNoCall allows the method to be treated as leaf (and eliminate the
// HSuspendCheck from entry block). However, it will still get a valid stack frame
// because the HNullCheck needs an environment.
@@ -1125,16 +1126,15 @@
// When throwing from a try block, we may need to retrieve dalvik registers from
// physical registers and we also need to set up stack mask for GC. This is
// implicitly achieved by passing kCallOnSlowPath to the LocationSummary.
- bool can_throw_into_catch_block = null_check->CanThrowIntoCatchBlock();
+ bool can_throw_into_catch_block = instruction->CanThrowIntoCatchBlock();
if (can_throw_into_catch_block) {
call_kind = LocationSummary::kCallOnSlowPath;
}
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(null_check, call_kind);
+ LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
if (can_throw_into_catch_block && compiler_options_.GetImplicitNullChecks()) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(caller_saves); // Default: no caller-save registers.
}
- locations->SetInAt(0, Location::RequiresRegister());
- DCHECK(!null_check->HasUses());
+ DCHECK(!instruction->HasUses());
return locations;
}
@@ -1179,37 +1179,51 @@
GetMoveResolver()->EmitNativeCode(¶llel_move);
}
-void CodeGenerator::ValidateInvokeRuntime(HInstruction* instruction, SlowPathCode* slow_path) {
+void CodeGenerator::ValidateInvokeRuntime(QuickEntrypointEnum entrypoint,
+ HInstruction* instruction,
+ SlowPathCode* slow_path) {
// Ensure that the call kind indication given to the register allocator is
- // coherent with the runtime call generated, and that the GC side effect is
- // set when required.
+ // coherent with the runtime call generated.
if (slow_path == nullptr) {
DCHECK(instruction->GetLocations()->WillCall())
<< "instruction->DebugName()=" << instruction->DebugName();
- DCHECK(instruction->GetSideEffects().Includes(SideEffects::CanTriggerGC()))
- << "instruction->DebugName()=" << instruction->DebugName()
- << " instruction->GetSideEffects().ToString()=" << instruction->GetSideEffects().ToString();
} else {
DCHECK(instruction->GetLocations()->CallsOnSlowPath() || slow_path->IsFatal())
<< "instruction->DebugName()=" << instruction->DebugName()
<< " slow_path->GetDescription()=" << slow_path->GetDescription();
- DCHECK(instruction->GetSideEffects().Includes(SideEffects::CanTriggerGC()) ||
- // When (non-Baker) read barriers are enabled, some instructions
- // use a slow path to emit a read barrier, which does not trigger
- // GC.
- (kEmitCompilerReadBarrier &&
- !kUseBakerReadBarrier &&
- (instruction->IsInstanceFieldGet() ||
- instruction->IsStaticFieldGet() ||
- instruction->IsArrayGet() ||
- instruction->IsLoadClass() ||
- instruction->IsLoadString() ||
- instruction->IsInstanceOf() ||
- instruction->IsCheckCast() ||
- (instruction->IsInvokeVirtual() && instruction->GetLocations()->Intrinsified()))))
- << "instruction->DebugName()=" << instruction->DebugName()
- << " instruction->GetSideEffects().ToString()=" << instruction->GetSideEffects().ToString()
- << " slow_path->GetDescription()=" << slow_path->GetDescription();
+ }
+
+ // Check that the GC side effect is set when required.
+ // TODO: Reverse EntrypointCanTriggerGC
+ if (EntrypointCanTriggerGC(entrypoint)) {
+ if (slow_path == nullptr) {
+ DCHECK(instruction->GetSideEffects().Includes(SideEffects::CanTriggerGC()))
+ << "instruction->DebugName()=" << instruction->DebugName()
+ << " instruction->GetSideEffects().ToString()="
+ << instruction->GetSideEffects().ToString();
+ } else {
+ DCHECK(instruction->GetSideEffects().Includes(SideEffects::CanTriggerGC()) ||
+ // When (non-Baker) read barriers are enabled, some instructions
+ // use a slow path to emit a read barrier, which does not trigger
+ // GC.
+ (kEmitCompilerReadBarrier &&
+ !kUseBakerReadBarrier &&
+ (instruction->IsInstanceFieldGet() ||
+ instruction->IsStaticFieldGet() ||
+ instruction->IsArrayGet() ||
+ instruction->IsLoadClass() ||
+ instruction->IsLoadString() ||
+ instruction->IsInstanceOf() ||
+ instruction->IsCheckCast() ||
+ (instruction->IsInvokeVirtual() && instruction->GetLocations()->Intrinsified()))))
+ << "instruction->DebugName()=" << instruction->DebugName()
+ << " instruction->GetSideEffects().ToString()="
+ << instruction->GetSideEffects().ToString()
+ << " slow_path->GetDescription()=" << slow_path->GetDescription();
+ }
+ } else {
+ // The GC side effect is not required for the instruction. But the instruction might still have
+ // it, for example if it calls other entrypoints requiring it.
}
// Check the coherency of leaf information.
@@ -1259,7 +1273,7 @@
}
const uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
- for (size_t i : LowToHighBits(fp_spills)) {
+ for (uint32_t i : LowToHighBits(fp_spills)) {
DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
saved_fpu_stack_offsets_[i] = stack_offset;
@@ -1278,7 +1292,7 @@
}
const uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
- for (size_t i : LowToHighBits(fp_spills)) {
+ for (uint32_t i : LowToHighBits(fp_spills)) {
DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
stack_offset += codegen->RestoreFloatingPointRegister(stack_offset, i);
diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h
index b4d4b9b..c0c798d 100644
--- a/compiler/optimizing/code_generator.h
+++ b/compiler/optimizing/code_generator.h
@@ -313,7 +313,8 @@
bool CanMoveNullCheckToUser(HNullCheck* null_check);
void MaybeRecordImplicitNullCheck(HInstruction* instruction);
- LocationSummary* CreateNullCheckLocations(HNullCheck* null_check);
+ LocationSummary* CreateThrowingSlowPathLocations(
+ HInstruction* instruction, RegisterSet caller_saves = RegisterSet::Empty());
void GenerateNullCheck(HNullCheck* null_check);
virtual void GenerateImplicitNullCheck(HNullCheck* null_check) = 0;
virtual void GenerateExplicitNullCheck(HNullCheck* null_check) = 0;
@@ -404,7 +405,9 @@
// Perfoms checks pertaining to an InvokeRuntime call.
- void ValidateInvokeRuntime(HInstruction* instruction, SlowPathCode* slow_path);
+ void ValidateInvokeRuntime(QuickEntrypointEnum entrypoint,
+ HInstruction* instruction,
+ SlowPathCode* slow_path);
// Perfoms checks pertaining to an InvokeRuntimeWithoutRecordingPcInfo call.
static void ValidateInvokeRuntimeWithoutRecordingPcInfo(HInstruction* instruction,
@@ -577,6 +580,7 @@
core_spill_mask_(0),
fpu_spill_mask_(0),
first_register_slot_in_slow_path_(0),
+ allocated_registers_(RegisterSet::Empty()),
blocked_core_registers_(graph->GetArena()->AllocArray<bool>(number_of_core_registers,
kArenaAllocCodeGenerator)),
blocked_fpu_registers_(graph->GetArena()->AllocArray<bool>(number_of_fpu_registers,
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index 40c2b9c..a052873 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -63,9 +63,188 @@
#define __ down_cast<ArmAssembler*>(codegen->GetAssembler())-> // NOLINT
#define QUICK_ENTRY_POINT(x) QUICK_ENTRYPOINT_OFFSET(kArmPointerSize, x).Int32Value()
-class NullCheckSlowPathARM : public SlowPathCode {
+static constexpr int kRegListThreshold = 4;
+
+// SaveLiveRegisters and RestoreLiveRegisters from SlowPathCodeARM operate on sets of S registers,
+// for each live D registers they treat two corresponding S registers as live ones.
+//
+// Two following functions (SaveContiguousSRegisterList, RestoreContiguousSRegisterList) build
+// from a list of contiguous S registers a list of contiguous D registers (processing first/last
+// S registers corner cases) and save/restore this new list treating them as D registers.
+// - decreasing code size
+// - avoiding hazards on Cortex-A57, when a pair of S registers for an actual live D register is
+// restored and then used in regular non SlowPath code as D register.
+//
+// For the following example (v means the S register is live):
+// D names: | D0 | D1 | D2 | D4 | ...
+// S names: | S0 | S1 | S2 | S3 | S4 | S5 | S6 | S7 | ...
+// Live? | | v | v | v | v | v | v | | ...
+//
+// S1 and S6 will be saved/restored independently; D registers list (D1, D2) will be processed
+// as D registers.
+static size_t SaveContiguousSRegisterList(size_t first,
+ size_t last,
+ CodeGenerator* codegen,
+ size_t stack_offset) {
+ DCHECK_LE(first, last);
+ if ((first == last) && (first == 0)) {
+ stack_offset += codegen->SaveFloatingPointRegister(stack_offset, first);
+ return stack_offset;
+ }
+ if (first % 2 == 1) {
+ stack_offset += codegen->SaveFloatingPointRegister(stack_offset, first++);
+ }
+
+ bool save_last = false;
+ if (last % 2 == 0) {
+ save_last = true;
+ --last;
+ }
+
+ if (first < last) {
+ DRegister d_reg = static_cast<DRegister>(first / 2);
+ DCHECK_EQ((last - first + 1) % 2, 0u);
+ size_t number_of_d_regs = (last - first + 1) / 2;
+
+ if (number_of_d_regs == 1) {
+ __ StoreDToOffset(d_reg, SP, stack_offset);
+ } else if (number_of_d_regs > 1) {
+ __ add(IP, SP, ShifterOperand(stack_offset));
+ __ vstmiad(IP, d_reg, number_of_d_regs);
+ }
+ stack_offset += number_of_d_regs * kArmWordSize * 2;
+ }
+
+ if (save_last) {
+ stack_offset += codegen->SaveFloatingPointRegister(stack_offset, last + 1);
+ }
+
+ return stack_offset;
+}
+
+static size_t RestoreContiguousSRegisterList(size_t first,
+ size_t last,
+ CodeGenerator* codegen,
+ size_t stack_offset) {
+ DCHECK_LE(first, last);
+ if ((first == last) && (first == 0)) {
+ stack_offset += codegen->RestoreFloatingPointRegister(stack_offset, first);
+ return stack_offset;
+ }
+ if (first % 2 == 1) {
+ stack_offset += codegen->RestoreFloatingPointRegister(stack_offset, first++);
+ }
+
+ bool restore_last = false;
+ if (last % 2 == 0) {
+ restore_last = true;
+ --last;
+ }
+
+ if (first < last) {
+ DRegister d_reg = static_cast<DRegister>(first / 2);
+ DCHECK_EQ((last - first + 1) % 2, 0u);
+ size_t number_of_d_regs = (last - first + 1) / 2;
+ if (number_of_d_regs == 1) {
+ __ LoadDFromOffset(d_reg, SP, stack_offset);
+ } else if (number_of_d_regs > 1) {
+ __ add(IP, SP, ShifterOperand(stack_offset));
+ __ vldmiad(IP, d_reg, number_of_d_regs);
+ }
+ stack_offset += number_of_d_regs * kArmWordSize * 2;
+ }
+
+ if (restore_last) {
+ stack_offset += codegen->RestoreFloatingPointRegister(stack_offset, last + 1);
+ }
+
+ return stack_offset;
+}
+
+void SlowPathCodeARM::SaveLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) {
+ size_t stack_offset = codegen->GetFirstRegisterSlotInSlowPath();
+ size_t orig_offset = stack_offset;
+
+ const uint32_t core_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ true);
+ for (uint32_t i : LowToHighBits(core_spills)) {
+ // If the register holds an object, update the stack mask.
+ if (locations->RegisterContainsObject(i)) {
+ locations->SetStackBit(stack_offset / kVRegSize);
+ }
+ DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+ DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
+ saved_core_stack_offsets_[i] = stack_offset;
+ stack_offset += kArmWordSize;
+ }
+
+ int reg_num = POPCOUNT(core_spills);
+ if (reg_num != 0) {
+ if (reg_num > kRegListThreshold) {
+ __ StoreList(RegList(core_spills), orig_offset);
+ } else {
+ stack_offset = orig_offset;
+ for (uint32_t i : LowToHighBits(core_spills)) {
+ stack_offset += codegen->SaveCoreRegister(stack_offset, i);
+ }
+ }
+ }
+
+ uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
+ orig_offset = stack_offset;
+ for (uint32_t i : LowToHighBits(fp_spills)) {
+ DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
+ saved_fpu_stack_offsets_[i] = stack_offset;
+ stack_offset += kArmWordSize;
+ }
+
+ stack_offset = orig_offset;
+ while (fp_spills != 0u) {
+ uint32_t begin = CTZ(fp_spills);
+ uint32_t tmp = fp_spills + (1u << begin);
+ fp_spills &= tmp; // Clear the contiguous range of 1s.
+ uint32_t end = (tmp == 0u) ? 32u : CTZ(tmp); // CTZ(0) is undefined.
+ stack_offset = SaveContiguousSRegisterList(begin, end - 1, codegen, stack_offset);
+ }
+ DCHECK_LE(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+}
+
+void SlowPathCodeARM::RestoreLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) {
+ size_t stack_offset = codegen->GetFirstRegisterSlotInSlowPath();
+ size_t orig_offset = stack_offset;
+
+ const uint32_t core_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ true);
+ for (uint32_t i : LowToHighBits(core_spills)) {
+ DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+ DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
+ stack_offset += kArmWordSize;
+ }
+
+ int reg_num = POPCOUNT(core_spills);
+ if (reg_num != 0) {
+ if (reg_num > kRegListThreshold) {
+ __ LoadList(RegList(core_spills), orig_offset);
+ } else {
+ stack_offset = orig_offset;
+ for (uint32_t i : LowToHighBits(core_spills)) {
+ stack_offset += codegen->RestoreCoreRegister(stack_offset, i);
+ }
+ }
+ }
+
+ uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
+ while (fp_spills != 0u) {
+ uint32_t begin = CTZ(fp_spills);
+ uint32_t tmp = fp_spills + (1u << begin);
+ fp_spills &= tmp; // Clear the contiguous range of 1s.
+ uint32_t end = (tmp == 0u) ? 32u : CTZ(tmp); // CTZ(0) is undefined.
+ stack_offset = RestoreContiguousSRegisterList(begin, end - 1, codegen, stack_offset);
+ }
+ DCHECK_LE(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+}
+
+class NullCheckSlowPathARM : public SlowPathCodeARM {
public:
- explicit NullCheckSlowPathARM(HNullCheck* instruction) : SlowPathCode(instruction) {}
+ explicit NullCheckSlowPathARM(HNullCheck* instruction) : SlowPathCodeARM(instruction) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
@@ -89,17 +268,13 @@
DISALLOW_COPY_AND_ASSIGN(NullCheckSlowPathARM);
};
-class DivZeroCheckSlowPathARM : public SlowPathCode {
+class DivZeroCheckSlowPathARM : public SlowPathCodeARM {
public:
- explicit DivZeroCheckSlowPathARM(HDivZeroCheck* instruction) : SlowPathCode(instruction) {}
+ explicit DivZeroCheckSlowPathARM(HDivZeroCheck* instruction) : SlowPathCodeARM(instruction) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
arm_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -112,10 +287,10 @@
DISALLOW_COPY_AND_ASSIGN(DivZeroCheckSlowPathARM);
};
-class SuspendCheckSlowPathARM : public SlowPathCode {
+class SuspendCheckSlowPathARM : public SlowPathCodeARM {
public:
SuspendCheckSlowPathARM(HSuspendCheck* instruction, HBasicBlock* successor)
- : SlowPathCode(instruction), successor_(successor) {}
+ : SlowPathCodeARM(instruction), successor_(successor) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
@@ -150,10 +325,10 @@
DISALLOW_COPY_AND_ASSIGN(SuspendCheckSlowPathARM);
};
-class BoundsCheckSlowPathARM : public SlowPathCode {
+class BoundsCheckSlowPathARM : public SlowPathCodeARM {
public:
explicit BoundsCheckSlowPathARM(HBoundsCheck* instruction)
- : SlowPathCode(instruction) {}
+ : SlowPathCodeARM(instruction) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
@@ -190,13 +365,13 @@
DISALLOW_COPY_AND_ASSIGN(BoundsCheckSlowPathARM);
};
-class LoadClassSlowPathARM : public SlowPathCode {
+class LoadClassSlowPathARM : public SlowPathCodeARM {
public:
LoadClassSlowPathARM(HLoadClass* cls,
HInstruction* at,
uint32_t dex_pc,
bool do_clinit)
- : SlowPathCode(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+ : SlowPathCodeARM(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
DCHECK(at->IsLoadClass() || at->IsClinitCheck());
}
@@ -247,10 +422,10 @@
DISALLOW_COPY_AND_ASSIGN(LoadClassSlowPathARM);
};
-class TypeCheckSlowPathARM : public SlowPathCode {
+class TypeCheckSlowPathARM : public SlowPathCodeARM {
public:
TypeCheckSlowPathARM(HInstruction* instruction, bool is_fatal)
- : SlowPathCode(instruction), is_fatal_(is_fatal) {}
+ : SlowPathCodeARM(instruction), is_fatal_(is_fatal) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
LocationSummary* locations = instruction_->GetLocations();
@@ -307,10 +482,10 @@
DISALLOW_COPY_AND_ASSIGN(TypeCheckSlowPathARM);
};
-class DeoptimizationSlowPathARM : public SlowPathCode {
+class DeoptimizationSlowPathARM : public SlowPathCodeARM {
public:
explicit DeoptimizationSlowPathARM(HDeoptimize* instruction)
- : SlowPathCode(instruction) {}
+ : SlowPathCodeARM(instruction) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
@@ -325,9 +500,9 @@
DISALLOW_COPY_AND_ASSIGN(DeoptimizationSlowPathARM);
};
-class ArraySetSlowPathARM : public SlowPathCode {
+class ArraySetSlowPathARM : public SlowPathCodeARM {
public:
- explicit ArraySetSlowPathARM(HInstruction* instruction) : SlowPathCode(instruction) {}
+ explicit ArraySetSlowPathARM(HInstruction* instruction) : SlowPathCodeARM(instruction) {}
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
LocationSummary* locations = instruction_->GetLocations();
@@ -367,10 +542,10 @@
};
// Slow path marking an object during a read barrier.
-class ReadBarrierMarkSlowPathARM : public SlowPathCode {
+class ReadBarrierMarkSlowPathARM : public SlowPathCodeARM {
public:
ReadBarrierMarkSlowPathARM(HInstruction* instruction, Location obj)
- : SlowPathCode(instruction), obj_(obj) {
+ : SlowPathCodeARM(instruction), obj_(obj) {
DCHECK(kEmitCompilerReadBarrier);
}
@@ -434,7 +609,7 @@
};
// Slow path generating a read barrier for a heap reference.
-class ReadBarrierForHeapReferenceSlowPathARM : public SlowPathCode {
+class ReadBarrierForHeapReferenceSlowPathARM : public SlowPathCodeARM {
public:
ReadBarrierForHeapReferenceSlowPathARM(HInstruction* instruction,
Location out,
@@ -442,7 +617,7 @@
Location obj,
uint32_t offset,
Location index)
- : SlowPathCode(instruction),
+ : SlowPathCodeARM(instruction),
out_(out),
ref_(ref),
obj_(obj),
@@ -614,10 +789,10 @@
};
// Slow path generating a read barrier for a GC root.
-class ReadBarrierForRootSlowPathARM : public SlowPathCode {
+class ReadBarrierForRootSlowPathARM : public SlowPathCodeARM {
public:
ReadBarrierForRootSlowPathARM(HInstruction* instruction, Location out, Location root)
- : SlowPathCode(instruction), out_(out), root_(root) {
+ : SlowPathCodeARM(instruction), out_(out), root_(root) {
DCHECK(kEmitCompilerReadBarrier);
}
@@ -1177,7 +1352,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
GenerateInvokeRuntime(GetThreadOffset<kArmPointerSize>(entrypoint).Int32Value());
if (EntrypointRequiresStackMap(entrypoint)) {
RecordPcInfo(instruction, dex_pc, slow_path);
@@ -1502,14 +1677,14 @@
void LocationsBuilderARM::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::RequiresRegister());
}
}
void InstructionCodeGeneratorARM::VisitDeoptimize(HDeoptimize* deoptimize) {
- SlowPathCode* slow_path = deopt_slow_paths_.NewSlowPath<DeoptimizationSlowPathARM>(deoptimize);
+ SlowPathCodeARM* slow_path = deopt_slow_paths_.NewSlowPath<DeoptimizationSlowPathARM>(deoptimize);
GenerateTestAndBranch(deoptimize,
/* condition_input_index */ 0,
slow_path->GetEntryLabel(),
@@ -3085,18 +3260,12 @@
}
void LocationsBuilderARM::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorARM::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- SlowPathCode* slow_path = new (GetGraph()->GetArena()) DivZeroCheckSlowPathARM(instruction);
+ SlowPathCodeARM* slow_path = new (GetGraph()->GetArena()) DivZeroCheckSlowPathARM(instruction);
codegen_->AddSlowPath(slow_path);
LocationSummary* locations = instruction->GetLocations();
@@ -3931,7 +4100,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_field_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
@@ -4251,7 +4420,8 @@
}
void LocationsBuilderARM::VisitNullCheck(HNullCheck* instruction) {
- codegen_->CreateNullCheckLocations(instruction);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ locations->SetInAt(0, Location::RequiresRegister());
}
void CodeGeneratorARM::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -4265,7 +4435,7 @@
}
void CodeGeneratorARM::GenerateExplicitNullCheck(HNullCheck* instruction) {
- SlowPathCode* slow_path = new (GetGraph()->GetArena()) NullCheckSlowPathARM(instruction);
+ SlowPathCodeARM* slow_path = new (GetGraph()->GetArena()) NullCheckSlowPathARM(instruction);
AddSlowPath(slow_path);
LocationSummary* locations = instruction->GetLocations();
@@ -4403,7 +4573,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_array_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
@@ -4683,7 +4853,7 @@
uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
Label done;
- SlowPathCode* slow_path = nullptr;
+ SlowPathCodeARM* slow_path = nullptr;
if (may_need_runtime_call_for_type_check) {
slow_path = new (GetGraph()->GetArena()) ArraySetSlowPathARM(instruction);
@@ -4888,20 +5058,18 @@
}
void LocationsBuilderARM::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorARM::VisitBoundsCheck(HBoundsCheck* instruction) {
LocationSummary* locations = instruction->GetLocations();
- SlowPathCode* slow_path =
+ SlowPathCodeARM* slow_path =
new (GetGraph()->GetArena()) BoundsCheckSlowPathARM(instruction);
codegen_->AddSlowPath(slow_path);
@@ -4940,7 +5108,7 @@
void LocationsBuilderARM::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorARM::VisitSuspendCheck(HSuspendCheck* instruction) {
@@ -5262,7 +5430,7 @@
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
HLoadClass::LoadKind load_kind = cls->GetLoadKind();
@@ -5370,7 +5538,7 @@
if (generate_null_check || cls->MustGenerateClinitCheck()) {
DCHECK(cls->CanCallRuntime());
- SlowPathCode* slow_path = new (GetGraph()->GetArena()) LoadClassSlowPathARM(
+ SlowPathCodeARM* slow_path = new (GetGraph()->GetArena()) LoadClassSlowPathARM(
cls, cls, cls->GetDexPc(), cls->MustGenerateClinitCheck());
codegen_->AddSlowPath(slow_path);
if (generate_null_check) {
@@ -5395,7 +5563,7 @@
void InstructionCodeGeneratorARM::VisitClinitCheck(HClinitCheck* check) {
// We assume the class is not null.
- SlowPathCode* slow_path = new (GetGraph()->GetArena()) LoadClassSlowPathARM(
+ SlowPathCodeARM* slow_path = new (GetGraph()->GetArena()) LoadClassSlowPathARM(
check->GetLoadClass(), check, check->GetDexPc(), true);
codegen_->AddSlowPath(slow_path);
GenerateClassInitializationCheck(slow_path,
@@ -5403,7 +5571,7 @@
}
void InstructionCodeGeneratorARM::GenerateClassInitializationCheck(
- SlowPathCode* slow_path, Register class_reg) {
+ SlowPathCodeARM* slow_path, Register class_reg) {
__ LoadFromOffset(kLoadWord, IP, class_reg, mirror::Class::StatusOffset().Int32Value());
__ cmp(IP, ShifterOperand(mirror::Class::kStatusInitialized));
__ b(slow_path->GetEntryLabel(), LT);
@@ -5566,7 +5734,7 @@
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
if (baker_read_barrier_slow_path) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
@@ -5596,7 +5764,7 @@
uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
uint32_t primitive_offset = mirror::Class::PrimitiveTypeOffset().Int32Value();
Label done, zero;
- SlowPathCode* slow_path = nullptr;
+ SlowPathCodeARM* slow_path = nullptr;
// Return 0 if `obj` is null.
// avoid null check if we know obj is not null.
@@ -5788,7 +5956,7 @@
type_check_kind == TypeCheckKind::kClassHierarchyCheck ||
type_check_kind == TypeCheckKind::kArrayObjectCheck) &&
!instruction->CanThrowIntoCatchBlock();
- SlowPathCode* type_check_slow_path =
+ SlowPathCodeARM* type_check_slow_path =
new (GetGraph()->GetArena()) TypeCheckSlowPathARM(instruction,
is_type_check_slow_path_fatal);
codegen_->AddSlowPath(type_check_slow_path);
@@ -6282,7 +6450,7 @@
"have different sizes.");
// Slow path marking the GC root `root`.
- SlowPathCode* slow_path =
+ SlowPathCodeARM* slow_path =
new (GetGraph()->GetArena()) ReadBarrierMarkSlowPathARM(instruction, root);
codegen_->AddSlowPath(slow_path);
@@ -6423,7 +6591,7 @@
__ MaybeUnpoisonHeapReference(ref_reg);
// Slow path marking the object `ref` when it is gray.
- SlowPathCode* slow_path =
+ SlowPathCodeARM* slow_path =
new (GetGraph()->GetArena()) ReadBarrierMarkSlowPathARM(instruction, ref);
AddSlowPath(slow_path);
@@ -6459,7 +6627,7 @@
// not used by the artReadBarrierSlow entry point.
//
// TODO: Unpoison `ref` when it is used by artReadBarrierSlow.
- SlowPathCode* slow_path = new (GetGraph()->GetArena())
+ SlowPathCodeARM* slow_path = new (GetGraph()->GetArena())
ReadBarrierForHeapReferenceSlowPathARM(instruction, out, ref, obj, offset, index);
AddSlowPath(slow_path);
@@ -6494,7 +6662,7 @@
//
// Note that GC roots are not affected by heap poisoning, so we do
// not need to do anything special for this here.
- SlowPathCode* slow_path =
+ SlowPathCodeARM* slow_path =
new (GetGraph()->GetArena()) ReadBarrierForRootSlowPathARM(instruction, out, root);
AddSlowPath(slow_path);
diff --git a/compiler/optimizing/code_generator_arm.h b/compiler/optimizing/code_generator_arm.h
index 38a2410..424a1a1 100644
--- a/compiler/optimizing/code_generator_arm.h
+++ b/compiler/optimizing/code_generator_arm.h
@@ -50,6 +50,18 @@
static constexpr size_t kRuntimeParameterFpuRegistersLength =
arraysize(kRuntimeParameterFpuRegisters);
+class SlowPathCodeARM : public SlowPathCode {
+ public:
+ explicit SlowPathCodeARM(HInstruction* instruction) : SlowPathCode(instruction) {}
+
+ void SaveLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) FINAL;
+ void RestoreLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) FINAL;
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(SlowPathCodeARM);
+};
+
+
class InvokeRuntimeCallingConvention : public CallingConvention<Register, SRegister> {
public:
InvokeRuntimeCallingConvention()
@@ -216,7 +228,7 @@
// is the block to branch to if the suspend check is not needed, and after
// the suspend call.
void GenerateSuspendCheck(HSuspendCheck* check, HBasicBlock* successor);
- void GenerateClassInitializationCheck(SlowPathCode* slow_path, Register class_reg);
+ void GenerateClassInitializationCheck(SlowPathCodeARM* slow_path, Register class_reg);
void GenerateAndConst(Register out, Register first, uint32_t value);
void GenerateOrrConst(Register out, Register first, uint32_t value);
void GenerateEorConst(Register out, Register first, uint32_t value);
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 599185a..a29e9f3 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -139,18 +139,18 @@
// Calculate memory accessing operand for save/restore live registers.
static void SaveRestoreLiveRegistersHelper(CodeGenerator* codegen,
- RegisterSet* register_set,
+ LocationSummary* locations,
int64_t spill_offset,
bool is_save) {
- DCHECK(ArtVixlRegCodeCoherentForRegSet(register_set->GetCoreRegisters(),
+ const uint32_t core_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ true);
+ const uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
+ DCHECK(ArtVixlRegCodeCoherentForRegSet(core_spills,
codegen->GetNumberOfCoreRegisters(),
- register_set->GetFloatingPointRegisters(),
+ fp_spills,
codegen->GetNumberOfFloatingPointRegisters()));
- CPURegList core_list = CPURegList(CPURegister::kRegister, kXRegSize,
- register_set->GetCoreRegisters() & (~callee_saved_core_registers.GetList()));
- CPURegList fp_list = CPURegList(CPURegister::kFPRegister, kDRegSize,
- register_set->GetFloatingPointRegisters() & (~callee_saved_fp_registers.GetList()));
+ CPURegList core_list = CPURegList(CPURegister::kRegister, kXRegSize, core_spills);
+ CPURegList fp_list = CPURegList(CPURegister::kFPRegister, kDRegSize, fp_spills);
MacroAssembler* masm = down_cast<CodeGeneratorARM64*>(codegen)->GetVIXLAssembler();
UseScratchRegisterScope temps(masm);
@@ -184,38 +184,35 @@
}
void SlowPathCodeARM64::SaveLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) {
- RegisterSet* register_set = locations->GetLiveRegisters();
size_t stack_offset = codegen->GetFirstRegisterSlotInSlowPath();
- for (size_t i = 0, e = codegen->GetNumberOfCoreRegisters(); i < e; ++i) {
- if (!codegen->IsCoreCalleeSaveRegister(i) && register_set->ContainsCoreRegister(i)) {
- // If the register holds an object, update the stack mask.
- if (locations->RegisterContainsObject(i)) {
- locations->SetStackBit(stack_offset / kVRegSize);
- }
- DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
- DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
- saved_core_stack_offsets_[i] = stack_offset;
- stack_offset += kXRegSizeInBytes;
+ const uint32_t core_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ true);
+ for (uint32_t i : LowToHighBits(core_spills)) {
+ // If the register holds an object, update the stack mask.
+ if (locations->RegisterContainsObject(i)) {
+ locations->SetStackBit(stack_offset / kVRegSize);
}
+ DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+ DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
+ saved_core_stack_offsets_[i] = stack_offset;
+ stack_offset += kXRegSizeInBytes;
}
- for (size_t i = 0, e = codegen->GetNumberOfFloatingPointRegisters(); i < e; ++i) {
- if (!codegen->IsFloatingPointCalleeSaveRegister(i) &&
- register_set->ContainsFloatingPointRegister(i)) {
- DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
- DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
- saved_fpu_stack_offsets_[i] = stack_offset;
- stack_offset += kDRegSizeInBytes;
- }
+ const uint32_t fp_spills = codegen->GetSlowPathSpills(locations, /* core_registers */ false);
+ for (uint32_t i : LowToHighBits(fp_spills)) {
+ DCHECK_LT(stack_offset, codegen->GetFrameSize() - codegen->FrameEntrySpillSize());
+ DCHECK_LT(i, kMaximumNumberOfExpectedRegisters);
+ saved_fpu_stack_offsets_[i] = stack_offset;
+ stack_offset += kDRegSizeInBytes;
}
- SaveRestoreLiveRegistersHelper(codegen, register_set,
+ SaveRestoreLiveRegistersHelper(codegen,
+ locations,
codegen->GetFirstRegisterSlotInSlowPath(), true /* is_save */);
}
void SlowPathCodeARM64::RestoreLiveRegisters(CodeGenerator* codegen, LocationSummary* locations) {
- RegisterSet* register_set = locations->GetLiveRegisters();
- SaveRestoreLiveRegistersHelper(codegen, register_set,
+ SaveRestoreLiveRegistersHelper(codegen,
+ locations,
codegen->GetFirstRegisterSlotInSlowPath(), false /* is_save */);
}
@@ -261,10 +258,6 @@
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorARM64* arm64_codegen = down_cast<CodeGeneratorARM64*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
arm64_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -1452,7 +1445,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
GenerateInvokeRuntime(GetThreadOffset<kArm64PointerSize>(entrypoint).Int32Value());
if (EntrypointRequiresStackMap(entrypoint)) {
RecordPcInfo(instruction, dex_pc, slow_path);
@@ -1608,7 +1601,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_field_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
if (Primitive::IsFloatingPointType(instruction->GetType())) {
@@ -2036,7 +2029,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_array_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
@@ -2306,15 +2299,13 @@
}
void LocationsBuilderARM64::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0).GetCode()));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1).GetCode()));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, ARM64EncodableConstantOrRegister(instruction->InputAt(1), instruction));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorARM64::VisitBoundsCheck(HBoundsCheck* instruction) {
@@ -2685,14 +2676,8 @@
}
void LocationsBuilderARM64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorARM64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -2924,7 +2909,7 @@
void LocationsBuilderARM64::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::RequiresRegister());
}
@@ -3077,7 +3062,7 @@
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
if (baker_read_barrier_slow_path) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
@@ -3944,7 +3929,7 @@
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
HLoadClass::LoadKind load_kind = cls->GetLoadKind();
@@ -4384,7 +4369,8 @@
}
void LocationsBuilderARM64::VisitNullCheck(HNullCheck* instruction) {
- codegen_->CreateNullCheckLocations(instruction);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ locations->SetInAt(0, Location::RequiresRegister());
}
void CodeGeneratorARM64::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -4670,7 +4656,7 @@
void LocationsBuilderARM64::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorARM64::VisitSuspendCheck(HSuspendCheck* instruction) {
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index b767aa5..2211ea3 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -194,10 +194,6 @@
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorMIPS* mips_codegen = down_cast<CodeGeneratorMIPS*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
mips_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -905,7 +901,7 @@
} else {
DCHECK(destination.IsStackSlot())
<< "Cannot move " << c->DebugName() << " to " << destination;
- __ StoreConst32ToOffset(value, SP, destination.GetStackIndex(), TMP);
+ __ StoreConstToOffset(kStoreWord, value, SP, destination.GetStackIndex(), TMP);
}
} else if (c->IsLongConstant()) {
// Move 64 bit constant.
@@ -917,7 +913,7 @@
} else {
DCHECK(destination.IsDoubleStackSlot())
<< "Cannot move " << c->DebugName() << " to " << destination;
- __ StoreConst64ToOffset(value, SP, destination.GetStackIndex(), TMP);
+ __ StoreConstToOffset(kStoreDoubleword, value, SP, destination.GetStackIndex(), TMP);
}
} else if (c->IsFloatConstant()) {
// Move 32 bit float constant.
@@ -927,7 +923,7 @@
} else {
DCHECK(destination.IsStackSlot())
<< "Cannot move " << c->DebugName() << " to " << destination;
- __ StoreConst32ToOffset(value, SP, destination.GetStackIndex(), TMP);
+ __ StoreConstToOffset(kStoreWord, value, SP, destination.GetStackIndex(), TMP);
}
} else {
// Move 64 bit double constant.
@@ -939,7 +935,7 @@
} else {
DCHECK(destination.IsDoubleStackSlot())
<< "Cannot move " << c->DebugName() << " to " << destination;
- __ StoreConst64ToOffset(value, SP, destination.GetStackIndex(), TMP);
+ __ StoreConstToOffset(kStoreDoubleword, value, SP, destination.GetStackIndex(), TMP);
}
}
}
@@ -1224,7 +1220,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
bool reordering = __ SetReorder(false);
__ LoadFromOffset(kLoadWord, T9, TR, GetThreadOffset<kMipsPointerSize>(entrypoint).Int32Value());
__ Jalr(T9);
@@ -1960,6 +1956,25 @@
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
+Location LocationsBuilderMIPS::RegisterOrZeroConstant(HInstruction* instruction) {
+ return (instruction->IsConstant() && instruction->AsConstant()->IsZeroBitPattern())
+ ? Location::ConstantLocation(instruction->AsConstant())
+ : Location::RequiresRegister();
+}
+
+Location LocationsBuilderMIPS::FpuRegisterOrConstantForStore(HInstruction* instruction) {
+ // We can store 0.0 directly (from the ZERO register) without loading it into an FPU register.
+ // We can store a non-zero float or double constant without first loading it into the FPU,
+ // but we should only prefer this if the constant has a single use.
+ if (instruction->IsConstant() &&
+ (instruction->AsConstant()->IsZeroBitPattern() ||
+ instruction->GetUses().HasExactlyOneElement())) {
+ return Location::ConstantLocation(instruction->AsConstant());
+ // Otherwise fall through and require an FPU register for the constant.
+ }
+ return Location::RequiresFpuRegister();
+}
+
void LocationsBuilderMIPS::VisitArraySet(HArraySet* instruction) {
bool needs_runtime_call = instruction->NeedsTypeCheck();
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(
@@ -1974,9 +1989,9 @@
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
if (Primitive::IsFloatingPointType(instruction->InputAt(2)->GetType())) {
- locations->SetInAt(2, Location::RequiresFpuRegister());
+ locations->SetInAt(2, FpuRegisterOrConstantForStore(instruction->InputAt(2)));
} else {
- locations->SetInAt(2, Location::RequiresRegister());
+ locations->SetInAt(2, RegisterOrZeroConstant(instruction->InputAt(2)));
}
}
}
@@ -1985,24 +2000,29 @@
LocationSummary* locations = instruction->GetLocations();
Register obj = locations->InAt(0).AsRegister<Register>();
Location index = locations->InAt(1);
+ Location value_location = locations->InAt(2);
Primitive::Type value_type = instruction->GetComponentType();
bool needs_runtime_call = locations->WillCall();
bool needs_write_barrier =
CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
auto null_checker = GetImplicitNullChecker(instruction);
+ Register base_reg = index.IsConstant() ? obj : TMP;
switch (value_type) {
case Primitive::kPrimBoolean:
case Primitive::kPrimByte: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
- Register value = locations->InAt(2).AsRegister<Register>();
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + data_offset;
- __ StoreToOffset(kStoreByte, value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1;
} else {
- __ Addu(TMP, obj, index.AsRegister<Register>());
- __ StoreToOffset(kStoreByte, value, TMP, data_offset, null_checker);
+ __ Addu(base_reg, obj, index.AsRegister<Register>());
+ }
+ if (value_location.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreByte, value, base_reg, data_offset, TMP, null_checker);
+ } else {
+ Register value = value_location.AsRegister<Register>();
+ __ StoreToOffset(kStoreByte, value, base_reg, data_offset, null_checker);
}
break;
}
@@ -2010,15 +2030,18 @@
case Primitive::kPrimShort:
case Primitive::kPrimChar: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
- Register value = locations->InAt(2).AsRegister<Register>();
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + data_offset;
- __ StoreToOffset(kStoreHalfword, value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2;
} else {
- __ Sll(TMP, index.AsRegister<Register>(), TIMES_2);
- __ Addu(TMP, obj, TMP);
- __ StoreToOffset(kStoreHalfword, value, TMP, data_offset, null_checker);
+ __ Sll(base_reg, index.AsRegister<Register>(), TIMES_2);
+ __ Addu(base_reg, obj, base_reg);
+ }
+ if (value_location.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreHalfword, value, base_reg, data_offset, TMP, null_checker);
+ } else {
+ Register value = value_location.AsRegister<Register>();
+ __ StoreToOffset(kStoreHalfword, value, base_reg, data_offset, null_checker);
}
break;
}
@@ -2027,20 +2050,23 @@
case Primitive::kPrimNot: {
if (!needs_runtime_call) {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
- Register value = locations->InAt(2).AsRegister<Register>();
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
- __ StoreToOffset(kStoreWord, value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
} else {
- DCHECK(index.IsRegister()) << index;
- __ Sll(TMP, index.AsRegister<Register>(), TIMES_4);
- __ Addu(TMP, obj, TMP);
- __ StoreToOffset(kStoreWord, value, TMP, data_offset, null_checker);
+ __ Sll(base_reg, index.AsRegister<Register>(), TIMES_4);
+ __ Addu(base_reg, obj, base_reg);
}
- if (needs_write_barrier) {
- DCHECK_EQ(value_type, Primitive::kPrimNot);
- codegen_->MarkGCCard(obj, value);
+ if (value_location.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreWord, value, base_reg, data_offset, TMP, null_checker);
+ DCHECK(!needs_write_barrier);
+ } else {
+ Register value = value_location.AsRegister<Register>();
+ __ StoreToOffset(kStoreWord, value, base_reg, data_offset, null_checker);
+ if (needs_write_barrier) {
+ DCHECK_EQ(value_type, Primitive::kPrimNot);
+ codegen_->MarkGCCard(obj, value);
+ }
}
} else {
DCHECK_EQ(value_type, Primitive::kPrimNot);
@@ -2052,47 +2078,54 @@
case Primitive::kPrimLong: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
- Register value = locations->InAt(2).AsRegisterPairLow<Register>();
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
- __ StoreToOffset(kStoreDoubleword, value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
} else {
- __ Sll(TMP, index.AsRegister<Register>(), TIMES_8);
- __ Addu(TMP, obj, TMP);
- __ StoreToOffset(kStoreDoubleword, value, TMP, data_offset, null_checker);
+ __ Sll(base_reg, index.AsRegister<Register>(), TIMES_8);
+ __ Addu(base_reg, obj, base_reg);
+ }
+ if (value_location.IsConstant()) {
+ int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreDoubleword, value, base_reg, data_offset, TMP, null_checker);
+ } else {
+ Register value = value_location.AsRegisterPairLow<Register>();
+ __ StoreToOffset(kStoreDoubleword, value, base_reg, data_offset, null_checker);
}
break;
}
case Primitive::kPrimFloat: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
- FRegister value = locations->InAt(2).AsFpuRegister<FRegister>();
- DCHECK(locations->InAt(2).IsFpuRegister());
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
- __ StoreSToOffset(value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
} else {
- __ Sll(TMP, index.AsRegister<Register>(), TIMES_4);
- __ Addu(TMP, obj, TMP);
- __ StoreSToOffset(value, TMP, data_offset, null_checker);
+ __ Sll(base_reg, index.AsRegister<Register>(), TIMES_4);
+ __ Addu(base_reg, obj, base_reg);
+ }
+ if (value_location.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreWord, value, base_reg, data_offset, TMP, null_checker);
+ } else {
+ FRegister value = value_location.AsFpuRegister<FRegister>();
+ __ StoreSToOffset(value, base_reg, data_offset, null_checker);
}
break;
}
case Primitive::kPrimDouble: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
- FRegister value = locations->InAt(2).AsFpuRegister<FRegister>();
- DCHECK(locations->InAt(2).IsFpuRegister());
if (index.IsConstant()) {
- size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
- __ StoreDToOffset(value, obj, offset, null_checker);
+ data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
} else {
- __ Sll(TMP, index.AsRegister<Register>(), TIMES_8);
- __ Addu(TMP, obj, TMP);
- __ StoreDToOffset(value, TMP, data_offset, null_checker);
+ __ Sll(base_reg, index.AsRegister<Register>(), TIMES_8);
+ __ Addu(base_reg, obj, base_reg);
+ }
+ if (value_location.IsConstant()) {
+ int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(kStoreDoubleword, value, base_reg, data_offset, TMP, null_checker);
+ } else {
+ FRegister value = value_location.AsFpuRegister<FRegister>();
+ __ StoreDToOffset(value, base_reg, data_offset, null_checker);
}
break;
}
@@ -2104,15 +2137,13 @@
}
void LocationsBuilderMIPS::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorMIPS::VisitBoundsCheck(HBoundsCheck* instruction) {
@@ -2627,14 +2658,8 @@
}
void LocationsBuilderMIPS::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorMIPS::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -3688,7 +3713,7 @@
void LocationsBuilderMIPS::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::RequiresRegister());
}
@@ -3888,9 +3913,9 @@
}
} else {
if (Primitive::IsFloatingPointType(field_type)) {
- locations->SetInAt(1, Location::RequiresFpuRegister());
+ locations->SetInAt(1, FpuRegisterOrConstantForStore(instruction->InputAt(1)));
} else {
- locations->SetInAt(1, Location::RequiresRegister());
+ locations->SetInAt(1, RegisterOrZeroConstant(instruction->InputAt(1)));
}
}
}
@@ -3901,6 +3926,7 @@
Primitive::Type type = field_info.GetFieldType();
LocationSummary* locations = instruction->GetLocations();
Register obj = locations->InAt(0).AsRegister<Register>();
+ Location value_location = locations->InAt(1);
StoreOperandType store_type = kStoreByte;
bool is_volatile = field_info.IsVolatile();
uint32_t offset = field_info.GetFieldOffset().Uint32Value();
@@ -3941,24 +3967,24 @@
codegen_->RecordPcInfo(instruction, instruction->GetDexPc());
if (type == Primitive::kPrimDouble) {
// Pass FP parameters in core registers.
- Location in = locations->InAt(1);
- if (in.IsFpuRegister()) {
- __ Mfc1(locations->GetTemp(1).AsRegister<Register>(), in.AsFpuRegister<FRegister>());
+ if (value_location.IsFpuRegister()) {
+ __ Mfc1(locations->GetTemp(1).AsRegister<Register>(),
+ value_location.AsFpuRegister<FRegister>());
__ MoveFromFpuHigh(locations->GetTemp(2).AsRegister<Register>(),
- in.AsFpuRegister<FRegister>());
- } else if (in.IsDoubleStackSlot()) {
+ value_location.AsFpuRegister<FRegister>());
+ } else if (value_location.IsDoubleStackSlot()) {
__ LoadFromOffset(kLoadWord,
locations->GetTemp(1).AsRegister<Register>(),
SP,
- in.GetStackIndex());
+ value_location.GetStackIndex());
__ LoadFromOffset(kLoadWord,
locations->GetTemp(2).AsRegister<Register>(),
SP,
- in.GetStackIndex() + 4);
+ value_location.GetStackIndex() + 4);
} else {
- DCHECK(in.IsConstant());
- DCHECK(in.GetConstant()->IsDoubleConstant());
- int64_t value = bit_cast<int64_t, double>(in.GetConstant()->AsDoubleConstant()->GetValue());
+ DCHECK(value_location.IsConstant());
+ DCHECK(value_location.GetConstant()->IsDoubleConstant());
+ int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
__ LoadConst64(locations->GetTemp(2).AsRegister<Register>(),
locations->GetTemp(1).AsRegister<Register>(),
value);
@@ -3967,19 +3993,19 @@
codegen_->InvokeRuntime(kQuickA64Store, instruction, dex_pc);
CheckEntrypointTypes<kQuickA64Store, void, volatile int64_t *, int64_t>();
} else {
- if (!Primitive::IsFloatingPointType(type)) {
+ if (value_location.IsConstant()) {
+ int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
+ __ StoreConstToOffset(store_type, value, obj, offset, TMP, null_checker);
+ } else if (!Primitive::IsFloatingPointType(type)) {
Register src;
if (type == Primitive::kPrimLong) {
- DCHECK(locations->InAt(1).IsRegisterPair());
- src = locations->InAt(1).AsRegisterPairLow<Register>();
+ src = value_location.AsRegisterPairLow<Register>();
} else {
- DCHECK(locations->InAt(1).IsRegister());
- src = locations->InAt(1).AsRegister<Register>();
+ src = value_location.AsRegister<Register>();
}
__ StoreToOffset(store_type, src, obj, offset, null_checker);
} else {
- DCHECK(locations->InAt(1).IsFpuRegister());
- FRegister src = locations->InAt(1).AsFpuRegister<FRegister>();
+ FRegister src = value_location.AsFpuRegister<FRegister>();
if (type == Primitive::kPrimFloat) {
__ StoreSToOffset(src, obj, offset, null_checker);
} else {
@@ -3990,8 +4016,7 @@
// TODO: memory barriers?
if (CodeGenerator::StoreNeedsWriteBarrier(type, instruction->InputAt(1))) {
- DCHECK(locations->InAt(1).IsRegister());
- Register src = locations->InAt(1).AsRegister<Register>();
+ Register src = value_location.AsRegister<Register>();
codegen_->MarkGCCard(obj, src);
}
@@ -5075,7 +5100,8 @@
}
void LocationsBuilderMIPS::VisitNullCheck(HNullCheck* instruction) {
- codegen_->CreateNullCheckLocations(instruction);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ locations->SetInAt(0, Location::RequiresRegister());
}
void CodeGeneratorMIPS::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -5369,7 +5395,7 @@
void LocationsBuilderMIPS::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorMIPS::VisitSuspendCheck(HSuspendCheck* instruction) {
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index a42374f..553a7e6 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -191,6 +191,8 @@
void HandleShift(HBinaryOperation* operation);
void HandleFieldSet(HInstruction* instruction, const FieldInfo& field_info);
void HandleFieldGet(HInstruction* instruction, const FieldInfo& field_info);
+ Location RegisterOrZeroConstant(HInstruction* instruction);
+ Location FpuRegisterOrConstantForStore(HInstruction* instruction);
InvokeDexCallingConventionVisitorMIPS parameter_visitor_;
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 4d87523..5039fad 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -150,10 +150,6 @@
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorMIPS64* mips64_codegen = down_cast<CodeGeneratorMIPS64*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
mips64_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -946,7 +942,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
// TODO: anything related to T9/GP/GOT/PIC/.so's?
__ LoadFromOffset(kLoadDoubleword,
T9,
@@ -1558,15 +1554,13 @@
}
void LocationsBuilderMIPS64::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorMIPS64::VisitBoundsCheck(HBoundsCheck* instruction) {
@@ -2110,14 +2104,8 @@
}
void LocationsBuilderMIPS64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorMIPS64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -2630,7 +2618,7 @@
void LocationsBuilderMIPS64::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::RequiresRegister());
}
@@ -3461,7 +3449,8 @@
}
void LocationsBuilderMIPS64::VisitNullCheck(HNullCheck* instruction) {
- codegen_->CreateNullCheckLocations(instruction);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ locations->SetInAt(0, Location::RequiresRegister());
}
void CodeGeneratorMIPS64::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -3741,7 +3730,7 @@
void LocationsBuilderMIPS64::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorMIPS64::VisitSuspendCheck(HSuspendCheck* instruction) {
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index 28db29c..cc9fe83 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -84,10 +84,6 @@
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorX86* x86_codegen = down_cast<CodeGeneratorX86*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
x86_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -754,7 +750,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
GenerateInvokeRuntime(GetThreadOffset<kX86PointerSize>(entrypoint).Int32Value());
if (EntrypointRequiresStackMap(entrypoint)) {
RecordPcInfo(instruction, dex_pc, slow_path);
@@ -1069,15 +1065,11 @@
__ movsd(Address(ESP, destination.GetStackIndex()), source.AsFpuRegister<XmmRegister>());
} else if (source.IsConstant()) {
HConstant* constant = source.GetConstant();
- int64_t value;
- if (constant->IsLongConstant()) {
- value = constant->AsLongConstant()->GetValue();
- } else {
- DCHECK(constant->IsDoubleConstant());
- value = bit_cast<int64_t, double>(constant->AsDoubleConstant()->GetValue());
- }
+ DCHECK(constant->IsLongConstant() || constant->IsDoubleConstant());
+ int64_t value = GetInt64ValueOf(constant);
__ movl(Address(ESP, destination.GetStackIndex()), Immediate(Low32Bits(value)));
- __ movl(Address(ESP, destination.GetHighStackIndex(kX86WordSize)), Immediate(High32Bits(value)));
+ __ movl(Address(ESP, destination.GetHighStackIndex(kX86WordSize)),
+ Immediate(High32Bits(value)));
} else {
DCHECK(source.IsDoubleStackSlot()) << source;
EmitParallelMoves(
@@ -1427,14 +1419,7 @@
Location lhs = condition->GetLocations()->InAt(0);
Location rhs = condition->GetLocations()->InAt(1);
// LHS is guaranteed to be in a register (see LocationsBuilderX86::HandleCondition).
- if (rhs.IsRegister()) {
- __ cmpl(lhs.AsRegister<Register>(), rhs.AsRegister<Register>());
- } else if (rhs.IsConstant()) {
- int32_t constant = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
- codegen_->Compare32BitValue(lhs.AsRegister<Register>(), constant);
- } else {
- __ cmpl(lhs.AsRegister<Register>(), Address(ESP, rhs.GetStackIndex()));
- }
+ codegen_->GenerateIntCompare(lhs, rhs);
if (true_target == nullptr) {
__ j(X86Condition(condition->GetOppositeCondition()), false_target);
} else {
@@ -1469,7 +1454,7 @@
void LocationsBuilderX86::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::Any());
}
@@ -1528,18 +1513,6 @@
locations->SetOut(Location::SameAsFirstInput());
}
-void CodeGeneratorX86::GenerateIntCompare(Location lhs, Location rhs) {
- Register lhs_reg = lhs.AsRegister<Register>();
- if (rhs.IsConstant()) {
- int32_t value = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
- Compare32BitValue(lhs_reg, value);
- } else if (rhs.IsStackSlot()) {
- assembler_.cmpl(lhs_reg, Address(ESP, rhs.GetStackIndex()));
- } else {
- assembler_.cmpl(lhs_reg, rhs.AsRegister<Register>());
- }
-}
-
void InstructionCodeGeneratorX86::VisitSelect(HSelect* select) {
LocationSummary* locations = select->GetLocations();
DCHECK(locations->InAt(0).Equals(locations->Out()));
@@ -3571,10 +3544,7 @@
}
void LocationsBuilderX86::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
switch (instruction->GetType()) {
case Primitive::kPrimBoolean:
case Primitive::kPrimByte:
@@ -3594,9 +3564,6 @@
default:
LOG(FATAL) << "Unexpected type for HDivZeroCheck " << instruction->GetType();
}
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorX86::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -3621,7 +3588,7 @@
} else {
DCHECK(value.IsConstant()) << value;
if (value.GetConstant()->AsIntConstant()->GetValue() == 0) {
- __ jmp(slow_path->GetEntryLabel());
+ __ jmp(slow_path->GetEntryLabel());
}
}
break;
@@ -4540,7 +4507,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_field_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
@@ -4950,11 +4917,11 @@
}
void LocationsBuilderX86::VisitNullCheck(HNullCheck* instruction) {
- LocationSummary* locations = codegen_->CreateNullCheckLocations(instruction);
- if (!codegen_->GetCompilerOptions().GetImplicitNullChecks()) {
- // Explicit null checks can use any location.
- locations->SetInAt(0, Location::Any());
- }
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ Location loc = codegen_->GetCompilerOptions().GetImplicitNullChecks()
+ ? Location::RequiresRegister()
+ : Location::Any();
+ locations->SetInAt(0, loc);
}
void CodeGeneratorX86::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -5001,7 +4968,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_array_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
@@ -5033,56 +5000,31 @@
switch (type) {
case Primitive::kPrimBoolean: {
Register out = out_loc.AsRegister<Register>();
- if (index.IsConstant()) {
- __ movzxb(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + data_offset));
- } else {
- __ movzxb(out, Address(obj, index.AsRegister<Register>(), TIMES_1, data_offset));
- }
+ __ movzxb(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_1, data_offset));
break;
}
case Primitive::kPrimByte: {
Register out = out_loc.AsRegister<Register>();
- if (index.IsConstant()) {
- __ movsxb(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + data_offset));
- } else {
- __ movsxb(out, Address(obj, index.AsRegister<Register>(), TIMES_1, data_offset));
- }
+ __ movsxb(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_1, data_offset));
break;
}
case Primitive::kPrimShort: {
Register out = out_loc.AsRegister<Register>();
- if (index.IsConstant()) {
- __ movsxw(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + data_offset));
- } else {
- __ movsxw(out, Address(obj, index.AsRegister<Register>(), TIMES_2, data_offset));
- }
+ __ movsxw(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_2, data_offset));
break;
}
case Primitive::kPrimChar: {
Register out = out_loc.AsRegister<Register>();
- if (index.IsConstant()) {
- __ movzxw(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + data_offset));
- } else {
- __ movzxw(out, Address(obj, index.AsRegister<Register>(), TIMES_2, data_offset));
- }
+ __ movzxw(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_2, data_offset));
break;
}
case Primitive::kPrimInt: {
Register out = out_loc.AsRegister<Register>();
- if (index.IsConstant()) {
- __ movl(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset));
- } else {
- __ movl(out, Address(obj, index.AsRegister<Register>(), TIMES_4, data_offset));
- }
+ __ movl(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset));
break;
}
@@ -5099,21 +5041,16 @@
instruction, out_loc, obj, data_offset, index, /* needs_null_check */ true);
} else {
Register out = out_loc.AsRegister<Register>();
+ __ movl(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ // If read barriers are enabled, emit read barriers other than
+ // Baker's using a slow path (and also unpoison the loaded
+ // reference, if heap poisoning is enabled).
if (index.IsConstant()) {
uint32_t offset =
(index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
- __ movl(out, Address(obj, offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- // If read barriers are enabled, emit read barriers other than
- // Baker's using a slow path (and also unpoison the loaded
- // reference, if heap poisoning is enabled).
codegen_->MaybeGenerateReadBarrierSlow(instruction, out_loc, out_loc, obj_loc, offset);
} else {
- __ movl(out, Address(obj, index.AsRegister<Register>(), TIMES_4, data_offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- // If read barriers are enabled, emit read barriers other than
- // Baker's using a slow path (and also unpoison the loaded
- // reference, if heap poisoning is enabled).
codegen_->MaybeGenerateReadBarrierSlow(
instruction, out_loc, out_loc, obj_loc, data_offset, index);
}
@@ -5123,40 +5060,23 @@
case Primitive::kPrimLong: {
DCHECK_NE(obj, out_loc.AsRegisterPairLow<Register>());
- if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
- __ movl(out_loc.AsRegisterPairLow<Register>(), Address(obj, offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(out_loc.AsRegisterPairHigh<Register>(), Address(obj, offset + kX86WordSize));
- } else {
- __ movl(out_loc.AsRegisterPairLow<Register>(),
- Address(obj, index.AsRegister<Register>(), TIMES_8, data_offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(out_loc.AsRegisterPairHigh<Register>(),
- Address(obj, index.AsRegister<Register>(), TIMES_8, data_offset + kX86WordSize));
- }
+ __ movl(out_loc.AsRegisterPairLow<Register>(),
+ CodeGeneratorX86::ArrayAddress(obj, index, TIMES_8, data_offset));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ __ movl(out_loc.AsRegisterPairHigh<Register>(),
+ CodeGeneratorX86::ArrayAddress(obj, index, TIMES_8, data_offset + kX86WordSize));
break;
}
case Primitive::kPrimFloat: {
XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
- if (index.IsConstant()) {
- __ movss(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset));
- } else {
- __ movss(out, Address(obj, index.AsRegister<Register>(), TIMES_4, data_offset));
- }
+ __ movss(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset));
break;
}
case Primitive::kPrimDouble: {
XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
- if (index.IsConstant()) {
- __ movsd(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset));
- } else {
- __ movsd(out, Address(obj, index.AsRegister<Register>(), TIMES_8, data_offset));
- }
+ __ movsd(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_8, data_offset));
break;
}
@@ -5227,9 +5147,7 @@
case Primitive::kPrimBoolean:
case Primitive::kPrimByte: {
uint32_t offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_1, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_1, offset);
if (value.IsRegister()) {
__ movb(address, value.AsRegister<ByteRegister>());
} else {
@@ -5242,9 +5160,7 @@
case Primitive::kPrimShort:
case Primitive::kPrimChar: {
uint32_t offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_2, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_2, offset);
if (value.IsRegister()) {
__ movw(address, value.AsRegister<Register>());
} else {
@@ -5256,9 +5172,7 @@
case Primitive::kPrimNot: {
uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
if (!value.IsRegister()) {
// Just setting null.
@@ -5354,9 +5268,7 @@
case Primitive::kPrimInt: {
uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
if (value.IsRegister()) {
__ movl(address, value.AsRegister<Register>());
} else {
@@ -5370,44 +5282,27 @@
case Primitive::kPrimLong: {
uint32_t data_offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
- if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
- if (value.IsRegisterPair()) {
- __ movl(Address(array, offset), value.AsRegisterPairLow<Register>());
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(Address(array, offset + kX86WordSize), value.AsRegisterPairHigh<Register>());
- } else {
- DCHECK(value.IsConstant());
- int64_t val = value.GetConstant()->AsLongConstant()->GetValue();
- __ movl(Address(array, offset), Immediate(Low32Bits(val)));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(Address(array, offset + kX86WordSize), Immediate(High32Bits(val)));
- }
+ if (value.IsRegisterPair()) {
+ __ movl(CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, data_offset),
+ value.AsRegisterPairLow<Register>());
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ __ movl(CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, data_offset + kX86WordSize),
+ value.AsRegisterPairHigh<Register>());
} else {
- if (value.IsRegisterPair()) {
- __ movl(Address(array, index.AsRegister<Register>(), TIMES_8, data_offset),
- value.AsRegisterPairLow<Register>());
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(Address(array, index.AsRegister<Register>(), TIMES_8, data_offset + kX86WordSize),
- value.AsRegisterPairHigh<Register>());
- } else {
- DCHECK(value.IsConstant());
- int64_t val = value.GetConstant()->AsLongConstant()->GetValue();
- __ movl(Address(array, index.AsRegister<Register>(), TIMES_8, data_offset),
- Immediate(Low32Bits(val)));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ movl(Address(array, index.AsRegister<Register>(), TIMES_8, data_offset + kX86WordSize),
- Immediate(High32Bits(val)));
- }
+ DCHECK(value.IsConstant());
+ int64_t val = value.GetConstant()->AsLongConstant()->GetValue();
+ __ movl(CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, data_offset),
+ Immediate(Low32Bits(val)));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ __ movl(CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, data_offset + kX86WordSize),
+ Immediate(High32Bits(val)));
}
break;
}
case Primitive::kPrimFloat: {
uint32_t offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
if (value.IsFpuRegister()) {
__ movss(address, value.AsFpuRegister<XmmRegister>());
} else {
@@ -5421,17 +5316,13 @@
case Primitive::kPrimDouble: {
uint32_t offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + offset)
- : Address(array, index.AsRegister<Register>(), TIMES_8, offset);
+ Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, offset);
if (value.IsFpuRegister()) {
__ movsd(address, value.AsFpuRegister<XmmRegister>());
} else {
DCHECK(value.IsConstant());
- Address address_hi = index.IsConstant() ?
- Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) +
- offset + kX86WordSize) :
- Address(array, index.AsRegister<Register>(), TIMES_8, offset + kX86WordSize);
+ Address address_hi =
+ CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, offset + kX86WordSize);
int64_t v = bit_cast<int64_t, double>(value.GetConstant()->AsDoubleConstant()->GetValue());
__ movl(address, Immediate(Low32Bits(v)));
codegen_->MaybeRecordImplicitNullCheck(instruction);
@@ -5468,18 +5359,16 @@
}
void LocationsBuilderX86::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
HInstruction* length = instruction->InputAt(1);
if (!length->IsEmittedAtUseSite()) {
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
}
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorX86::VisitBoundsCheck(HBoundsCheck* instruction) {
@@ -5525,13 +5414,7 @@
}
codegen_->MaybeRecordImplicitNullCheck(array_length);
} else {
- Register length = length_loc.AsRegister<Register>();
- if (index_loc.IsConstant()) {
- int32_t value = CodeGenerator::GetInt32ValueOf(index_loc.GetConstant());
- __ cmpl(length, Immediate(value));
- } else {
- __ cmpl(length, index_loc.AsRegister<Register>());
- }
+ codegen_->GenerateIntCompare(length_loc, index_loc);
}
codegen_->AddSlowPath(slow_path);
__ j(kBelowEqual, slow_path->GetEntryLabel());
@@ -5549,7 +5432,7 @@
void LocationsBuilderX86::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorX86::VisitSuspendCheck(HSuspendCheck* instruction) {
@@ -5907,7 +5790,7 @@
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
HLoadClass::LoadKind load_kind = cls->GetLoadKind();
@@ -6204,7 +6087,7 @@
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
if (baker_read_barrier_slow_path) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::Any());
@@ -6909,9 +6792,7 @@
"art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
// /* HeapReference<Object> */ ref =
// *(obj + data_offset + index * sizeof(HeapReference<Object>))
- Address src = index.IsConstant() ?
- Address(obj, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset) :
- Address(obj, index.AsRegister<Register>(), TIMES_4, data_offset);
+ Address src = CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset);
GenerateReferenceLoadWithBakerReadBarrier(instruction, ref, obj, src, needs_null_check);
}
@@ -7392,6 +7273,27 @@
}
}
+void CodeGeneratorX86::GenerateIntCompare(Location lhs, Location rhs) {
+ Register lhs_reg = lhs.AsRegister<Register>();
+ if (rhs.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
+ Compare32BitValue(lhs_reg, value);
+ } else if (rhs.IsStackSlot()) {
+ __ cmpl(lhs_reg, Address(ESP, rhs.GetStackIndex()));
+ } else {
+ __ cmpl(lhs_reg, rhs.AsRegister<Register>());
+ }
+}
+
+Address CodeGeneratorX86::ArrayAddress(Register obj,
+ Location index,
+ ScaleFactor scale,
+ uint32_t data_offset) {
+ return index.IsConstant() ?
+ Address(obj, (index.GetConstant()->AsIntConstant()->GetValue() << scale) + data_offset) :
+ Address(obj, index.AsRegister<Register>(), scale, data_offset);
+}
+
Address CodeGeneratorX86::LiteralCaseTable(HX86PackedSwitch* switch_instr,
Register reg,
Register value) {
diff --git a/compiler/optimizing/code_generator_x86.h b/compiler/optimizing/code_generator_x86.h
index 04a0a3d..5866e65 100644
--- a/compiler/optimizing/code_generator_x86.h
+++ b/compiler/optimizing/code_generator_x86.h
@@ -427,8 +427,6 @@
Register value,
bool value_can_be_null);
- void GenerateIntCompare(Location lhs, Location rhs);
-
void GenerateMemoryBarrier(MemBarrierKind kind);
Label* GetLabelOf(HBasicBlock* block) const {
@@ -474,6 +472,15 @@
// Compare a register with a 32-bit value in the most efficient manner.
void Compare32BitValue(Register dest, int32_t value);
+ // Compare int values. Supports only register locations for `lhs`.
+ void GenerateIntCompare(Location lhs, Location rhs);
+
+ // Construct address for array access.
+ static Address ArrayAddress(Register obj,
+ Location index,
+ ScaleFactor scale,
+ uint32_t data_offset);
+
Address LiteralCaseTable(HX86PackedSwitch* switch_instr, Register reg, Register value);
void Finalize(CodeAllocator* allocator) OVERRIDE;
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 88d98fc..1d87bf6 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -88,10 +88,6 @@
void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
CodeGeneratorX86_64* x86_64_codegen = down_cast<CodeGeneratorX86_64*>(codegen);
__ Bind(GetEntryLabel());
- if (instruction_->CanThrowIntoCatchBlock()) {
- // Live registers will be restored in the catch block if caught.
- SaveLiveRegisters(codegen, instruction_->GetLocations());
- }
x86_64_codegen->InvokeRuntime(kQuickThrowDivZero, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickThrowDivZero, void, void>();
}
@@ -981,7 +977,7 @@
HInstruction* instruction,
uint32_t dex_pc,
SlowPathCode* slow_path) {
- ValidateInvokeRuntime(instruction, slow_path);
+ ValidateInvokeRuntime(entrypoint, instruction, slow_path);
GenerateInvokeRuntime(GetThreadOffset<kX86_64PointerSize>(entrypoint).Int32Value());
if (EntrypointRequiresStackMap(entrypoint)) {
RecordPcInfo(instruction, dex_pc, slow_path);
@@ -1204,13 +1200,8 @@
source.AsFpuRegister<XmmRegister>());
} else if (source.IsConstant()) {
HConstant* constant = source.GetConstant();
- int64_t value;
- if (constant->IsDoubleConstant()) {
- value = bit_cast<int64_t, double>(constant->AsDoubleConstant()->GetValue());
- } else {
- DCHECK(constant->IsLongConstant());
- value = constant->AsLongConstant()->GetValue();
- }
+ DCHECK(constant->IsLongConstant() || constant->IsDoubleConstant());
+ int64_t value = GetInt64ValueOf(constant);
Store64BitValueToStack(destination, value);
} else {
DCHECK(source.IsDoubleStackSlot());
@@ -1309,31 +1300,11 @@
case Primitive::kPrimShort:
case Primitive::kPrimInt:
case Primitive::kPrimNot: {
- CpuRegister left_reg = left.AsRegister<CpuRegister>();
- if (right.IsConstant()) {
- int32_t value = CodeGenerator::GetInt32ValueOf(right.GetConstant());
- if (value == 0) {
- __ testl(left_reg, left_reg);
- } else {
- __ cmpl(left_reg, Immediate(value));
- }
- } else if (right.IsStackSlot()) {
- __ cmpl(left_reg, Address(CpuRegister(RSP), right.GetStackIndex()));
- } else {
- __ cmpl(left_reg, right.AsRegister<CpuRegister>());
- }
+ codegen_->GenerateIntCompare(left, right);
break;
}
case Primitive::kPrimLong: {
- CpuRegister left_reg = left.AsRegister<CpuRegister>();
- if (right.IsConstant()) {
- int64_t value = right.GetConstant()->AsLongConstant()->GetValue();
- codegen_->Compare64BitValue(left_reg, value);
- } else if (right.IsDoubleStackSlot()) {
- __ cmpq(left_reg, Address(CpuRegister(RSP), right.GetStackIndex()));
- } else {
- __ cmpq(left_reg, right.AsRegister<CpuRegister>());
- }
+ codegen_->GenerateLongCompare(left, right);
break;
}
case Primitive::kPrimFloat: {
@@ -1488,15 +1459,7 @@
Location lhs = condition->GetLocations()->InAt(0);
Location rhs = condition->GetLocations()->InAt(1);
- if (rhs.IsRegister()) {
- __ cmpl(lhs.AsRegister<CpuRegister>(), rhs.AsRegister<CpuRegister>());
- } else if (rhs.IsConstant()) {
- int32_t constant = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
- codegen_->Compare32BitValue(lhs.AsRegister<CpuRegister>(), constant);
- } else {
- __ cmpl(lhs.AsRegister<CpuRegister>(),
- Address(CpuRegister(RSP), rhs.GetStackIndex()));
- }
+ codegen_->GenerateIntCompare(lhs, rhs);
if (true_target == nullptr) {
__ j(X86_64IntegerCondition(condition->GetOppositeCondition()), false_target);
} else {
@@ -1531,7 +1494,7 @@
void LocationsBuilderX86_64::VisitDeoptimize(HDeoptimize* deoptimize) {
LocationSummary* locations = new (GetGraph()->GetArena())
LocationSummary(deoptimize, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
if (IsBooleanValueOrMaterializedCondition(deoptimize->InputAt(0))) {
locations->SetInAt(0, Location::Any());
}
@@ -1696,28 +1659,14 @@
// Clear output register: setcc only sets the low byte.
__ xorl(reg, reg);
- if (rhs.IsRegister()) {
- __ cmpl(lhs.AsRegister<CpuRegister>(), rhs.AsRegister<CpuRegister>());
- } else if (rhs.IsConstant()) {
- int32_t constant = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
- codegen_->Compare32BitValue(lhs.AsRegister<CpuRegister>(), constant);
- } else {
- __ cmpl(lhs.AsRegister<CpuRegister>(), Address(CpuRegister(RSP), rhs.GetStackIndex()));
- }
+ codegen_->GenerateIntCompare(lhs, rhs);
__ setcc(X86_64IntegerCondition(cond->GetCondition()), reg);
return;
case Primitive::kPrimLong:
// Clear output register: setcc only sets the low byte.
__ xorl(reg, reg);
- if (rhs.IsRegister()) {
- __ cmpq(lhs.AsRegister<CpuRegister>(), rhs.AsRegister<CpuRegister>());
- } else if (rhs.IsConstant()) {
- int64_t value = rhs.GetConstant()->AsLongConstant()->GetValue();
- codegen_->Compare64BitValue(lhs.AsRegister<CpuRegister>(), value);
- } else {
- __ cmpq(lhs.AsRegister<CpuRegister>(), Address(CpuRegister(RSP), rhs.GetStackIndex()));
- }
+ codegen_->GenerateLongCompare(lhs, rhs);
__ setcc(X86_64IntegerCondition(cond->GetCondition()), reg);
return;
case Primitive::kPrimFloat: {
@@ -1885,27 +1834,11 @@
case Primitive::kPrimShort:
case Primitive::kPrimChar:
case Primitive::kPrimInt: {
- CpuRegister left_reg = left.AsRegister<CpuRegister>();
- if (right.IsConstant()) {
- int32_t value = right.GetConstant()->AsIntConstant()->GetValue();
- codegen_->Compare32BitValue(left_reg, value);
- } else if (right.IsStackSlot()) {
- __ cmpl(left_reg, Address(CpuRegister(RSP), right.GetStackIndex()));
- } else {
- __ cmpl(left_reg, right.AsRegister<CpuRegister>());
- }
+ codegen_->GenerateIntCompare(left, right);
break;
}
case Primitive::kPrimLong: {
- CpuRegister left_reg = left.AsRegister<CpuRegister>();
- if (right.IsConstant()) {
- int64_t value = right.GetConstant()->AsLongConstant()->GetValue();
- codegen_->Compare64BitValue(left_reg, value);
- } else if (right.IsDoubleStackSlot()) {
- __ cmpq(left_reg, Address(CpuRegister(RSP), right.GetStackIndex()));
- } else {
- __ cmpq(left_reg, right.AsRegister<CpuRegister>());
- }
+ codegen_->GenerateLongCompare(left, right);
break;
}
case Primitive::kPrimFloat: {
@@ -3681,14 +3614,8 @@
}
void LocationsBuilderX86_64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::Any());
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorX86_64::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -3714,7 +3641,7 @@
} else {
DCHECK(value.IsConstant()) << value;
if (value.GetConstant()->AsIntConstant()->GetValue() == 0) {
- __ jmp(slow_path->GetEntryLabel());
+ __ jmp(slow_path->GetEntryLabel());
}
}
break;
@@ -3729,7 +3656,7 @@
} else {
DCHECK(value.IsConstant()) << value;
if (value.GetConstant()->AsLongConstant()->GetValue() == 0) {
- __ jmp(slow_path->GetEntryLabel());
+ __ jmp(slow_path->GetEntryLabel());
}
}
break;
@@ -4084,7 +4011,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_field_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
if (Primitive::IsFloatingPointType(instruction->GetType())) {
@@ -4459,11 +4386,11 @@
}
void LocationsBuilderX86_64::VisitNullCheck(HNullCheck* instruction) {
- LocationSummary* locations = codegen_->CreateNullCheckLocations(instruction);
- if (!codegen_->GetCompilerOptions().GetImplicitNullChecks()) {
- // Explicit null checks can use any location.
- locations->SetInAt(0, Location::Any());
- }
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
+ Location loc = codegen_->GetCompilerOptions().GetImplicitNullChecks()
+ ? Location::RequiresRegister()
+ : Location::Any();
+ locations->SetInAt(0, loc);
}
void CodeGeneratorX86_64::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -4510,7 +4437,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_array_get_with_read_barrier && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
@@ -4538,56 +4465,31 @@
switch (type) {
case Primitive::kPrimBoolean: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movzxb(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + data_offset));
- } else {
- __ movzxb(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_1, data_offset));
- }
+ __ movzxb(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_1, data_offset));
break;
}
case Primitive::kPrimByte: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movsxb(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + data_offset));
- } else {
- __ movsxb(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_1, data_offset));
- }
+ __ movsxb(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_1, data_offset));
break;
}
case Primitive::kPrimShort: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movsxw(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + data_offset));
- } else {
- __ movsxw(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_2, data_offset));
- }
+ __ movsxw(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_2, data_offset));
break;
}
case Primitive::kPrimChar: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movzxw(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + data_offset));
- } else {
- __ movzxw(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_2, data_offset));
- }
+ __ movzxw(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_2, data_offset));
break;
}
case Primitive::kPrimInt: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movl(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset));
- } else {
- __ movl(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_4, data_offset));
- }
+ __ movl(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset));
break;
}
@@ -4604,21 +4506,16 @@
instruction, out_loc, obj, data_offset, index, /* needs_null_check */ true);
} else {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
+ __ movl(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ // If read barriers are enabled, emit read barriers other than
+ // Baker's using a slow path (and also unpoison the loaded
+ // reference, if heap poisoning is enabled).
if (index.IsConstant()) {
uint32_t offset =
(index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
- __ movl(out, Address(obj, offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- // If read barriers are enabled, emit read barriers other than
- // Baker's using a slow path (and also unpoison the loaded
- // reference, if heap poisoning is enabled).
codegen_->MaybeGenerateReadBarrierSlow(instruction, out_loc, out_loc, obj_loc, offset);
} else {
- __ movl(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_4, data_offset));
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- // If read barriers are enabled, emit read barriers other than
- // Baker's using a slow path (and also unpoison the loaded
- // reference, if heap poisoning is enabled).
codegen_->MaybeGenerateReadBarrierSlow(
instruction, out_loc, out_loc, obj_loc, data_offset, index);
}
@@ -4628,34 +4525,19 @@
case Primitive::kPrimLong: {
CpuRegister out = out_loc.AsRegister<CpuRegister>();
- if (index.IsConstant()) {
- __ movq(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset));
- } else {
- __ movq(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_8, data_offset));
- }
+ __ movq(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_8, data_offset));
break;
}
case Primitive::kPrimFloat: {
XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
- if (index.IsConstant()) {
- __ movss(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset));
- } else {
- __ movss(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_4, data_offset));
- }
+ __ movss(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset));
break;
}
case Primitive::kPrimDouble: {
XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
- if (index.IsConstant()) {
- __ movsd(out, Address(obj,
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset));
- } else {
- __ movsd(out, Address(obj, index.AsRegister<CpuRegister>(), TIMES_8, data_offset));
- }
+ __ movsd(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_8, data_offset));
break;
}
@@ -4718,9 +4600,7 @@
case Primitive::kPrimBoolean:
case Primitive::kPrimByte: {
uint32_t offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_1, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_1, offset);
if (value.IsRegister()) {
__ movb(address, value.AsRegister<CpuRegister>());
} else {
@@ -4733,9 +4613,7 @@
case Primitive::kPrimShort:
case Primitive::kPrimChar: {
uint32_t offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_2, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_2, offset);
if (value.IsRegister()) {
__ movw(address, value.AsRegister<CpuRegister>());
} else {
@@ -4748,9 +4626,7 @@
case Primitive::kPrimNot: {
uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
if (!value.IsRegister()) {
// Just setting null.
@@ -4846,9 +4722,7 @@
case Primitive::kPrimInt: {
uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
if (value.IsRegister()) {
__ movl(address, value.AsRegister<CpuRegister>());
} else {
@@ -4862,18 +4736,14 @@
case Primitive::kPrimLong: {
uint32_t offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_8, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset);
if (value.IsRegister()) {
__ movq(address, value.AsRegister<CpuRegister>());
codegen_->MaybeRecordImplicitNullCheck(instruction);
} else {
int64_t v = value.GetConstant()->AsLongConstant()->GetValue();
- Address address_high = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) +
- offset + sizeof(int32_t))
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_8, offset + sizeof(int32_t));
+ Address address_high =
+ CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset + sizeof(int32_t));
codegen_->MoveInt64ToAddress(address, address_high, v, instruction);
}
break;
@@ -4881,15 +4751,12 @@
case Primitive::kPrimFloat: {
uint32_t offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_4, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
if (value.IsFpuRegister()) {
__ movss(address, value.AsFpuRegister<XmmRegister>());
} else {
DCHECK(value.IsConstant());
- int32_t v =
- bit_cast<int32_t, float>(value.GetConstant()->AsFloatConstant()->GetValue());
+ int32_t v = bit_cast<int32_t, float>(value.GetConstant()->AsFloatConstant()->GetValue());
__ movl(address, Immediate(v));
}
codegen_->MaybeRecordImplicitNullCheck(instruction);
@@ -4898,19 +4765,15 @@
case Primitive::kPrimDouble: {
uint32_t offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
- Address address = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + offset)
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_8, offset);
+ Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset);
if (value.IsFpuRegister()) {
__ movsd(address, value.AsFpuRegister<XmmRegister>());
codegen_->MaybeRecordImplicitNullCheck(instruction);
} else {
int64_t v =
bit_cast<int64_t, double>(value.GetConstant()->AsDoubleConstant()->GetValue());
- Address address_high = index.IsConstant()
- ? Address(array, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) +
- offset + sizeof(int32_t))
- : Address(array, index.AsRegister<CpuRegister>(), TIMES_8, offset + sizeof(int32_t));
+ Address address_high =
+ CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset + sizeof(int32_t));
codegen_->MoveInt64ToAddress(address, address_high, v, instruction);
}
break;
@@ -4945,18 +4808,16 @@
}
void LocationsBuilderX86_64::VisitBoundsCheck(HBoundsCheck* instruction) {
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConvention calling_convention;
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+ caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction, caller_saves);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
HInstruction* length = instruction->InputAt(1);
if (!length->IsEmittedAtUseSite()) {
locations->SetInAt(1, Location::RegisterOrConstant(length));
}
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorX86_64::VisitBoundsCheck(HBoundsCheck* instruction) {
@@ -5001,13 +4862,7 @@
}
codegen_->MaybeRecordImplicitNullCheck(array_length);
} else {
- CpuRegister length = length_loc.AsRegister<CpuRegister>();
- if (index_loc.IsConstant()) {
- int32_t value = CodeGenerator::GetInt32ValueOf(index_loc.GetConstant());
- __ cmpl(length, Immediate(value));
- } else {
- __ cmpl(length, index_loc.AsRegister<CpuRegister>());
- }
+ codegen_->GenerateIntCompare(length_loc, index_loc);
}
codegen_->AddSlowPath(slow_path);
__ j(kBelowEqual, slow_path->GetEntryLabel());
@@ -5045,7 +4900,7 @@
void LocationsBuilderX86_64::VisitSuspendCheck(HSuspendCheck* instruction) {
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorX86_64::VisitSuspendCheck(HSuspendCheck* instruction) {
@@ -5346,7 +5201,7 @@
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
HLoadClass::LoadKind load_kind = cls->GetLoadKind();
@@ -5621,7 +5476,7 @@
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
if (baker_read_barrier_slow_path) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::Any());
@@ -6361,9 +6216,7 @@
"art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
// /* HeapReference<Object> */ ref =
// *(obj + data_offset + index * sizeof(HeapReference<Object>))
- Address src = index.IsConstant() ?
- Address(obj, (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset) :
- Address(obj, index.AsRegister<CpuRegister>(), TIMES_4, data_offset);
+ Address src = CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset);
GenerateReferenceLoadWithBakerReadBarrier(instruction, ref, obj, src, needs_null_check);
}
@@ -6668,6 +6521,39 @@
}
}
+void CodeGeneratorX86_64::GenerateIntCompare(Location lhs, Location rhs) {
+ CpuRegister lhs_reg = lhs.AsRegister<CpuRegister>();
+ if (rhs.IsConstant()) {
+ int32_t value = CodeGenerator::GetInt32ValueOf(rhs.GetConstant());
+ Compare32BitValue(lhs_reg, value);
+ } else if (rhs.IsStackSlot()) {
+ __ cmpl(lhs_reg, Address(CpuRegister(RSP), rhs.GetStackIndex()));
+ } else {
+ __ cmpl(lhs_reg, rhs.AsRegister<CpuRegister>());
+ }
+}
+
+void CodeGeneratorX86_64::GenerateLongCompare(Location lhs, Location rhs) {
+ CpuRegister lhs_reg = lhs.AsRegister<CpuRegister>();
+ if (rhs.IsConstant()) {
+ int64_t value = rhs.GetConstant()->AsLongConstant()->GetValue();
+ Compare64BitValue(lhs_reg, value);
+ } else if (rhs.IsDoubleStackSlot()) {
+ __ cmpq(lhs_reg, Address(CpuRegister(RSP), rhs.GetStackIndex()));
+ } else {
+ __ cmpq(lhs_reg, rhs.AsRegister<CpuRegister>());
+ }
+}
+
+Address CodeGeneratorX86_64::ArrayAddress(CpuRegister obj,
+ Location index,
+ ScaleFactor scale,
+ uint32_t data_offset) {
+ return index.IsConstant() ?
+ Address(obj, (index.GetConstant()->AsIntConstant()->GetValue() << scale) + data_offset) :
+ Address(obj, index.AsRegister<CpuRegister>(), scale, data_offset);
+}
+
void CodeGeneratorX86_64::Store64BitValueToStack(Location dest, int64_t value) {
DCHECK(dest.IsDoubleStackSlot());
if (IsInt<32>(value)) {
diff --git a/compiler/optimizing/code_generator_x86_64.h b/compiler/optimizing/code_generator_x86_64.h
index 693d0b8..7108676 100644
--- a/compiler/optimizing/code_generator_x86_64.h
+++ b/compiler/optimizing/code_generator_x86_64.h
@@ -510,6 +510,18 @@
void Compare32BitValue(CpuRegister dest, int32_t value);
void Compare64BitValue(CpuRegister dest, int64_t value);
+ // Compare int values. Supports only register locations for `lhs`.
+ void GenerateIntCompare(Location lhs, Location rhs);
+
+ // Compare long values. Supports only register locations for `lhs`.
+ void GenerateLongCompare(Location lhs, Location rhs);
+
+ // Construct address for array access.
+ static Address ArrayAddress(CpuRegister obj,
+ Location index,
+ ScaleFactor scale,
+ uint32_t data_offset);
+
Address LiteralCaseTable(HPackedSwitch* switch_instr);
// Store a 64 bit value into a DoubleStackSlot in the most efficient manner.
diff --git a/compiler/optimizing/common_arm64.h b/compiler/optimizing/common_arm64.h
index eda0971..776a483 100644
--- a/compiler/optimizing/common_arm64.h
+++ b/compiler/optimizing/common_arm64.h
@@ -273,9 +273,9 @@
// only SP/WSP and ZXR/WZR codes are different between art and vixl.
// Note: This function is only used for debug checks.
inline bool ArtVixlRegCodeCoherentForRegSet(uint32_t art_core_registers,
- size_t num_core,
- uint32_t art_fpu_registers,
- size_t num_fpu) {
+ size_t num_core,
+ uint32_t art_fpu_registers,
+ size_t num_fpu) {
// The register masks won't work if the number of register is larger than 32.
DCHECK_GE(sizeof(art_core_registers) * 8, num_core);
DCHECK_GE(sizeof(art_fpu_registers) * 8, num_fpu);
diff --git a/compiler/optimizing/induction_var_analysis.cc b/compiler/optimizing/induction_var_analysis.cc
index 129c2a9..c501ccf 100644
--- a/compiler/optimizing/induction_var_analysis.cc
+++ b/compiler/optimizing/induction_var_analysis.cc
@@ -714,10 +714,12 @@
case kCondGE: op = kGE; break;
default: LOG(FATAL) << "CONDITION UNREACHABLE";
}
+ // Associate trip count with control instruction, rather than the condition (even
+ // though it's its use) since former provides a convenient use-free placeholder.
+ HInstruction* control = loop->GetHeader()->GetLastInstruction();
InductionInfo* taken_test = CreateInvariantOp(op, lower_expr, upper_expr);
- AssignInfo(loop,
- loop->GetHeader()->GetLastInstruction(),
- CreateTripCount(tcKind, trip_count, taken_test, type));
+ DCHECK(control->IsIf());
+ AssignInfo(loop, control, CreateTripCount(tcKind, trip_count, taken_test, type));
}
bool HInductionVarAnalysis::IsTaken(InductionInfo* lower_expr,
diff --git a/compiler/optimizing/induction_var_analysis_test.cc b/compiler/optimizing/induction_var_analysis_test.cc
index 580d24b..292bc4e 100644
--- a/compiler/optimizing/induction_var_analysis_test.cc
+++ b/compiler/optimizing/induction_var_analysis_test.cc
@@ -157,6 +157,13 @@
iva_->LookupInfo(loop_body_[d]->GetLoopInformation(), instruction));
}
+ // Returns induction information of the trip-count of loop at depth d.
+ std::string GetTripCount(int d) {
+ HInstruction* control = loop_header_[d]->GetLastInstruction();
+ DCHECK(control->IsIf());
+ return GetInductionInfo(control, d);
+ }
+
// Returns true if instructions have identical induction.
bool HaveSameInduction(HInstruction* instruction1, HInstruction* instruction2) {
return HInductionVarAnalysis::InductionEqual(
@@ -239,8 +246,7 @@
EXPECT_FALSE(HaveSameInduction(store->InputAt(1), increment_[0]));
// Trip-count.
- EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))",
- GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, FindDerivedInduction) {
@@ -579,8 +585,7 @@
}
EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(increment_[d], d).c_str());
// Trip-count.
- EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))",
- GetInductionInfo(loop_header_[d]->GetLastInstruction(), d).c_str());
+ EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))", GetTripCount(d).c_str());
}
}
@@ -607,8 +612,7 @@
EXPECT_FALSE(HaveSameInduction(store1->InputAt(1), store2->InputAt(1)));
// Trip-count.
- EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))",
- GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, ByteLoopControl1) {
@@ -626,8 +630,7 @@
EXPECT_STREQ("((1) * i + ((-128) + (1))):PrimByte", GetInductionInfo(increment_[0], 0).c_str());
// Trip-count.
- EXPECT_STREQ("(((127) - (-128)) (TC-loop) ((-128) < (127)))",
- GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("(((127) - (-128)) (TC-loop) ((-128) < (127)))", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, ByteLoopControl2) {
@@ -645,7 +648,7 @@
EXPECT_STREQ("((1) * i + ((-128) + (1))):PrimByte", GetInductionInfo(increment_[0], 0).c_str());
// Trip-count undefined.
- EXPECT_STREQ("", GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, ShortLoopControl1) {
@@ -664,8 +667,7 @@
EXPECT_STREQ("((1) * i + ((-32768) + (1))):PrimShort",
GetInductionInfo(increment_[0], 0).c_str());
// Trip-count.
- EXPECT_STREQ("(((32767) - (-32768)) (TC-loop) ((-32768) < (32767)))",
- GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("(((32767) - (-32768)) (TC-loop) ((-32768) < (32767)))", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, ShortLoopControl2) {
@@ -684,7 +686,7 @@
EXPECT_STREQ("((1) * i + ((-32768) + (1))):PrimShort",
GetInductionInfo(increment_[0], 0).c_str());
// Trip-count undefined.
- EXPECT_STREQ("", GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, CharLoopControl1) {
@@ -701,8 +703,7 @@
EXPECT_STREQ("((1) * i + (1)):PrimChar", GetInductionInfo(increment_[0], 0).c_str());
// Trip-count.
- EXPECT_STREQ("((65535) (TC-loop) ((0) < (65535)))",
- GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("((65535) (TC-loop) ((0) < (65535)))", GetTripCount(0).c_str());
}
TEST_F(InductionVarAnalysisTest, CharLoopControl2) {
@@ -719,7 +720,7 @@
EXPECT_STREQ("((1) * i + (1)):PrimChar", GetInductionInfo(increment_[0], 0).c_str());
// Trip-count undefined.
- EXPECT_STREQ("", GetInductionInfo(loop_header_[0]->GetLastInstruction(), 0).c_str());
+ EXPECT_STREQ("", GetTripCount(0).c_str());
}
} // namespace art
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index 18e6f5c..cd8b7c7 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -106,6 +106,12 @@
return instruction;
}
+/** Helper method to obtain loop's control instruction. */
+static HInstruction* GetLoopControl(HLoopInformation* loop) {
+ DCHECK(loop != nullptr);
+ return loop->GetHeader()->GetLastInstruction();
+}
+
//
// Public class methods.
//
@@ -179,7 +185,7 @@
/*out*/HInstruction** lower,
/*out*/HInstruction** upper) {
bool is_last_value = false;
- int64_t s = 0;
+ int64_t stride_value = 0;
bool b1, b2; // unused
if (!GenerateCode(context,
instruction,
@@ -189,7 +195,7 @@
lower,
upper,
nullptr,
- &s,
+ &stride_value,
&b1,
&b2)) {
LOG(FATAL) << "Failed precondition: CanGenerateRange()";
@@ -232,7 +238,9 @@
nullptr,
nullptr,
nullptr, // nothing generated yet
- &stride_value, &needs_finite_test, &needs_taken_test)
+ &stride_value,
+ &needs_finite_test,
+ &needs_taken_test)
&& !needs_finite_test && !needs_taken_test;
}
@@ -265,7 +273,10 @@
for (HLoopInformation* lp = instruction->GetBlock()->GetLoopInformation(); // closest enveloping loop
lp != nullptr;
lp = lp->GetPreHeader()->GetLoopInformation()) {
+ // Update instruction's information.
ReplaceInduction(induction_analysis_->LookupInfo(lp, instruction), fetch, replacement);
+ // Update loop's trip-count information.
+ ReplaceInduction(induction_analysis_->LookupInfo(lp, GetLoopControl(lp)), fetch, replacement);
}
}
@@ -308,13 +319,13 @@
/*out*/ HLoopInformation** loop,
/*out*/ HInductionVarAnalysis::InductionInfo** info,
/*out*/ HInductionVarAnalysis::InductionInfo** trip) const {
- HLoopInformation* l = context->GetBlock()->GetLoopInformation(); // closest enveloping loop
- if (l != nullptr) {
- HInductionVarAnalysis::InductionInfo* i = induction_analysis_->LookupInfo(l, instruction);
+ HLoopInformation* lp = context->GetBlock()->GetLoopInformation(); // closest enveloping loop
+ if (lp != nullptr) {
+ HInductionVarAnalysis::InductionInfo* i = induction_analysis_->LookupInfo(lp, instruction);
if (i != nullptr) {
- *loop = l;
+ *loop = lp;
*info = i;
- *trip = induction_analysis_->LookupInfo(l, l->GetHeader()->GetLastInstruction());
+ *trip = induction_analysis_->LookupInfo(lp, GetLoopControl(lp));
return true;
}
}
@@ -878,7 +889,8 @@
} else if (stride_value == -1) {
oper = new (graph->GetArena()) HSub(type, opb, opa);
} else {
- HInstruction* mul = new (graph->GetArena()) HMul(type, graph->GetIntConstant(stride_value), opa);
+ HInstruction* mul = new (graph->GetArena()) HMul(
+ type, graph->GetIntConstant(stride_value), opa);
oper = new (graph->GetArena()) HAdd(type, Insert(block, mul), opb);
}
*result = Insert(block, oper);
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 4ca0600..b787888 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -1577,6 +1577,18 @@
return;
}
+ if ((input_cst != nullptr) && input_cst->IsOne()
+ && input_other->GetType() == Primitive::kPrimBoolean) {
+ // Replace code looking like
+ // XOR dst, src, 1
+ // with
+ // BOOLEAN_NOT dst, src
+ HBooleanNot* boolean_not = new (GetGraph()->GetArena()) HBooleanNot(input_other);
+ instruction->GetBlock()->ReplaceAndRemoveInstructionWith(instruction, boolean_not);
+ RecordSimplification();
+ return;
+ }
+
if ((input_cst != nullptr) && AreAllBitsSet(input_cst)) {
// Replace code looking like
// XOR dst, src, 0xFFF...FF
diff --git a/compiler/optimizing/instruction_simplifier_shared.cc b/compiler/optimizing/instruction_simplifier_shared.cc
index 8f7778f..04e063c 100644
--- a/compiler/optimizing/instruction_simplifier_shared.cc
+++ b/compiler/optimizing/instruction_simplifier_shared.cc
@@ -259,7 +259,8 @@
HIntConstant* offset = graph->GetIntConstant(data_offset);
HIntermediateAddress* address =
new (arena) HIntermediateAddress(array, offset, kNoDexPc);
- address->SetReferenceTypeInfo(array->GetReferenceTypeInfo());
+ // TODO: Is it ok to not have this on the intermediate address?
+ // address->SetReferenceTypeInfo(array->GetReferenceTypeInfo());
access->GetBlock()->InsertInstructionBefore(address, access);
access->ReplaceInput(address, 0);
// Both instructions must depend on GC to prevent any instruction that can
diff --git a/compiler/optimizing/intrinsics_arm.cc b/compiler/optimizing/intrinsics_arm.cc
index 67640a1..fd2da10 100644
--- a/compiler/optimizing/intrinsics_arm.cc
+++ b/compiler/optimizing/intrinsics_arm.cc
@@ -657,7 +657,7 @@
LocationSummary::kNoCall,
kIntrinsified);
if (can_call && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::NoLocation()); // Unused receiver.
locations->SetInAt(1, Location::RequiresRegister());
diff --git a/compiler/optimizing/intrinsics_arm64.cc b/compiler/optimizing/intrinsics_arm64.cc
index 082076d..ce58657 100644
--- a/compiler/optimizing/intrinsics_arm64.cc
+++ b/compiler/optimizing/intrinsics_arm64.cc
@@ -895,7 +895,7 @@
LocationSummary::kNoCall,
kIntrinsified);
if (can_call && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::NoLocation()); // Unused receiver.
locations->SetInAt(1, Location::RequiresRegister());
diff --git a/compiler/optimizing/intrinsics_mips64.cc b/compiler/optimizing/intrinsics_mips64.cc
index be8eb51..1d153e2 100644
--- a/compiler/optimizing/intrinsics_mips64.cc
+++ b/compiler/optimizing/intrinsics_mips64.cc
@@ -1857,11 +1857,11 @@
if (type == Primitive::kPrimLong) {
__ Dclz(TMP, in);
__ LoadConst64(AT, INT64_C(0x8000000000000000));
- __ Dsrlv(out, AT, TMP);
+ __ Dsrlv(AT, AT, TMP);
} else {
__ Clz(TMP, in);
__ LoadConst32(AT, 0x80000000);
- __ Srlv(out, AT, TMP);
+ __ Srlv(AT, AT, TMP);
}
// For either value of "type", when "in" is zero, "out" should also
// be zero. Without this extra "and" operation, when "in" is zero,
@@ -1869,7 +1869,7 @@
// the MIPS logical shift operations "dsrlv", and "srlv" don't use
// the shift amount (TMP) directly; they use either (TMP % 64) or
// (TMP % 32), respectively.
- __ And(out, out, in);
+ __ And(out, AT, in);
}
// int java.lang.Integer.highestOneBit(int)
diff --git a/compiler/optimizing/intrinsics_x86.cc b/compiler/optimizing/intrinsics_x86.cc
index d17f85e..e61aba0 100644
--- a/compiler/optimizing/intrinsics_x86.cc
+++ b/compiler/optimizing/intrinsics_x86.cc
@@ -1977,7 +1977,7 @@
LocationSummary::kNoCall,
kIntrinsified);
if (can_call && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::NoLocation()); // Unused receiver.
locations->SetInAt(1, Location::RequiresRegister());
diff --git a/compiler/optimizing/intrinsics_x86_64.cc b/compiler/optimizing/intrinsics_x86_64.cc
index f8f30d9..0f31fab 100644
--- a/compiler/optimizing/intrinsics_x86_64.cc
+++ b/compiler/optimizing/intrinsics_x86_64.cc
@@ -2110,7 +2110,7 @@
LocationSummary::kNoCall,
kIntrinsified);
if (can_call && kUseBakerReadBarrier) {
- locations->SetCustomSlowPathCallerSaves(RegisterSet()); // No caller-save registers.
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::NoLocation()); // Unused receiver.
locations->SetInAt(1, Location::RequiresRegister());
diff --git a/compiler/optimizing/locations.cc b/compiler/optimizing/locations.cc
index 1b1b3a7..d157509 100644
--- a/compiler/optimizing/locations.cc
+++ b/compiler/optimizing/locations.cc
@@ -33,8 +33,8 @@
output_overlaps_(Location::kOutputOverlap),
stack_mask_(nullptr),
register_mask_(0),
- live_registers_(),
- custom_slow_path_caller_saves_() {
+ live_registers_(RegisterSet::Empty()),
+ custom_slow_path_caller_saves_(RegisterSet::Empty()) {
instruction->SetLocations(this);
if (NeedsSafepoint()) {
diff --git a/compiler/optimizing/locations.h b/compiler/optimizing/locations.h
index c97c4a6..da27928 100644
--- a/compiler/optimizing/locations.h
+++ b/compiler/optimizing/locations.h
@@ -420,7 +420,7 @@
class RegisterSet : public ValueObject {
public:
- RegisterSet() : core_registers_(0), floating_point_registers_(0) {}
+ static RegisterSet Empty() { return RegisterSet(); }
void Add(Location loc) {
if (loc.IsRegister()) {
@@ -465,6 +465,8 @@
}
private:
+ RegisterSet() : core_registers_(0), floating_point_registers_(0) {}
+
uint32_t core_registers_;
uint32_t floating_point_registers_;
};
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index caecc57..6d207765 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -4374,7 +4374,7 @@
HInstruction* left,
HInstruction* right,
uint32_t dex_pc)
- : HBinaryOperation(result_type, left, right, SideEffectsForArchRuntimeCalls(), dex_pc) {}
+ : HBinaryOperation(result_type, left, right, SideEffects::None(), dex_pc) {}
template <typename T>
T ComputeIntegral(T x, T y) const {
@@ -4409,11 +4409,6 @@
ComputeFP(x->GetValue(), y->GetValue()), GetDexPc());
}
- static SideEffects SideEffectsForArchRuntimeCalls() {
- // The generated code can use a runtime call.
- return SideEffects::CanTriggerGC();
- }
-
DECLARE_INSTRUCTION(Div);
private:
@@ -4426,7 +4421,7 @@
HInstruction* left,
HInstruction* right,
uint32_t dex_pc)
- : HBinaryOperation(result_type, left, right, SideEffectsForArchRuntimeCalls(), dex_pc) {}
+ : HBinaryOperation(result_type, left, right, SideEffects::None(), dex_pc) {}
template <typename T>
T ComputeIntegral(T x, T y) const {
@@ -4461,10 +4456,6 @@
ComputeFP(x->GetValue(), y->GetValue()), GetDexPc());
}
- static SideEffects SideEffectsForArchRuntimeCalls() {
- return SideEffects::CanTriggerGC();
- }
-
DECLARE_INSTRUCTION(Rem);
private:
@@ -4917,9 +4908,7 @@
public:
// Instantiate a type conversion of `input` to `result_type`.
HTypeConversion(Primitive::Type result_type, HInstruction* input, uint32_t dex_pc)
- : HExpression(result_type,
- SideEffectsForArchRuntimeCalls(input->GetType(), result_type),
- dex_pc) {
+ : HExpression(result_type, SideEffects::None(), dex_pc) {
SetRawInputAt(0, input);
// Invariant: We should never generate a conversion to a Boolean value.
DCHECK_NE(Primitive::kPrimBoolean, result_type);
@@ -4938,18 +4927,6 @@
// containing the result. If the input cannot be converted, return nullptr.
HConstant* TryStaticEvaluation() const;
- static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type input_type,
- Primitive::Type result_type) {
- // Some architectures may not require the 'GC' side effects, but at this point
- // in the compilation process we do not know what architecture we will
- // generate code for, so we must be conservative.
- if ((Primitive::IsFloatingPointType(input_type) && Primitive::IsIntegralType(result_type))
- || (input_type == Primitive::kPrimLong && Primitive::IsFloatingPointType(result_type))) {
- return SideEffects::CanTriggerGC();
- }
- return SideEffects::None();
- }
-
DECLARE_INSTRUCTION(TypeConversion);
private:
@@ -5031,9 +5008,7 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
uint32_t dex_pc)
- : HExpression(field_type,
- SideEffectsForArchRuntimeCalls(field_type, is_volatile),
- dex_pc),
+ : HExpression(field_type, SideEffects::FieldReadOfType(field_type, is_volatile), dex_pc),
field_info_(field_offset,
field_type,
is_volatile,
@@ -5064,16 +5039,6 @@
Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
bool IsVolatile() const { return field_info_.IsVolatile(); }
- static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type field_type, bool is_volatile) {
- SideEffects side_effects = SideEffects::FieldReadOfType(field_type, is_volatile);
-
- // MIPS delegates volatile kPrimLong and kPrimDouble loads to a runtime helper.
- if (Primitive::Is64BitType(field_type)) {
- side_effects.Add(SideEffects::CanTriggerGC());
- }
- return side_effects;
- }
-
DECLARE_INSTRUCTION(InstanceFieldGet);
private:
@@ -5094,8 +5059,7 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
uint32_t dex_pc)
- : HTemplateInstruction(SideEffectsForArchRuntimeCalls(field_type, is_volatile),
- dex_pc),
+ : HTemplateInstruction(SideEffects::FieldWriteOfType(field_type, is_volatile), dex_pc),
field_info_(field_offset,
field_type,
is_volatile,
@@ -5120,16 +5084,6 @@
bool GetValueCanBeNull() const { return GetPackedFlag<kFlagValueCanBeNull>(); }
void ClearValueCanBeNull() { SetPackedFlag<kFlagValueCanBeNull>(false); }
- static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type field_type, bool is_volatile) {
- SideEffects side_effects = SideEffects::FieldWriteOfType(field_type, is_volatile);
-
- // MIPS delegates volatile kPrimLong and kPrimDouble stores to a runtime helper.
- if (Primitive::Is64BitType(field_type)) {
- side_effects.Add(SideEffects::CanTriggerGC());
- }
- return side_effects;
- }
-
DECLARE_INSTRUCTION(InstanceFieldSet);
private:
@@ -5934,9 +5888,7 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
uint32_t dex_pc)
- : HExpression(field_type,
- SideEffectsForArchRuntimeCalls(field_type, is_volatile),
- dex_pc),
+ : HExpression(field_type, SideEffects::FieldReadOfType(field_type, is_volatile), dex_pc),
field_info_(field_offset,
field_type,
is_volatile,
@@ -5964,16 +5916,6 @@
Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
bool IsVolatile() const { return field_info_.IsVolatile(); }
- static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type field_type, bool is_volatile) {
- SideEffects side_effects = SideEffects::FieldReadOfType(field_type, is_volatile);
-
- // MIPS delegates volatile kPrimLong and kPrimDouble loads to a runtime helper.
- if (Primitive::Is64BitType(field_type)) {
- side_effects.Add(SideEffects::CanTriggerGC());
- }
- return side_effects;
- }
-
DECLARE_INSTRUCTION(StaticFieldGet);
private:
@@ -5994,8 +5936,7 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
uint32_t dex_pc)
- : HTemplateInstruction(SideEffectsForArchRuntimeCalls(field_type, is_volatile),
- dex_pc),
+ : HTemplateInstruction(SideEffects::FieldWriteOfType(field_type, is_volatile), dex_pc),
field_info_(field_offset,
field_type,
is_volatile,
@@ -6017,16 +5958,6 @@
bool GetValueCanBeNull() const { return GetPackedFlag<kFlagValueCanBeNull>(); }
void ClearValueCanBeNull() { SetPackedFlag<kFlagValueCanBeNull>(false); }
- static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type field_type, bool is_volatile) {
- SideEffects side_effects = SideEffects::FieldWriteOfType(field_type, is_volatile);
-
- // MIPS delegates volatile kPrimLong and kPrimDouble stores to a runtime helper.
- if (Primitive::Is64BitType(field_type)) {
- side_effects.Add(SideEffects::CanTriggerGC());
- }
- return side_effects;
- }
-
DECLARE_INSTRUCTION(StaticFieldSet);
private:
diff --git a/compiler/optimizing/nodes_shared.h b/compiler/optimizing/nodes_shared.h
index 8bd8667..814202e 100644
--- a/compiler/optimizing/nodes_shared.h
+++ b/compiler/optimizing/nodes_shared.h
@@ -17,6 +17,11 @@
#ifndef ART_COMPILER_OPTIMIZING_NODES_SHARED_H_
#define ART_COMPILER_OPTIMIZING_NODES_SHARED_H_
+// This `#include` should never be used by compilation, as this file (`nodes_shared.h`) is included
+// in `nodes.h`. However it helps editing tools (e.g. YouCompleteMe) by giving them better context
+// (defining `HInstruction` and co).
+#include "nodes.h"
+
namespace art {
class HMultiplyAccumulate FINAL : public HExpression<3> {
@@ -117,10 +122,15 @@
// This instruction computes an intermediate address pointing in the 'middle' of an object. The
// result pointer cannot be handled by GC, so extra care is taken to make sure that this value is
// never used across anything that can trigger GC.
+// The result of this instruction is not a pointer in the sense of `Primitive::kPrimNot`. So we
+// represent it by the type `Primitive::kPrimInt`.
class HIntermediateAddress FINAL : public HExpression<2> {
public:
HIntermediateAddress(HInstruction* base_address, HInstruction* offset, uint32_t dex_pc)
- : HExpression(Primitive::kPrimNot, SideEffects::DependsOnGC(), dex_pc) {
+ : HExpression(Primitive::kPrimInt, SideEffects::DependsOnGC(), dex_pc) {
+ DCHECK_EQ(Primitive::ComponentSize(Primitive::kPrimInt),
+ Primitive::ComponentSize(Primitive::kPrimNot))
+ << "kPrimInt and kPrimNot have different sizes.";
SetRawInputAt(0, base_address);
SetRawInputAt(1, offset);
}
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index b8e1379..e64c005 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -157,20 +157,11 @@
}
void HSharpening::ProcessLoadClass(HLoadClass* load_class) {
- if (load_class->NeedsAccessCheck()) {
- // We need to call the runtime anyway, so we simply get the class as that call's return value.
- return;
- }
- if (load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass) {
- // Loading from the ArtMethod* is the most efficient retrieval.
- // TODO: This may not actually be true for all architectures and
- // locations of target classes. The additional register pressure
- // for using the ArtMethod* should be considered.
- return;
- }
-
- DCHECK_EQ(load_class->GetLoadKind(), HLoadClass::LoadKind::kDexCacheViaMethod);
+ DCHECK(load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCacheViaMethod ||
+ load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass)
+ << load_class->GetLoadKind();
DCHECK(!load_class->IsInDexCache()) << "HLoadClass should not be optimized before sharpening.";
+ DCHECK(!load_class->IsInBootImage()) << "HLoadClass should not be optimized before sharpening.";
const DexFile& dex_file = load_class->GetDexFile();
uint32_t type_index = load_class->GetTypeIndex();
@@ -242,13 +233,28 @@
}
}
}
- if (is_in_dex_cache) {
- load_class->MarkInDexCache();
- }
+
if (is_in_boot_image) {
load_class->MarkInBootImage();
}
+ if (load_class->NeedsAccessCheck()) {
+ // We need to call the runtime anyway, so we simply get the class as that call's return value.
+ return;
+ }
+
+ if (load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass) {
+ // Loading from the ArtMethod* is the most efficient retrieval in code size.
+ // TODO: This may not actually be true for all architectures and
+ // locations of target classes. The additional register pressure
+ // for using the ArtMethod* should be considered.
+ return;
+ }
+
+ if (is_in_dex_cache) {
+ load_class->MarkInDexCache();
+ }
+
HLoadClass::LoadKind load_kind = codegen_->GetSupportedLoadClassKind(desired_load_kind);
switch (load_kind) {
case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
diff --git a/compiler/utils/arm/assembler_arm.h b/compiler/utils/arm/assembler_arm.h
index aefbf26..ee5811c 100644
--- a/compiler/utils/arm/assembler_arm.h
+++ b/compiler/utils/arm/assembler_arm.h
@@ -763,6 +763,9 @@
virtual void PushList(RegList regs, Condition cond = AL) = 0;
virtual void PopList(RegList regs, Condition cond = AL) = 0;
+ virtual void StoreList(RegList regs, size_t stack_offset) = 0;
+ virtual void LoadList(RegList regs, size_t stack_offset) = 0;
+
virtual void Mov(Register rd, Register rm, Condition cond = AL) = 0;
// Convenience shift instructions. Use mov instruction with shifter operand
diff --git a/compiler/utils/arm/assembler_thumb2.cc b/compiler/utils/arm/assembler_thumb2.cc
index f5ccf40..2269ba2 100644
--- a/compiler/utils/arm/assembler_thumb2.cc
+++ b/compiler/utils/arm/assembler_thumb2.cc
@@ -3372,6 +3372,30 @@
ldm(IA_W, SP, regs, cond);
}
+void Thumb2Assembler::StoreList(RegList regs, size_t stack_offset) {
+ DCHECK_NE(regs, 0u);
+ DCHECK_EQ(regs & (1u << IP), 0u);
+ if (IsPowerOfTwo(regs)) {
+ Register reg = static_cast<Register>(CTZ(static_cast<uint32_t>(regs)));
+ str(reg, Address(SP, stack_offset));
+ } else {
+ add(IP, SP, ShifterOperand(stack_offset));
+ stm(IA, IP, regs);
+ }
+}
+
+void Thumb2Assembler::LoadList(RegList regs, size_t stack_offset) {
+ DCHECK_NE(regs, 0u);
+ DCHECK_EQ(regs & (1u << IP), 0u);
+ if (IsPowerOfTwo(regs)) {
+ Register reg = static_cast<Register>(CTZ(static_cast<uint32_t>(regs)));
+ ldr(reg, Address(SP, stack_offset));
+ } else {
+ Register lowest_reg = static_cast<Register>(CTZ(static_cast<uint32_t>(regs)));
+ add(lowest_reg, SP, ShifterOperand(stack_offset));
+ ldm(IA, lowest_reg, regs);
+ }
+}
void Thumb2Assembler::Mov(Register rd, Register rm, Condition cond) {
if (cond != AL || rd != rm) {
diff --git a/compiler/utils/arm/assembler_thumb2.h b/compiler/utils/arm/assembler_thumb2.h
index 917c947..1c495aa 100644
--- a/compiler/utils/arm/assembler_thumb2.h
+++ b/compiler/utils/arm/assembler_thumb2.h
@@ -293,6 +293,8 @@
void PushList(RegList regs, Condition cond = AL) OVERRIDE;
void PopList(RegList regs, Condition cond = AL) OVERRIDE;
+ void StoreList(RegList regs, size_t stack_offset) OVERRIDE;
+ void LoadList(RegList regs, size_t stack_offset) OVERRIDE;
void Mov(Register rd, Register rm, Condition cond = AL) OVERRIDE;
diff --git a/compiler/utils/mips/assembler_mips.h b/compiler/utils/mips/assembler_mips.h
index 099620c..e1255f7 100644
--- a/compiler/utils/mips/assembler_mips.h
+++ b/compiler/utils/mips/assembler_mips.h
@@ -496,46 +496,61 @@
public:
template <typename ImplicitNullChecker = NoImplicitNullChecker>
- void StoreConst32ToOffset(int32_t value,
- Register base,
- int32_t offset,
- Register temp,
- ImplicitNullChecker null_checker = NoImplicitNullChecker()) {
+ void StoreConstToOffset(StoreOperandType type,
+ int64_t value,
+ Register base,
+ int32_t offset,
+ Register temp,
+ ImplicitNullChecker null_checker = NoImplicitNullChecker()) {
+ // We permit `base` and `temp` to coincide (however, we check that neither is AT),
+ // in which case the `base` register may be overwritten in the process.
CHECK_NE(temp, AT); // Must not use AT as temp, so as not to overwrite the adjusted base.
- AdjustBaseAndOffset(base, offset, /* is_doubleword */ false);
- if (value == 0) {
- temp = ZERO;
- } else {
- LoadConst32(temp, value);
- }
- Sw(temp, base, offset);
- null_checker();
- }
-
- template <typename ImplicitNullChecker = NoImplicitNullChecker>
- void StoreConst64ToOffset(int64_t value,
- Register base,
- int32_t offset,
- Register temp,
- ImplicitNullChecker null_checker = NoImplicitNullChecker()) {
- CHECK_NE(temp, AT); // Must not use AT as temp, so as not to overwrite the adjusted base.
- AdjustBaseAndOffset(base, offset, /* is_doubleword */ true);
+ AdjustBaseAndOffset(base, offset, /* is_doubleword */ (type == kStoreDoubleword));
uint32_t low = Low32Bits(value);
uint32_t high = High32Bits(value);
- if (low == 0) {
- Sw(ZERO, base, offset);
- } else {
- LoadConst32(temp, low);
- Sw(temp, base, offset);
+ Register reg;
+ // If the adjustment left `base` unchanged and equal to `temp`, we can't use `temp`
+ // to load and hold the value but we can use AT instead as AT hasn't been used yet.
+ // Otherwise, `temp` can be used for the value. And if `temp` is the same as the
+ // original `base` (that is, `base` prior to the adjustment), the original `base`
+ // register will be overwritten.
+ if (base == temp) {
+ temp = AT;
}
- null_checker();
- if (high == 0) {
- Sw(ZERO, base, offset + kMipsWordSize);
+ if (low == 0) {
+ reg = ZERO;
} else {
- if (high != low) {
- LoadConst32(temp, high);
- }
- Sw(temp, base, offset + kMipsWordSize);
+ reg = temp;
+ LoadConst32(reg, low);
+ }
+ switch (type) {
+ case kStoreByte:
+ Sb(reg, base, offset);
+ break;
+ case kStoreHalfword:
+ Sh(reg, base, offset);
+ break;
+ case kStoreWord:
+ Sw(reg, base, offset);
+ break;
+ case kStoreDoubleword:
+ Sw(reg, base, offset);
+ null_checker();
+ if (high == 0) {
+ reg = ZERO;
+ } else {
+ reg = temp;
+ if (high != low) {
+ LoadConst32(reg, high);
+ }
+ }
+ Sw(reg, base, offset + kMipsWordSize);
+ break;
+ default:
+ LOG(FATAL) << "UNREACHABLE";
+ }
+ if (type != kStoreDoubleword) {
+ null_checker();
}
}
diff --git a/compiler/utils/mips/assembler_mips_test.cc b/compiler/utils/mips/assembler_mips_test.cc
index a92455f..a9abf2f 100644
--- a/compiler/utils/mips/assembler_mips_test.cc
+++ b/compiler/utils/mips/assembler_mips_test.cc
@@ -1977,6 +1977,85 @@
DriverStr(expected, "StoreDToOffset");
}
+TEST_F(AssemblerMIPSTest, StoreConstToOffset) {
+ __ StoreConstToOffset(mips::kStoreByte, 0xFF, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreHalfword, 0xFFFF, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreWord, 0x12345678, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreDoubleword, 0x123456789ABCDEF0, mips::A1, +0, mips::T8);
+
+ __ StoreConstToOffset(mips::kStoreByte, 0, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreHalfword, 0, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreWord, 0, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreDoubleword, 0, mips::A1, +0, mips::T8);
+
+ __ StoreConstToOffset(mips::kStoreDoubleword, 0x1234567812345678, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreDoubleword, 0x1234567800000000, mips::A1, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreDoubleword, 0x0000000012345678, mips::A1, +0, mips::T8);
+
+ __ StoreConstToOffset(mips::kStoreWord, 0, mips::T8, +0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreWord, 0x12345678, mips::T8, +0, mips::T8);
+
+ __ StoreConstToOffset(mips::kStoreWord, 0, mips::A1, -0xFFF0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreWord, 0x12345678, mips::A1, +0xFFF0, mips::T8);
+
+ __ StoreConstToOffset(mips::kStoreWord, 0, mips::T8, -0xFFF0, mips::T8);
+ __ StoreConstToOffset(mips::kStoreWord, 0x12345678, mips::T8, +0xFFF0, mips::T8);
+
+ const char* expected =
+ "ori $t8, $zero, 0xFF\n"
+ "sb $t8, 0($a1)\n"
+ "ori $t8, $zero, 0xFFFF\n"
+ "sh $t8, 0($a1)\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 0($a1)\n"
+ "lui $t8, 0x9ABC\n"
+ "ori $t8, $t8, 0xDEF0\n"
+ "sw $t8, 0($a1)\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 4($a1)\n"
+
+ "sb $zero, 0($a1)\n"
+ "sh $zero, 0($a1)\n"
+ "sw $zero, 0($a1)\n"
+ "sw $zero, 0($a1)\n"
+ "sw $zero, 4($a1)\n"
+
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 0($a1)\n"
+ "sw $t8, 4($a1)\n"
+ "sw $zero, 0($a1)\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 4($a1)\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 0($a1)\n"
+ "sw $zero, 4($a1)\n"
+
+ "sw $zero, 0($t8)\n"
+ "lui $at, 0x1234\n"
+ "ori $at, $at, 0x5678\n"
+ "sw $at, 0($t8)\n"
+
+ "addiu $at, $a1, -0x7FF8\n"
+ "sw $zero, -0x7FF8($at)\n"
+ "addiu $at, $a1, 0x7FF8\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 0x7FF8($at)\n"
+
+ "addiu $at, $t8, -0x7FF8\n"
+ "sw $zero, -0x7FF8($at)\n"
+ "addiu $at, $t8, 0x7FF8\n"
+ "lui $t8, 0x1234\n"
+ "ori $t8, $t8, 0x5678\n"
+ "sw $t8, 0x7FF8($at)\n";
+ DriverStr(expected, "StoreConstToOffset");
+}
+
TEST_F(AssemblerMIPSTest, B) {
mips::MipsLabel label1, label2;
__ B(&label1);
diff --git a/dex2oat/Android.bp b/dex2oat/Android.bp
index d422734..11c18b0 100644
--- a/dex2oat/Android.bp
+++ b/dex2oat/Android.bp
@@ -124,7 +124,7 @@
art_cc_test {
name: "art_dex2oat_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["dex2oat_test.cc"],
}
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 63f5e0c..c422163 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -64,6 +64,8 @@
#include "interpreter/unstarted_runtime.h"
#include "jit/offline_profiling_info.h"
#include "leb128.h"
+#include "linker/buffered_output_stream.h"
+#include "linker/file_output_stream.h"
#include "linker/multi_oat_relative_patcher.h"
#include "mirror/class-inl.h"
#include "mirror/class_loader.h"
@@ -1384,7 +1386,10 @@
if (IsBootImage() && image_filenames_.size() > 1) {
// If we're compiling the boot image, store the boot classpath into the Key-Value store.
// We need this for the multi-image case.
- key_value_store_->Put(OatHeader::kBootClassPathKey, GetMultiImageBootClassPath());
+ key_value_store_->Put(OatHeader::kBootClassPathKey,
+ gc::space::ImageSpace::GetMultiImageBootClassPath(dex_locations_,
+ oat_filenames_,
+ image_filenames_));
}
if (!IsBootImage()) {
@@ -1753,6 +1758,28 @@
}
}
+ {
+ TimingLogger::ScopedTiming t2("dex2oat Write VDEX", timings_);
+ DCHECK(IsBootImage() || oat_files_.size() == 1u);
+ DCHECK_EQ(IsBootImage(), verifier_deps_ == nullptr);
+ for (size_t i = 0, size = oat_files_.size(); i != size; ++i) {
+ File* vdex_file = vdex_files_[i].get();
+ std::unique_ptr<BufferedOutputStream> vdex_out(
+ MakeUnique<BufferedOutputStream>(MakeUnique<FileOutputStream>(vdex_file)));
+
+ if (!oat_writers_[i]->WriteVerifierDeps(vdex_out.get(), verifier_deps_.get())) {
+ LOG(ERROR) << "Failed to write verifier dependencies into VDEX " << vdex_file->GetPath();
+ return false;
+ }
+
+ // VDEX finalized, seek back to the beginning and write the header.
+ if (!oat_writers_[i]->WriteVdexHeader(vdex_out.get())) {
+ LOG(ERROR) << "Failed to write vdex header into VDEX " << vdex_file->GetPath();
+ return false;
+ }
+ }
+ }
+
linker::MultiOatRelativePatcher patcher(instruction_set_, instruction_set_features_.get());
{
TimingLogger::ScopedTiming t2("dex2oat Write ELF", timings_);
@@ -2028,49 +2055,6 @@
return result;
}
- std::string GetMultiImageBootClassPath() {
- DCHECK(IsBootImage());
- DCHECK_GT(oat_filenames_.size(), 1u);
- // If the image filename was adapted (e.g., for our tests), we need to change this here,
- // too, but need to strip all path components (they will be re-established when loading).
- std::ostringstream bootcp_oss;
- bool first_bootcp = true;
- for (size_t i = 0; i < dex_locations_.size(); ++i) {
- if (!first_bootcp) {
- bootcp_oss << ":";
- }
-
- std::string dex_loc = dex_locations_[i];
- std::string image_filename = image_filenames_[i];
-
- // Use the dex_loc path, but the image_filename name (without path elements).
- size_t dex_last_slash = dex_loc.rfind('/');
-
- // npos is max(size_t). That makes this a bit ugly.
- size_t image_last_slash = image_filename.rfind('/');
- size_t image_last_at = image_filename.rfind('@');
- size_t image_last_sep = (image_last_slash == std::string::npos)
- ? image_last_at
- : (image_last_at == std::string::npos)
- ? std::string::npos
- : std::max(image_last_slash, image_last_at);
- // Note: whenever image_last_sep == npos, +1 overflow means using the full string.
-
- if (dex_last_slash == std::string::npos) {
- dex_loc = image_filename.substr(image_last_sep + 1);
- } else {
- dex_loc = dex_loc.substr(0, dex_last_slash + 1) +
- image_filename.substr(image_last_sep + 1);
- }
-
- // Image filenames already end with .art, no need to replace.
-
- bootcp_oss << dex_loc;
- first_bootcp = false;
- }
- return bootcp_oss.str();
- }
-
std::vector<std::string> GetClassPathLocations(const std::string& class_path) {
// This function is used only for apps and for an app we have exactly one oat file.
DCHECK(!IsBootImage());
@@ -2604,6 +2588,7 @@
std::vector<std::unique_ptr<ElfWriter>> elf_writers_;
std::vector<std::unique_ptr<OatWriter>> oat_writers_;
std::vector<OutputStream*> rodata_;
+ std::vector<std::unique_ptr<OutputStream>> vdex_out_;
std::unique_ptr<ImageWriter> image_writer_;
std::unique_ptr<CompilerDriver> driver_;
@@ -2792,6 +2777,8 @@
return EXIT_FAILURE;
}
+ // Helps debugging on device. Can be used to determine which dalvikvm instance invoked a dex2oat
+ // instance. Used by tools/bisection_search/bisection_search.py.
VLOG(compiler) << "Running dex2oat (parent PID = " << getppid() << ")";
bool result;
diff --git a/dexdump/Android.bp b/dexdump/Android.bp
index 74f7578..64f2299 100644
--- a/dexdump/Android.bp
+++ b/dexdump/Android.bp
@@ -28,7 +28,7 @@
art_cc_test {
name: "art_dexdump_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["dexdump_test.cc"],
}
diff --git a/dexdump/dexdump_main.cc b/dexdump/dexdump_main.cc
index f716ba8..5c032a0 100644
--- a/dexdump/dexdump_main.cc
+++ b/dexdump/dexdump_main.cc
@@ -28,8 +28,8 @@
#include <string.h>
#include <unistd.h>
+#include "base/logging.h"
#include "mem_map.h"
-#include "runtime.h"
namespace art {
diff --git a/dexdump/dexdump_test.cc b/dexdump/dexdump_test.cc
index 9819233..d28ca28 100644
--- a/dexdump/dexdump_test.cc
+++ b/dexdump/dexdump_test.cc
@@ -24,8 +24,6 @@
#include "base/stringprintf.h"
#include "common_runtime_test.h"
#include "runtime/arch/instruction_set.h"
-#include "runtime/gc/heap.h"
-#include "runtime/gc/space/image_space.h"
#include "runtime/os.h"
#include "runtime/utils.h"
#include "utils.h"
diff --git a/dexlayout/Android.bp b/dexlayout/Android.bp
index 9c4499f..c411572 100644
--- a/dexlayout/Android.bp
+++ b/dexlayout/Android.bp
@@ -18,6 +18,7 @@
srcs: [
"dexlayout_main.cc",
"dexlayout.cc",
+ "dex_ir.cc",
"dex_ir_builder.cc",
],
cflags: ["-Wall"],
@@ -27,7 +28,7 @@
art_cc_test {
name: "art_dexlayout_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["dexlayout_test.cc"],
}
diff --git a/dexlayout/dex_ir.cc b/dexlayout/dex_ir.cc
new file mode 100644
index 0000000..aff03cd
--- /dev/null
+++ b/dexlayout/dex_ir.cc
@@ -0,0 +1,487 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ *
+ * Implementation file of the dexlayout utility.
+ *
+ * This is a tool to read dex files into an internal representation,
+ * reorganize the representation, and emit dex files with a better
+ * file layout.
+ */
+
+#include "dex_ir.h"
+#include "dex_ir_builder.h"
+
+namespace art {
+namespace dex_ir {
+
+static uint64_t ReadVarWidth(const uint8_t** data, uint8_t length, bool sign_extend) {
+ uint64_t value = 0;
+ for (uint32_t i = 0; i <= length; i++) {
+ value |= static_cast<uint64_t>(*(*data)++) << (i * 8);
+ }
+ if (sign_extend) {
+ int shift = (7 - length) * 8;
+ return (static_cast<int64_t>(value) << shift) >> shift;
+ }
+ return value;
+}
+
+static bool GetPositionsCb(void* context, const DexFile::PositionInfo& entry) {
+ DebugInfoItem* debug_info = reinterpret_cast<DebugInfoItem*>(context);
+ PositionInfoVector& positions = debug_info->GetPositionInfo();
+ positions.push_back(std::unique_ptr<PositionInfo>(new PositionInfo(entry.address_, entry.line_)));
+ return false;
+}
+
+static void GetLocalsCb(void* context, const DexFile::LocalInfo& entry) {
+ DebugInfoItem* debug_info = reinterpret_cast<DebugInfoItem*>(context);
+ LocalInfoVector& locals = debug_info->GetLocalInfo();
+ const char* name = entry.name_ != nullptr ? entry.name_ : "(null)";
+ const char* signature = entry.signature_ != nullptr ? entry.signature_ : "";
+ locals.push_back(std::unique_ptr<LocalInfo>(
+ new LocalInfo(name, entry.descriptor_, signature, entry.start_address_,
+ entry.end_address_, entry.reg_)));
+}
+
+EncodedValue* Collections::ReadEncodedValue(const uint8_t** data) {
+ const uint8_t encoded_value = *(*data)++;
+ const uint8_t type = encoded_value & 0x1f;
+ EncodedValue* item = new EncodedValue(type);
+ ReadEncodedValue(data, type, encoded_value >> 5, item);
+ return item;
+}
+
+EncodedValue* Collections::ReadEncodedValue(const uint8_t** data, uint8_t type, uint8_t length) {
+ EncodedValue* item = new EncodedValue(type);
+ ReadEncodedValue(data, type, length, item);
+ return item;
+}
+
+void Collections::ReadEncodedValue(
+ const uint8_t** data, uint8_t type, uint8_t length, EncodedValue* item) {
+ switch (type) {
+ case DexFile::kDexAnnotationByte:
+ item->SetByte(static_cast<int8_t>(ReadVarWidth(data, length, false)));
+ break;
+ case DexFile::kDexAnnotationShort:
+ item->SetShort(static_cast<int16_t>(ReadVarWidth(data, length, true)));
+ break;
+ case DexFile::kDexAnnotationChar:
+ item->SetChar(static_cast<uint16_t>(ReadVarWidth(data, length, false)));
+ break;
+ case DexFile::kDexAnnotationInt:
+ item->SetInt(static_cast<int32_t>(ReadVarWidth(data, length, true)));
+ break;
+ case DexFile::kDexAnnotationLong:
+ item->SetLong(static_cast<int64_t>(ReadVarWidth(data, length, true)));
+ break;
+ case DexFile::kDexAnnotationFloat: {
+ // Fill on right.
+ union {
+ float f;
+ uint32_t data;
+ } conv;
+ conv.data = static_cast<uint32_t>(ReadVarWidth(data, length, false)) << (3 - length) * 8;
+ item->SetFloat(conv.f);
+ break;
+ }
+ case DexFile::kDexAnnotationDouble: {
+ // Fill on right.
+ union {
+ double d;
+ uint64_t data;
+ } conv;
+ conv.data = ReadVarWidth(data, length, false) << (7 - length) * 8;
+ item->SetDouble(conv.d);
+ break;
+ }
+ case DexFile::kDexAnnotationString: {
+ const uint32_t string_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
+ item->SetStringId(GetStringId(string_index));
+ break;
+ }
+ case DexFile::kDexAnnotationType: {
+ const uint32_t string_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
+ item->SetTypeId(GetTypeId(string_index));
+ break;
+ }
+ case DexFile::kDexAnnotationField:
+ case DexFile::kDexAnnotationEnum: {
+ const uint32_t field_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
+ item->SetFieldId(GetFieldId(field_index));
+ break;
+ }
+ case DexFile::kDexAnnotationMethod: {
+ const uint32_t method_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
+ item->SetMethodId(GetMethodId(method_index));
+ break;
+ }
+ case DexFile::kDexAnnotationArray: {
+ EncodedValueVector* values = new EncodedValueVector();
+ const uint32_t size = DecodeUnsignedLeb128(data);
+ // Decode all elements.
+ for (uint32_t i = 0; i < size; i++) {
+ values->push_back(std::unique_ptr<EncodedValue>(ReadEncodedValue(data)));
+ }
+ item->SetEncodedArray(new EncodedArrayItem(values));
+ break;
+ }
+ case DexFile::kDexAnnotationAnnotation: {
+ AnnotationElementVector* elements = new AnnotationElementVector();
+ const uint32_t type_idx = DecodeUnsignedLeb128(data);
+ const uint32_t size = DecodeUnsignedLeb128(data);
+ // Decode all name=value pairs.
+ for (uint32_t i = 0; i < size; i++) {
+ const uint32_t name_index = DecodeUnsignedLeb128(data);
+ elements->push_back(std::unique_ptr<AnnotationElement>(
+ new AnnotationElement(GetStringId(name_index), ReadEncodedValue(data))));
+ }
+ item->SetEncodedAnnotation(new EncodedAnnotation(GetTypeId(type_idx), elements));
+ break;
+ }
+ case DexFile::kDexAnnotationNull:
+ break;
+ case DexFile::kDexAnnotationBoolean:
+ item->SetBoolean(length != 0);
+ break;
+ default:
+ break;
+ }
+}
+
+void Collections::CreateStringId(const DexFile& dex_file, uint32_t i) {
+ const DexFile::StringId& disk_string_id = dex_file.GetStringId(i);
+ StringData* string_data = new StringData(dex_file.GetStringData(disk_string_id));
+ string_datas_.AddItem(string_data, disk_string_id.string_data_off_);
+
+ StringId* string_id = new StringId(string_data);
+ string_ids_.AddIndexedItem(string_id, StringIdsOffset() + i * StringId::ItemSize(), i);
+}
+
+void Collections::CreateTypeId(const DexFile& dex_file, uint32_t i) {
+ const DexFile::TypeId& disk_type_id = dex_file.GetTypeId(i);
+ TypeId* type_id = new TypeId(GetStringId(disk_type_id.descriptor_idx_));
+ type_ids_.AddIndexedItem(type_id, TypeIdsOffset() + i * TypeId::ItemSize(), i);
+}
+
+void Collections::CreateProtoId(const DexFile& dex_file, uint32_t i) {
+ const DexFile::ProtoId& disk_proto_id = dex_file.GetProtoId(i);
+ const DexFile::TypeList* type_list = dex_file.GetProtoParameters(disk_proto_id);
+ TypeList* parameter_type_list = CreateTypeList(type_list, disk_proto_id.parameters_off_, true);
+
+ ProtoId* proto_id = new ProtoId(GetStringId(disk_proto_id.shorty_idx_),
+ GetTypeId(disk_proto_id.return_type_idx_),
+ parameter_type_list);
+ proto_ids_.AddIndexedItem(proto_id, ProtoIdsOffset() + i * ProtoId::ItemSize(), i);
+}
+
+void Collections::CreateFieldId(const DexFile& dex_file, uint32_t i) {
+ const DexFile::FieldId& disk_field_id = dex_file.GetFieldId(i);
+ FieldId* field_id = new FieldId(GetTypeId(disk_field_id.class_idx_),
+ GetTypeId(disk_field_id.type_idx_),
+ GetStringId(disk_field_id.name_idx_));
+ field_ids_.AddIndexedItem(field_id, FieldIdsOffset() + i * FieldId::ItemSize(), i);
+}
+
+void Collections::CreateMethodId(const DexFile& dex_file, uint32_t i) {
+ const DexFile::MethodId& disk_method_id = dex_file.GetMethodId(i);
+ MethodId* method_id = new MethodId(GetTypeId(disk_method_id.class_idx_),
+ GetProtoId(disk_method_id.proto_idx_),
+ GetStringId(disk_method_id.name_idx_));
+ method_ids_.AddIndexedItem(method_id, MethodIdsOffset() + i * MethodId::ItemSize(), i);
+}
+
+void Collections::CreateClassDef(const DexFile& dex_file, uint32_t i) {
+ const DexFile::ClassDef& disk_class_def = dex_file.GetClassDef(i);
+ const TypeId* class_type = GetTypeId(disk_class_def.class_idx_);
+ uint32_t access_flags = disk_class_def.access_flags_;
+ const TypeId* superclass = GetTypeIdOrNullPtr(disk_class_def.superclass_idx_);
+
+ const DexFile::TypeList* type_list = dex_file.GetInterfacesList(disk_class_def);
+ TypeList* interfaces_type_list = CreateTypeList(type_list, disk_class_def.interfaces_off_, false);
+
+ const StringId* source_file = GetStringIdOrNullPtr(disk_class_def.source_file_idx_);
+ // Annotations.
+ AnnotationsDirectoryItem* annotations = nullptr;
+ const DexFile::AnnotationsDirectoryItem* disk_annotations_directory_item =
+ dex_file.GetAnnotationsDirectory(disk_class_def);
+ if (disk_annotations_directory_item != nullptr) {
+ annotations = CreateAnnotationsDirectoryItem(
+ dex_file, disk_annotations_directory_item, disk_class_def.annotations_off_);
+ }
+ // Static field initializers.
+ const uint8_t* static_data = dex_file.GetEncodedStaticFieldValuesArray(disk_class_def);
+ EncodedArrayItem* static_values =
+ CreateEncodedArrayItem(static_data, disk_class_def.static_values_off_);
+ ClassData* class_data = CreateClassData(
+ dex_file, dex_file.GetClassData(disk_class_def), disk_class_def.class_data_off_);
+ ClassDef* class_def = new ClassDef(class_type, access_flags, superclass, interfaces_type_list,
+ source_file, annotations, static_values, class_data);
+ class_defs_.AddIndexedItem(class_def, ClassDefsOffset() + i * ClassDef::ItemSize(), i);
+}
+
+TypeList* Collections::CreateTypeList(
+ const DexFile::TypeList* dex_type_list, uint32_t offset, bool allow_empty) {
+ if (dex_type_list == nullptr && !allow_empty) {
+ return nullptr;
+ }
+ // TODO: Create more efficient lookup for existing type lists.
+ for (std::unique_ptr<TypeList>& type_list : TypeLists()) {
+ if (type_list->GetOffset() == offset) {
+ return type_list.get();
+ }
+ }
+ TypeIdVector* type_vector = new TypeIdVector();
+ uint32_t size = dex_type_list == nullptr ? 0 : dex_type_list->Size();
+ for (uint32_t index = 0; index < size; ++index) {
+ type_vector->push_back(GetTypeId(dex_type_list->GetTypeItem(index).type_idx_));
+ }
+ TypeList* new_type_list = new TypeList(type_vector);
+ type_lists_.AddItem(new_type_list, offset);
+ return new_type_list;
+}
+
+EncodedArrayItem* Collections::CreateEncodedArrayItem(const uint8_t* static_data, uint32_t offset) {
+ if (static_data == nullptr) {
+ return nullptr;
+ }
+ uint32_t size = DecodeUnsignedLeb128(&static_data);
+ EncodedValueVector* values = new EncodedValueVector();
+ for (uint32_t i = 0; i < size; ++i) {
+ values->push_back(std::unique_ptr<EncodedValue>(ReadEncodedValue(&static_data)));
+ }
+ // TODO: Calculate the size of the encoded array.
+ EncodedArrayItem* encoded_array_item = new EncodedArrayItem(values);
+ encoded_array_items_.AddItem(encoded_array_item, offset);
+ return encoded_array_item;
+}
+
+AnnotationItem* Collections::CreateAnnotationItem(const DexFile::AnnotationItem* annotation,
+ uint32_t offset) {
+ uint8_t visibility = annotation->visibility_;
+ const uint8_t* annotation_data = annotation->annotation_;
+ EncodedValue* encoded_value =
+ ReadEncodedValue(&annotation_data, DexFile::kDexAnnotationAnnotation, 0);
+ // TODO: Calculate the size of the annotation.
+ AnnotationItem* annotation_item =
+ new AnnotationItem(visibility, encoded_value->ReleaseEncodedAnnotation());
+ annotation_items_.AddItem(annotation_item, offset);
+ return annotation_item;
+}
+
+
+AnnotationSetItem* Collections::CreateAnnotationSetItem(const DexFile& dex_file,
+ const DexFile::AnnotationSetItem& disk_annotations_item, uint32_t offset) {
+ if (disk_annotations_item.size_ == 0) {
+ return nullptr;
+ }
+ std::vector<AnnotationItem*>* items = new std::vector<AnnotationItem*>();
+ for (uint32_t i = 0; i < disk_annotations_item.size_; ++i) {
+ const DexFile::AnnotationItem* annotation =
+ dex_file.GetAnnotationItem(&disk_annotations_item, i);
+ if (annotation == nullptr) {
+ continue;
+ }
+ AnnotationItem* annotation_item =
+ CreateAnnotationItem(annotation, disk_annotations_item.entries_[i]);
+ items->push_back(annotation_item);
+ }
+ AnnotationSetItem* annotation_set_item = new AnnotationSetItem(items);
+ annotation_set_items_.AddItem(annotation_set_item, offset);
+ return annotation_set_item;
+}
+
+AnnotationsDirectoryItem* Collections::CreateAnnotationsDirectoryItem(const DexFile& dex_file,
+ const DexFile::AnnotationsDirectoryItem* disk_annotations_item, uint32_t offset) {
+ const DexFile::AnnotationSetItem* class_set_item =
+ dex_file.GetClassAnnotationSet(disk_annotations_item);
+ AnnotationSetItem* class_annotation = nullptr;
+ if (class_set_item != nullptr) {
+ uint32_t offset = disk_annotations_item->class_annotations_off_;
+ class_annotation = CreateAnnotationSetItem(dex_file, *class_set_item, offset);
+ }
+ const DexFile::FieldAnnotationsItem* fields =
+ dex_file.GetFieldAnnotations(disk_annotations_item);
+ FieldAnnotationVector* field_annotations = nullptr;
+ if (fields != nullptr) {
+ field_annotations = new FieldAnnotationVector();
+ for (uint32_t i = 0; i < disk_annotations_item->fields_size_; ++i) {
+ FieldId* field_id = GetFieldId(fields[i].field_idx_);
+ const DexFile::AnnotationSetItem* field_set_item =
+ dex_file.GetFieldAnnotationSetItem(fields[i]);
+ uint32_t annotation_set_offset = fields[i].annotations_off_;
+ AnnotationSetItem* annotation_set_item =
+ CreateAnnotationSetItem(dex_file, *field_set_item, annotation_set_offset);
+ field_annotations->push_back(std::unique_ptr<FieldAnnotation>(
+ new FieldAnnotation(field_id, annotation_set_item)));
+ }
+ }
+ const DexFile::MethodAnnotationsItem* methods =
+ dex_file.GetMethodAnnotations(disk_annotations_item);
+ MethodAnnotationVector* method_annotations = nullptr;
+ if (methods != nullptr) {
+ method_annotations = new MethodAnnotationVector();
+ for (uint32_t i = 0; i < disk_annotations_item->methods_size_; ++i) {
+ MethodId* method_id = GetMethodId(methods[i].method_idx_);
+ const DexFile::AnnotationSetItem* method_set_item =
+ dex_file.GetMethodAnnotationSetItem(methods[i]);
+ uint32_t annotation_set_offset = methods[i].annotations_off_;
+ AnnotationSetItem* annotation_set_item =
+ CreateAnnotationSetItem(dex_file, *method_set_item, annotation_set_offset);
+ method_annotations->push_back(std::unique_ptr<MethodAnnotation>(
+ new MethodAnnotation(method_id, annotation_set_item)));
+ }
+ }
+ const DexFile::ParameterAnnotationsItem* parameters =
+ dex_file.GetParameterAnnotations(disk_annotations_item);
+ ParameterAnnotationVector* parameter_annotations = nullptr;
+ if (parameters != nullptr) {
+ parameter_annotations = new ParameterAnnotationVector();
+ for (uint32_t i = 0; i < disk_annotations_item->parameters_size_; ++i) {
+ MethodId* method_id = GetMethodId(parameters[i].method_idx_);
+ const DexFile::AnnotationSetRefList* list =
+ dex_file.GetParameterAnnotationSetRefList(¶meters[i]);
+ parameter_annotations->push_back(std::unique_ptr<ParameterAnnotation>(
+ GenerateParameterAnnotation(dex_file, method_id, list, parameters[i].annotations_off_)));
+ }
+ }
+ // TODO: Calculate the size of the annotations directory.
+ AnnotationsDirectoryItem* annotations_directory_item = new AnnotationsDirectoryItem(
+ class_annotation, field_annotations, method_annotations, parameter_annotations);
+ annotations_directory_items_.AddItem(annotations_directory_item, offset);
+ return annotations_directory_item;
+}
+
+ParameterAnnotation* Collections::GenerateParameterAnnotation(
+ const DexFile& dex_file, MethodId* method_id,
+ const DexFile::AnnotationSetRefList* annotation_set_ref_list, uint32_t offset) {
+ std::vector<AnnotationSetItem*>* annotations = new std::vector<AnnotationSetItem*>();
+ for (uint32_t i = 0; i < annotation_set_ref_list->size_; ++i) {
+ const DexFile::AnnotationSetItem* annotation_set_item =
+ dex_file.GetSetRefItemItem(&annotation_set_ref_list->list_[i]);
+ uint32_t set_offset = annotation_set_ref_list->list_[i].annotations_off_;
+ annotations->push_back(CreateAnnotationSetItem(dex_file, *annotation_set_item, set_offset));
+ }
+ AnnotationSetRefList* new_ref_list = new AnnotationSetRefList(annotations);
+ annotation_set_ref_lists_.AddItem(new_ref_list, offset);
+ return new ParameterAnnotation(method_id, new_ref_list);
+}
+
+CodeItem* Collections::CreateCodeItem(const DexFile& dex_file,
+ const DexFile::CodeItem& disk_code_item, uint32_t offset) {
+ uint16_t registers_size = disk_code_item.registers_size_;
+ uint16_t ins_size = disk_code_item.ins_size_;
+ uint16_t outs_size = disk_code_item.outs_size_;
+ uint32_t tries_size = disk_code_item.tries_size_;
+
+ // TODO: Calculate the size of the debug info.
+ const uint8_t* debug_info_stream = dex_file.GetDebugInfoStream(&disk_code_item);
+ DebugInfoItem* debug_info = nullptr;
+ if (debug_info_stream != nullptr) {
+ debug_info = new DebugInfoItem();
+ debug_info_items_.AddItem(debug_info, disk_code_item.debug_info_off_);
+ }
+
+ uint32_t insns_size = disk_code_item.insns_size_in_code_units_;
+ uint16_t* insns = new uint16_t[insns_size];
+ memcpy(insns, disk_code_item.insns_, insns_size * sizeof(uint16_t));
+
+ TryItemVector* tries = nullptr;
+ if (tries_size > 0) {
+ tries = new TryItemVector();
+ for (uint32_t i = 0; i < tries_size; ++i) {
+ const DexFile::TryItem* disk_try_item = dex_file.GetTryItems(disk_code_item, i);
+ uint32_t start_addr = disk_try_item->start_addr_;
+ uint16_t insn_count = disk_try_item->insn_count_;
+ CatchHandlerVector* handlers = new CatchHandlerVector();
+ for (CatchHandlerIterator it(disk_code_item, *disk_try_item); it.HasNext(); it.Next()) {
+ const uint16_t type_index = it.GetHandlerTypeIndex();
+ const TypeId* type_id = GetTypeIdOrNullPtr(type_index);
+ handlers->push_back(std::unique_ptr<const CatchHandler>(
+ new CatchHandler(type_id, it.GetHandlerAddress())));
+ }
+ TryItem* try_item = new TryItem(start_addr, insn_count, handlers);
+ tries->push_back(std::unique_ptr<const TryItem>(try_item));
+ }
+ }
+ // TODO: Calculate the size of the code item.
+ CodeItem* code_item =
+ new CodeItem(registers_size, ins_size, outs_size, debug_info, insns_size, insns, tries);
+ code_items_.AddItem(code_item, offset);
+ return code_item;
+}
+
+MethodItem* Collections::GenerateMethodItem(const DexFile& dex_file, ClassDataItemIterator& cdii) {
+ MethodId* method_item = GetMethodId(cdii.GetMemberIndex());
+ uint32_t access_flags = cdii.GetRawMemberAccessFlags();
+ const DexFile::CodeItem* disk_code_item = cdii.GetMethodCodeItem();
+ CodeItem* code_item = nullptr;
+ DebugInfoItem* debug_info = nullptr;
+ if (disk_code_item != nullptr) {
+ code_item = CreateCodeItem(dex_file, *disk_code_item, cdii.GetMethodCodeItemOffset());
+ debug_info = code_item->DebugInfo();
+ }
+ if (debug_info != nullptr) {
+ bool is_static = (access_flags & kAccStatic) != 0;
+ dex_file.DecodeDebugLocalInfo(
+ disk_code_item, is_static, cdii.GetMemberIndex(), GetLocalsCb, debug_info);
+ dex_file.DecodeDebugPositionInfo(disk_code_item, GetPositionsCb, debug_info);
+ }
+ return new MethodItem(access_flags, method_item, code_item);
+}
+
+ClassData* Collections::CreateClassData(
+ const DexFile& dex_file, const uint8_t* encoded_data, uint32_t offset) {
+ // Read the fields and methods defined by the class, resolving the circular reference from those
+ // to classes by setting class at the same time.
+ ClassData* class_data = nullptr;
+ if (encoded_data != nullptr) {
+ ClassDataItemIterator cdii(dex_file, encoded_data);
+ // Static fields.
+ FieldItemVector* static_fields = new FieldItemVector();
+ for (uint32_t i = 0; cdii.HasNextStaticField(); i++, cdii.Next()) {
+ FieldId* field_item = GetFieldId(cdii.GetMemberIndex());
+ uint32_t access_flags = cdii.GetRawMemberAccessFlags();
+ static_fields->push_back(std::unique_ptr<FieldItem>(new FieldItem(access_flags, field_item)));
+ }
+ // Instance fields.
+ FieldItemVector* instance_fields = new FieldItemVector();
+ for (uint32_t i = 0; cdii.HasNextInstanceField(); i++, cdii.Next()) {
+ FieldId* field_item = GetFieldId(cdii.GetMemberIndex());
+ uint32_t access_flags = cdii.GetRawMemberAccessFlags();
+ instance_fields->push_back(
+ std::unique_ptr<FieldItem>(new FieldItem(access_flags, field_item)));
+ }
+ // Direct methods.
+ MethodItemVector* direct_methods = new MethodItemVector();
+ for (uint32_t i = 0; cdii.HasNextDirectMethod(); i++, cdii.Next()) {
+ direct_methods->push_back(
+ std::unique_ptr<MethodItem>(GenerateMethodItem(dex_file, cdii)));
+ }
+ // Virtual methods.
+ MethodItemVector* virtual_methods = new MethodItemVector();
+ for (uint32_t i = 0; cdii.HasNextVirtualMethod(); i++, cdii.Next()) {
+ virtual_methods->push_back(
+ std::unique_ptr<MethodItem>(GenerateMethodItem(dex_file, cdii)));
+ }
+ // TODO: Calculate the size of the class data.
+ class_data = new ClassData(static_fields, instance_fields, direct_methods, virtual_methods);
+ class_datas_.AddItem(class_data, offset);
+ }
+ return class_data;
+}
+
+} // namespace dex_ir
+} // namespace art
diff --git a/dexlayout/dex_ir.h b/dexlayout/dex_ir.h
index cbb4404..6ae9f1c 100644
--- a/dexlayout/dex_ir.h
+++ b/dexlayout/dex_ir.h
@@ -23,18 +23,23 @@
#include <stdint.h>
#include "dex_file-inl.h"
+#include "leb128.h"
namespace art {
namespace dex_ir {
// Forward declarations for classes used in containers or pointed to.
+class AnnotationItem;
class AnnotationsDirectoryItem;
class AnnotationSetItem;
-class ArrayItem;
+class AnnotationSetRefList;
class ClassData;
class ClassDef;
class CodeItem;
class DebugInfoItem;
+class EncodedAnnotation;
+class EncodedArrayItem;
+class EncodedValue;
class FieldId;
class FieldItem;
class Header;
@@ -42,10 +47,22 @@
class MapItem;
class MethodId;
class MethodItem;
+class ParameterAnnotation;
class ProtoId;
+class StringData;
class StringId;
class TryItem;
class TypeId;
+class TypeList;
+
+// Item size constants.
+static constexpr size_t kHeaderItemSize = 112;
+static constexpr size_t kStringIdItemSize = 4;
+static constexpr size_t kTypeIdItemSize = 4;
+static constexpr size_t kProtoIdItemSize = 12;
+static constexpr size_t kFieldIdItemSize = 8;
+static constexpr size_t kMethodIdItemSize = 8;
+static constexpr size_t kClassDefItemSize = 32;
// Visitor support
class AbstractDispatcher {
@@ -54,6 +71,7 @@
virtual ~AbstractDispatcher() { }
virtual void Dispatch(Header* header) = 0;
+ virtual void Dispatch(const StringData* string_data) = 0;
virtual void Dispatch(const StringId* string_id) = 0;
virtual void Dispatch(const TypeId* type_id) = 0;
virtual void Dispatch(const ProtoId* proto_id) = 0;
@@ -63,11 +81,13 @@
virtual void Dispatch(ClassDef* class_def) = 0;
virtual void Dispatch(FieldItem* field_item) = 0;
virtual void Dispatch(MethodItem* method_item) = 0;
- virtual void Dispatch(ArrayItem* array_item) = 0;
+ virtual void Dispatch(EncodedArrayItem* array_item) = 0;
virtual void Dispatch(CodeItem* code_item) = 0;
virtual void Dispatch(TryItem* try_item) = 0;
virtual void Dispatch(DebugInfoItem* debug_info_item) = 0;
+ virtual void Dispatch(AnnotationItem* annotation_item) = 0;
virtual void Dispatch(AnnotationSetItem* annotation_set_item) = 0;
+ virtual void Dispatch(AnnotationSetRefList* annotation_set_ref_list) = 0;
virtual void Dispatch(AnnotationsDirectoryItem* annotations_directory_item) = 0;
virtual void Dispatch(MapList* map_list) = 0;
virtual void Dispatch(MapItem* map_item) = 0;
@@ -82,9 +102,14 @@
CollectionWithOffset() = default;
std::vector<std::unique_ptr<T>>& Collection() { return collection_; }
// Read-time support methods
- void AddWithPosition(uint32_t position, T* object) {
+ void AddItem(T* object, uint32_t offset) {
+ object->SetOffset(offset);
collection_.push_back(std::unique_ptr<T>(object));
- collection_.back()->SetOffset(position);
+ }
+ void AddIndexedItem(T* object, uint32_t offset, uint32_t index) {
+ object->SetOffset(offset);
+ object->SetIndex(index);
+ collection_.push_back(std::unique_ptr<T>(object));
}
// Ordinary object insertion into collection.
void Insert(T object ATTRIBUTE_UNUSED) {
@@ -98,18 +123,160 @@
private:
std::vector<std::unique_ptr<T>> collection_;
uint32_t offset_ = 0;
+
DISALLOW_COPY_AND_ASSIGN(CollectionWithOffset);
};
+class Collections {
+ public:
+ Collections() = default;
+
+ std::vector<std::unique_ptr<StringId>>& StringIds() { return string_ids_.Collection(); }
+ std::vector<std::unique_ptr<TypeId>>& TypeIds() { return type_ids_.Collection(); }
+ std::vector<std::unique_ptr<ProtoId>>& ProtoIds() { return proto_ids_.Collection(); }
+ std::vector<std::unique_ptr<FieldId>>& FieldIds() { return field_ids_.Collection(); }
+ std::vector<std::unique_ptr<MethodId>>& MethodIds() { return method_ids_.Collection(); }
+ std::vector<std::unique_ptr<ClassDef>>& ClassDefs() { return class_defs_.Collection(); }
+
+ std::vector<std::unique_ptr<TypeList>>& TypeLists() { return type_lists_.Collection(); }
+ std::vector<std::unique_ptr<EncodedArrayItem>>& EncodedArrayItems()
+ { return encoded_array_items_.Collection(); }
+
+ void CreateStringId(const DexFile& dex_file, uint32_t i);
+ void CreateTypeId(const DexFile& dex_file, uint32_t i);
+ void CreateProtoId(const DexFile& dex_file, uint32_t i);
+ void CreateFieldId(const DexFile& dex_file, uint32_t i);
+ void CreateMethodId(const DexFile& dex_file, uint32_t i);
+ void CreateClassDef(const DexFile& dex_file, uint32_t i);
+
+ TypeList* CreateTypeList(const DexFile::TypeList* type_list, uint32_t offset, bool allow_empty);
+ EncodedArrayItem* CreateEncodedArrayItem(const uint8_t* static_data, uint32_t offset);
+ AnnotationItem* CreateAnnotationItem(const DexFile::AnnotationItem* annotation, uint32_t offset);
+ AnnotationSetItem* CreateAnnotationSetItem(const DexFile& dex_file,
+ const DexFile::AnnotationSetItem& disk_annotations_item, uint32_t offset);
+ AnnotationsDirectoryItem* CreateAnnotationsDirectoryItem(const DexFile& dex_file,
+ const DexFile::AnnotationsDirectoryItem* disk_annotations_item, uint32_t offset);
+ CodeItem* CreateCodeItem(
+ const DexFile& dex_file, const DexFile::CodeItem& disk_code_item, uint32_t offset);
+ ClassData* CreateClassData(const DexFile& dex_file, const uint8_t* encoded_data, uint32_t offset);
+
+ StringId* GetStringId(uint32_t index) { return StringIds()[index].get(); }
+ TypeId* GetTypeId(uint32_t index) { return TypeIds()[index].get(); }
+ ProtoId* GetProtoId(uint32_t index) { return ProtoIds()[index].get(); }
+ FieldId* GetFieldId(uint32_t index) { return FieldIds()[index].get(); }
+ MethodId* GetMethodId(uint32_t index) { return MethodIds()[index].get(); }
+ ClassDef* GetClassDef(uint32_t index) { return ClassDefs()[index].get(); }
+
+ StringId* GetStringIdOrNullPtr(uint32_t index) {
+ return index == DexFile::kDexNoIndex ? nullptr : GetStringId(index);
+ }
+ TypeId* GetTypeIdOrNullPtr(uint16_t index) {
+ return index == DexFile::kDexNoIndex16 ? nullptr : GetTypeId(index);
+ }
+
+ uint32_t StringIdsOffset() const { return string_ids_.GetOffset(); }
+ uint32_t TypeIdsOffset() const { return type_ids_.GetOffset(); }
+ uint32_t ProtoIdsOffset() const { return proto_ids_.GetOffset(); }
+ uint32_t FieldIdsOffset() const { return field_ids_.GetOffset(); }
+ uint32_t MethodIdsOffset() const { return method_ids_.GetOffset(); }
+ uint32_t ClassDefsOffset() const { return class_defs_.GetOffset(); }
+ uint32_t StringDatasOffset() const { return string_datas_.GetOffset(); }
+ uint32_t TypeListsOffset() const { return type_lists_.GetOffset(); }
+ uint32_t EncodedArrayOffset() const { return encoded_array_items_.GetOffset(); }
+ uint32_t AnnotationOffset() const { return annotation_items_.GetOffset(); }
+ uint32_t AnnotationSetOffset() const { return annotation_set_items_.GetOffset(); }
+ uint32_t AnnotationSetRefListsOffset() const { return annotation_set_ref_lists_.GetOffset(); }
+ uint32_t AnnotationsDirectoryOffset() const { return annotations_directory_items_.GetOffset(); }
+ uint32_t DebugInfoOffset() const { return debug_info_items_.GetOffset(); }
+ uint32_t CodeItemsOffset() const { return code_items_.GetOffset(); }
+ uint32_t ClassDatasOffset() const { return class_datas_.GetOffset(); }
+
+ void SetStringIdsOffset(uint32_t new_offset) { string_ids_.SetOffset(new_offset); }
+ void SetTypeIdsOffset(uint32_t new_offset) { type_ids_.SetOffset(new_offset); }
+ void SetProtoIdsOffset(uint32_t new_offset) { proto_ids_.SetOffset(new_offset); }
+ void SetFieldIdsOffset(uint32_t new_offset) { field_ids_.SetOffset(new_offset); }
+ void SetMethodIdsOffset(uint32_t new_offset) { method_ids_.SetOffset(new_offset); }
+ void SetClassDefsOffset(uint32_t new_offset) { class_defs_.SetOffset(new_offset); }
+ void SetStringDatasOffset(uint32_t new_offset) { string_datas_.SetOffset(new_offset); }
+ void SetTypeListsOffset(uint32_t new_offset) { type_lists_.SetOffset(new_offset); }
+ void SetEncodedArrayOffset(uint32_t new_offset) { encoded_array_items_.SetOffset(new_offset); }
+ void SetAnnotationOffset(uint32_t new_offset) { annotation_items_.SetOffset(new_offset); }
+ void SetAnnotationSetOffset(uint32_t new_offset) { annotation_set_items_.SetOffset(new_offset); }
+ void SetAnnotationSetRefListsOffset(uint32_t new_offset)
+ { annotation_set_ref_lists_.SetOffset(new_offset); }
+ void SetAnnotationsDirectoryOffset(uint32_t new_offset)
+ { annotations_directory_items_.SetOffset(new_offset); }
+ void SetDebugInfoOffset(uint32_t new_offset) { debug_info_items_.SetOffset(new_offset); }
+ void SetCodeItemsOffset(uint32_t new_offset) { code_items_.SetOffset(new_offset); }
+ void SetClassDatasOffset(uint32_t new_offset) { class_datas_.SetOffset(new_offset); }
+
+ uint32_t StringIdsSize() const { return string_ids_.Size(); }
+ uint32_t TypeIdsSize() const { return type_ids_.Size(); }
+ uint32_t ProtoIdsSize() const { return proto_ids_.Size(); }
+ uint32_t FieldIdsSize() const { return field_ids_.Size(); }
+ uint32_t MethodIdsSize() const { return method_ids_.Size(); }
+ uint32_t ClassDefsSize() const { return class_defs_.Size(); }
+
+ private:
+ EncodedValue* ReadEncodedValue(const uint8_t** data);
+ EncodedValue* ReadEncodedValue(const uint8_t** data, uint8_t type, uint8_t length);
+ void ReadEncodedValue(const uint8_t** data, uint8_t type, uint8_t length, EncodedValue* item);
+
+ ParameterAnnotation* GenerateParameterAnnotation(const DexFile& dex_file, MethodId* method_id,
+ const DexFile::AnnotationSetRefList* annotation_set_ref_list, uint32_t offset);
+ MethodItem* GenerateMethodItem(const DexFile& dex_file, ClassDataItemIterator& cdii);
+
+ CollectionWithOffset<StringId> string_ids_;
+ CollectionWithOffset<TypeId> type_ids_;
+ CollectionWithOffset<ProtoId> proto_ids_;
+ CollectionWithOffset<FieldId> field_ids_;
+ CollectionWithOffset<MethodId> method_ids_;
+ CollectionWithOffset<ClassDef> class_defs_;
+
+ CollectionWithOffset<StringData> string_datas_;
+ CollectionWithOffset<TypeList> type_lists_;
+ CollectionWithOffset<EncodedArrayItem> encoded_array_items_;
+ CollectionWithOffset<AnnotationItem> annotation_items_;
+ CollectionWithOffset<AnnotationSetItem> annotation_set_items_;
+ CollectionWithOffset<AnnotationSetRefList> annotation_set_ref_lists_;
+ CollectionWithOffset<AnnotationsDirectoryItem> annotations_directory_items_;
+ CollectionWithOffset<DebugInfoItem> debug_info_items_;
+ CollectionWithOffset<CodeItem> code_items_;
+ CollectionWithOffset<ClassData> class_datas_;
+
+ DISALLOW_COPY_AND_ASSIGN(Collections);
+};
+
class Item {
public:
+ Item() { }
virtual ~Item() { }
uint32_t GetOffset() const { return offset_; }
+ uint32_t GetSize() const { return size_; }
void SetOffset(uint32_t offset) { offset_ = offset; }
+ void SetSize(uint32_t size) { size_ = size; }
protected:
+ Item(uint32_t offset, uint32_t size) : offset_(offset), size_(size) { }
+
uint32_t offset_ = 0;
+ uint32_t size_ = 0;
+};
+
+class IndexedItem : public Item {
+ public:
+ IndexedItem() { }
+ virtual ~IndexedItem() { }
+
+ uint32_t GetIndex() const { return index_; }
+ void SetIndex(uint32_t index) { index_ = index; }
+
+ protected:
+ IndexedItem(uint32_t offset, uint32_t size, uint32_t index)
+ : Item(offset, size), index_(index) { }
+
+ uint32_t index_ = 0;
};
class Header : public Item {
@@ -124,7 +291,8 @@
uint32_t link_offset,
uint32_t data_size,
uint32_t data_offset)
- : checksum_(checksum),
+ : Item(0, kHeaderItemSize),
+ checksum_(checksum),
endian_tag_(endian_tag),
file_size_(file_size),
header_size_(header_size),
@@ -137,6 +305,8 @@
}
~Header() OVERRIDE { }
+ static size_t ItemSize() { return kHeaderItemSize; }
+
const uint8_t* Magic() const { return magic_; }
uint32_t Checksum() const { return checksum_; }
const uint8_t* Signature() const { return signature_; }
@@ -159,39 +329,7 @@
void SetDataSize(uint32_t new_data_size) { data_size_ = new_data_size; }
void SetDataOffset(uint32_t new_data_offset) { data_offset_ = new_data_offset; }
- // Collections.
- std::vector<std::unique_ptr<StringId>>& StringIds() { return string_ids_.Collection(); }
- std::vector<std::unique_ptr<TypeId>>& TypeIds() { return type_ids_.Collection(); }
- std::vector<std::unique_ptr<ProtoId>>& ProtoIds() { return proto_ids_.Collection(); }
- std::vector<std::unique_ptr<FieldId>>& FieldIds() { return field_ids_.Collection(); }
- std::vector<std::unique_ptr<MethodId>>& MethodIds() { return method_ids_.Collection(); }
- std::vector<std::unique_ptr<ClassDef>>& ClassDefs() { return class_defs_.Collection(); }
- uint32_t StringIdsOffset() const { return string_ids_.GetOffset(); }
- uint32_t TypeIdsOffset() const { return type_ids_.GetOffset(); }
- uint32_t ProtoIdsOffset() const { return proto_ids_.GetOffset(); }
- uint32_t FieldIdsOffset() const { return field_ids_.GetOffset(); }
- uint32_t MethodIdsOffset() const { return method_ids_.GetOffset(); }
- uint32_t ClassDefsOffset() const { return class_defs_.GetOffset(); }
- void SetStringIdsOffset(uint32_t new_offset) { string_ids_.SetOffset(new_offset); }
- void SetTypeIdsOffset(uint32_t new_offset) { type_ids_.SetOffset(new_offset); }
- void SetProtoIdsOffset(uint32_t new_offset) { proto_ids_.SetOffset(new_offset); }
- void SetFieldIdsOffset(uint32_t new_offset) { field_ids_.SetOffset(new_offset); }
- void SetMethodIdsOffset(uint32_t new_offset) { method_ids_.SetOffset(new_offset); }
- void SetClassDefsOffset(uint32_t new_offset) { class_defs_.SetOffset(new_offset); }
- uint32_t StringIdsSize() const { return string_ids_.Size(); }
- uint32_t TypeIdsSize() const { return type_ids_.Size(); }
- uint32_t ProtoIdsSize() const { return proto_ids_.Size(); }
- uint32_t FieldIdsSize() const { return field_ids_.Size(); }
- uint32_t MethodIdsSize() const { return method_ids_.Size(); }
- uint32_t ClassDefsSize() const { return class_defs_.Size(); }
-
- TypeId* GetTypeIdOrNullPtr(uint16_t index) {
- return index == DexFile::kDexNoIndex16 ? nullptr : TypeIds()[index].get();
- }
-
- StringId* GetStringIdOrNullPtr(uint32_t index) {
- return index == DexFile::kDexNoIndex ? nullptr : StringIds()[index].get();
- }
+ Collections& GetCollections() { return collections_; }
void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
@@ -207,19 +345,16 @@
uint32_t data_size_;
uint32_t data_offset_;
- CollectionWithOffset<StringId> string_ids_;
- CollectionWithOffset<TypeId> type_ids_;
- CollectionWithOffset<ProtoId> proto_ids_;
- CollectionWithOffset<FieldId> field_ids_;
- CollectionWithOffset<MethodId> method_ids_;
- CollectionWithOffset<ClassDef> class_defs_;
+ Collections collections_;
+
DISALLOW_COPY_AND_ASSIGN(Header);
};
-class StringId : public Item {
+class StringData : public Item {
public:
- explicit StringId(const char* data) : data_(strdup(data)) { }
- ~StringId() OVERRIDE { }
+ explicit StringData(const char* data) : data_(strdup(data)) {
+ size_ = UnsignedLeb128Size(strlen(data)) + strlen(data);
+ }
const char* Data() const { return data_.get(); }
@@ -227,50 +362,95 @@
private:
std::unique_ptr<const char> data_;
+
+ DISALLOW_COPY_AND_ASSIGN(StringData);
+};
+
+class StringId : public IndexedItem {
+ public:
+ explicit StringId(StringData* string_data) : string_data_(string_data) {
+ size_ = kStringIdItemSize;
+ }
+ ~StringId() OVERRIDE { }
+
+ static size_t ItemSize() { return kStringIdItemSize; }
+
+ const char* Data() const { return string_data_->Data(); }
+ StringData* DataItem() const { return string_data_; }
+
+ void Accept(AbstractDispatcher* dispatch) const { dispatch->Dispatch(this); }
+
+ private:
+ StringData* string_data_;
+
DISALLOW_COPY_AND_ASSIGN(StringId);
};
-class TypeId : public Item {
+class TypeId : public IndexedItem {
public:
- explicit TypeId(StringId* string_id) : string_id_(string_id) { }
+ explicit TypeId(StringId* string_id) : string_id_(string_id) { size_ = kTypeIdItemSize; }
~TypeId() OVERRIDE { }
+ static size_t ItemSize() { return kTypeIdItemSize; }
+
StringId* GetStringId() const { return string_id_; }
void Accept(AbstractDispatcher* dispatch) const { dispatch->Dispatch(this); }
private:
StringId* string_id_;
+
DISALLOW_COPY_AND_ASSIGN(TypeId);
};
using TypeIdVector = std::vector<const TypeId*>;
-class ProtoId : public Item {
+class TypeList : public Item {
public:
- ProtoId(const StringId* shorty, const TypeId* return_type, TypeIdVector* parameters)
- : shorty_(shorty), return_type_(return_type), parameters_(parameters) { }
+ explicit TypeList(TypeIdVector* type_list) : type_list_(type_list) {
+ size_ = sizeof(uint32_t) + (type_list->size() * sizeof(uint16_t));
+ }
+ ~TypeList() OVERRIDE { }
+
+ const TypeIdVector* GetTypeList() const { return type_list_.get(); }
+
+ private:
+ std::unique_ptr<TypeIdVector> type_list_;
+
+ DISALLOW_COPY_AND_ASSIGN(TypeList);
+};
+
+class ProtoId : public IndexedItem {
+ public:
+ ProtoId(const StringId* shorty, const TypeId* return_type, TypeList* parameters)
+ : shorty_(shorty), return_type_(return_type), parameters_(parameters)
+ { size_ = kProtoIdItemSize; }
~ProtoId() OVERRIDE { }
+ static size_t ItemSize() { return kProtoIdItemSize; }
+
const StringId* Shorty() const { return shorty_; }
const TypeId* ReturnType() const { return return_type_; }
- const std::vector<const TypeId*>& Parameters() const { return *parameters_; }
+ const TypeIdVector& Parameters() const { return *parameters_->GetTypeList(); }
void Accept(AbstractDispatcher* dispatch) const { dispatch->Dispatch(this); }
private:
const StringId* shorty_;
const TypeId* return_type_;
- std::unique_ptr<TypeIdVector> parameters_;
+ TypeList* parameters_;
+
DISALLOW_COPY_AND_ASSIGN(ProtoId);
};
-class FieldId : public Item {
+class FieldId : public IndexedItem {
public:
FieldId(const TypeId* klass, const TypeId* type, const StringId* name)
- : class_(klass), type_(type), name_(name) { }
+ : class_(klass), type_(type), name_(name) { size_ = kFieldIdItemSize; }
~FieldId() OVERRIDE { }
+ static size_t ItemSize() { return kFieldIdItemSize; }
+
const TypeId* Class() const { return class_; }
const TypeId* Type() const { return type_; }
const StringId* Name() const { return name_; }
@@ -281,15 +461,18 @@
const TypeId* class_;
const TypeId* type_;
const StringId* name_;
+
DISALLOW_COPY_AND_ASSIGN(FieldId);
};
-class MethodId : public Item {
+class MethodId : public IndexedItem {
public:
MethodId(const TypeId* klass, const ProtoId* proto, const StringId* name)
- : class_(klass), proto_(proto), name_(name) { }
+ : class_(klass), proto_(proto), name_(name) { size_ = kMethodIdItemSize; }
~MethodId() OVERRIDE { }
+ static size_t ItemSize() { return kMethodIdItemSize; }
+
const TypeId* Class() const { return class_; }
const ProtoId* Proto() const { return proto_; }
const StringId* Name() const { return name_; }
@@ -300,6 +483,7 @@
const TypeId* class_;
const ProtoId* proto_;
const StringId* name_;
+
DISALLOW_COPY_AND_ASSIGN(MethodId);
};
@@ -317,6 +501,7 @@
private:
uint32_t access_flags_;
const FieldId* field_id_;
+
DISALLOW_COPY_AND_ASSIGN(FieldItem);
};
@@ -330,93 +515,126 @@
uint32_t GetAccessFlags() const { return access_flags_; }
const MethodId* GetMethodId() const { return method_id_; }
- const CodeItem* GetCodeItem() const { return code_.get(); }
+ const CodeItem* GetCodeItem() const { return code_; }
void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
private:
uint32_t access_flags_;
const MethodId* method_id_;
- std::unique_ptr<const CodeItem> code_;
+ const CodeItem* code_;
+
DISALLOW_COPY_AND_ASSIGN(MethodItem);
};
using MethodItemVector = std::vector<std::unique_ptr<MethodItem>>;
-class ArrayItem : public Item {
+class EncodedValue {
public:
- class NameValuePair {
- public:
- NameValuePair(StringId* name, ArrayItem* value)
- : name_(name), value_(value) { }
-
- StringId* Name() const { return name_; }
- ArrayItem* Value() const { return value_.get(); }
-
- private:
- StringId* name_;
- std::unique_ptr<ArrayItem> value_;
- DISALLOW_COPY_AND_ASSIGN(NameValuePair);
- };
-
- struct ArrayItemVariant {
- public:
- union {
- bool bool_val_;
- int8_t byte_val_;
- int16_t short_val_;
- uint16_t char_val_;
- int32_t int_val_;
- int64_t long_val_;
- float float_val_;
- double double_val_;
- StringId* string_val_;
- FieldId* field_val_;
- MethodId* method_val_;
- } u_;
- std::unique_ptr<std::vector<std::unique_ptr<ArrayItem>>> annotation_array_val_;
- struct {
- StringId* string_;
- std::unique_ptr<std::vector<std::unique_ptr<NameValuePair>>> array_;
- } annotation_annotation_val_;
- };
-
- explicit ArrayItem(uint8_t type) : type_(type) { }
- ~ArrayItem() OVERRIDE { }
+ explicit EncodedValue(uint8_t type) : type_(type) { }
int8_t Type() const { return type_; }
- bool GetBoolean() const { return item_.u_.bool_val_; }
- int8_t GetByte() const { return item_.u_.byte_val_; }
- int16_t GetShort() const { return item_.u_.short_val_; }
- uint16_t GetChar() const { return item_.u_.char_val_; }
- int32_t GetInt() const { return item_.u_.int_val_; }
- int64_t GetLong() const { return item_.u_.long_val_; }
- float GetFloat() const { return item_.u_.float_val_; }
- double GetDouble() const { return item_.u_.double_val_; }
- StringId* GetStringId() const { return item_.u_.string_val_; }
- FieldId* GetFieldId() const { return item_.u_.field_val_; }
- MethodId* GetMethodId() const { return item_.u_.method_val_; }
- std::vector<std::unique_ptr<ArrayItem>>* GetAnnotationArray() const {
- return item_.annotation_array_val_.get();
- }
- StringId* GetAnnotationAnnotationString() const {
- return item_.annotation_annotation_val_.string_;
- }
- std::vector<std::unique_ptr<NameValuePair>>* GetAnnotationAnnotationNameValuePairArray() const {
- return item_.annotation_annotation_val_.array_.get();
- }
- // Used to construct the item union. Ugly, but necessary.
- ArrayItemVariant* GetArrayItemVariant() { return &item_; }
- void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
+ void SetBoolean(bool z) { u_.bool_val_ = z; }
+ void SetByte(int8_t b) { u_.byte_val_ = b; }
+ void SetShort(int16_t s) { u_.short_val_ = s; }
+ void SetChar(uint16_t c) { u_.char_val_ = c; }
+ void SetInt(int32_t i) { u_.int_val_ = i; }
+ void SetLong(int64_t l) { u_.long_val_ = l; }
+ void SetFloat(float f) { u_.float_val_ = f; }
+ void SetDouble(double d) { u_.double_val_ = d; }
+ void SetStringId(StringId* string_id) { u_.string_val_ = string_id; }
+ void SetTypeId(TypeId* type_id) { u_.type_val_ = type_id; }
+ void SetFieldId(FieldId* field_id) { u_.field_val_ = field_id; }
+ void SetMethodId(MethodId* method_id) { u_.method_val_ = method_id; }
+ void SetEncodedArray(EncodedArrayItem* encoded_array) { encoded_array_.reset(encoded_array); }
+ void SetEncodedAnnotation(EncodedAnnotation* encoded_annotation)
+ { encoded_annotation_.reset(encoded_annotation); }
+
+ bool GetBoolean() const { return u_.bool_val_; }
+ int8_t GetByte() const { return u_.byte_val_; }
+ int16_t GetShort() const { return u_.short_val_; }
+ uint16_t GetChar() const { return u_.char_val_; }
+ int32_t GetInt() const { return u_.int_val_; }
+ int64_t GetLong() const { return u_.long_val_; }
+ float GetFloat() const { return u_.float_val_; }
+ double GetDouble() const { return u_.double_val_; }
+ StringId* GetStringId() const { return u_.string_val_; }
+ TypeId* GetTypeId() const { return u_.type_val_; }
+ FieldId* GetFieldId() const { return u_.field_val_; }
+ MethodId* GetMethodId() const { return u_.method_val_; }
+ EncodedArrayItem* GetEncodedArray() const { return encoded_array_.get(); }
+ EncodedAnnotation* GetEncodedAnnotation() const { return encoded_annotation_.get(); }
+
+ EncodedAnnotation* ReleaseEncodedAnnotation() { return encoded_annotation_.release(); }
private:
uint8_t type_;
- ArrayItemVariant item_;
- DISALLOW_COPY_AND_ASSIGN(ArrayItem);
+ union {
+ bool bool_val_;
+ int8_t byte_val_;
+ int16_t short_val_;
+ uint16_t char_val_;
+ int32_t int_val_;
+ int64_t long_val_;
+ float float_val_;
+ double double_val_;
+ StringId* string_val_;
+ TypeId* type_val_;
+ FieldId* field_val_;
+ MethodId* method_val_;
+ } u_;
+ std::unique_ptr<EncodedArrayItem> encoded_array_;
+ std::unique_ptr<EncodedAnnotation> encoded_annotation_;
+
+ DISALLOW_COPY_AND_ASSIGN(EncodedValue);
};
-using ArrayItemVector = std::vector<std::unique_ptr<ArrayItem>>;
+using EncodedValueVector = std::vector<std::unique_ptr<EncodedValue>>;
+
+class AnnotationElement {
+ public:
+ AnnotationElement(StringId* name, EncodedValue* value) : name_(name), value_(value) { }
+
+ StringId* GetName() const { return name_; }
+ EncodedValue* GetValue() const { return value_.get(); }
+
+ private:
+ StringId* name_;
+ std::unique_ptr<EncodedValue> value_;
+
+ DISALLOW_COPY_AND_ASSIGN(AnnotationElement);
+};
+
+using AnnotationElementVector = std::vector<std::unique_ptr<AnnotationElement>>;
+
+class EncodedAnnotation {
+ public:
+ EncodedAnnotation(TypeId* type, AnnotationElementVector* elements)
+ : type_(type), elements_(elements) { }
+
+ TypeId* GetType() const { return type_; }
+ AnnotationElementVector* GetAnnotationElements() const { return elements_.get(); }
+
+ private:
+ TypeId* type_;
+ std::unique_ptr<AnnotationElementVector> elements_;
+
+ DISALLOW_COPY_AND_ASSIGN(EncodedAnnotation);
+};
+
+class EncodedArrayItem : public Item {
+ public:
+ explicit EncodedArrayItem(EncodedValueVector* encoded_values)
+ : encoded_values_(encoded_values) { }
+
+ EncodedValueVector* GetEncodedValues() const { return encoded_values_.get(); }
+
+ private:
+ std::unique_ptr<EncodedValueVector> encoded_values_;
+
+ DISALLOW_COPY_AND_ASSIGN(EncodedArrayItem);
+};
class ClassData : public Item {
public:
@@ -442,42 +660,43 @@
std::unique_ptr<FieldItemVector> instance_fields_;
std::unique_ptr<MethodItemVector> direct_methods_;
std::unique_ptr<MethodItemVector> virtual_methods_;
+
DISALLOW_COPY_AND_ASSIGN(ClassData);
};
-class ClassDef : public Item {
+class ClassDef : public IndexedItem {
public:
ClassDef(const TypeId* class_type,
uint32_t access_flags,
const TypeId* superclass,
- TypeIdVector* interfaces,
- uint32_t interfaces_offset,
+ TypeList* interfaces,
const StringId* source_file,
AnnotationsDirectoryItem* annotations,
- ArrayItemVector* static_values,
+ EncodedArrayItem* static_values,
ClassData* class_data)
: class_type_(class_type),
access_flags_(access_flags),
superclass_(superclass),
interfaces_(interfaces),
- interfaces_offset_(interfaces_offset),
source_file_(source_file),
annotations_(annotations),
static_values_(static_values),
- class_data_(class_data) { }
+ class_data_(class_data) { size_ = kClassDefItemSize; }
~ClassDef() OVERRIDE { }
+ static size_t ItemSize() { return kClassDefItemSize; }
+
const TypeId* ClassType() const { return class_type_; }
uint32_t GetAccessFlags() const { return access_flags_; }
const TypeId* Superclass() const { return superclass_; }
- TypeIdVector* Interfaces() { return interfaces_.get(); }
- uint32_t InterfacesOffset() const { return interfaces_offset_; }
- void SetInterfacesOffset(uint32_t new_offset) { interfaces_offset_ = new_offset; }
+ const TypeIdVector* Interfaces()
+ { return interfaces_ == nullptr ? nullptr: interfaces_->GetTypeList(); }
+ uint32_t InterfacesOffset() { return interfaces_ == nullptr ? 0 : interfaces_->GetOffset(); }
const StringId* SourceFile() const { return source_file_; }
- AnnotationsDirectoryItem* Annotations() const { return annotations_.get(); }
- ArrayItemVector* StaticValues() { return static_values_.get(); }
- ClassData* GetClassData() { return class_data_.get(); }
+ AnnotationsDirectoryItem* Annotations() const { return annotations_; }
+ EncodedArrayItem* StaticValues() { return static_values_; }
+ ClassData* GetClassData() { return class_data_; }
MethodItem* GenerateMethodItem(Header& header, ClassDataItemIterator& cdii);
@@ -487,12 +706,12 @@
const TypeId* class_type_;
uint32_t access_flags_;
const TypeId* superclass_;
- std::unique_ptr<TypeIdVector> interfaces_;
- uint32_t interfaces_offset_;
+ TypeList* interfaces_;
const StringId* source_file_;
- std::unique_ptr<AnnotationsDirectoryItem> annotations_;
- std::unique_ptr<ArrayItemVector> static_values_;
- std::unique_ptr<ClassData> class_data_;
+ AnnotationsDirectoryItem* annotations_;
+ EncodedArrayItem* static_values_;
+ ClassData* class_data_;
+
DISALLOW_COPY_AND_ASSIGN(ClassDef);
};
@@ -506,6 +725,7 @@
private:
const TypeId* type_id_;
uint32_t address_;
+
DISALLOW_COPY_AND_ASSIGN(CatchHandler);
};
@@ -527,6 +747,7 @@
uint32_t start_addr_;
uint16_t insn_count_;
std::unique_ptr<CatchHandlerVector> handlers_;
+
DISALLOW_COPY_AND_ASSIGN(TryItem);
};
@@ -555,7 +776,7 @@
uint16_t InsSize() const { return ins_size_; }
uint16_t OutsSize() const { return outs_size_; }
uint16_t TriesSize() const { return tries_ == nullptr ? 0 : tries_->size(); }
- DebugInfoItem* DebugInfo() const { return debug_info_.get(); }
+ DebugInfoItem* DebugInfo() const { return debug_info_; }
uint32_t InsnsSize() const { return insns_size_; }
uint16_t* Insns() const { return insns_.get(); }
TryItemVector* Tries() const { return tries_.get(); }
@@ -566,14 +787,14 @@
uint16_t registers_size_;
uint16_t ins_size_;
uint16_t outs_size_;
- std::unique_ptr<DebugInfoItem> debug_info_;
+ DebugInfoItem* debug_info_;
uint32_t insns_size_;
std::unique_ptr<uint16_t[]> insns_;
std::unique_ptr<TryItemVector> tries_;
+
DISALLOW_COPY_AND_ASSIGN(CodeItem);
};
-
struct PositionInfo {
PositionInfo(uint32_t address, uint32_t line) : address_(address), line_(line) { }
@@ -617,39 +838,60 @@
private:
PositionInfoVector positions_;
LocalInfoVector locals_;
+
DISALLOW_COPY_AND_ASSIGN(DebugInfoItem);
};
-class AnnotationItem {
+class AnnotationItem : public Item {
public:
- AnnotationItem(uint8_t visibility, ArrayItem* item) : visibility_(visibility), item_(item) { }
+ AnnotationItem(uint8_t visibility, EncodedAnnotation* annotation)
+ : visibility_(visibility), annotation_(annotation) { }
uint8_t GetVisibility() const { return visibility_; }
- ArrayItem* GetItem() const { return item_.get(); }
-
- private:
- uint8_t visibility_;
- std::unique_ptr<ArrayItem> item_;
- DISALLOW_COPY_AND_ASSIGN(AnnotationItem);
-};
-
-using AnnotationItemVector = std::vector<std::unique_ptr<AnnotationItem>>;
-
-class AnnotationSetItem : public Item {
- public:
- explicit AnnotationSetItem(AnnotationItemVector* items) : items_(items) { }
- ~AnnotationSetItem() OVERRIDE { }
-
- AnnotationItemVector* GetItems() { return items_.get(); }
+ EncodedAnnotation* GetAnnotation() const { return annotation_.get(); }
void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
private:
- std::unique_ptr<AnnotationItemVector> items_;
+ uint8_t visibility_;
+ std::unique_ptr<EncodedAnnotation> annotation_;
+
+ DISALLOW_COPY_AND_ASSIGN(AnnotationItem);
+};
+
+class AnnotationSetItem : public Item {
+ public:
+ explicit AnnotationSetItem(std::vector<AnnotationItem*>* items) : items_(items) {
+ size_ = sizeof(uint32_t) + items->size() * sizeof(uint32_t);
+ }
+ ~AnnotationSetItem() OVERRIDE { }
+
+ std::vector<AnnotationItem*>* GetItems() { return items_.get(); }
+
+ void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
+
+ private:
+ std::unique_ptr<std::vector<AnnotationItem*>> items_;
+
DISALLOW_COPY_AND_ASSIGN(AnnotationSetItem);
};
-using AnnotationSetItemVector = std::vector<std::unique_ptr<AnnotationSetItem>>;
+class AnnotationSetRefList : public Item {
+ public:
+ explicit AnnotationSetRefList(std::vector<AnnotationSetItem*>* items) : items_(items) {
+ size_ = sizeof(uint32_t) + items->size() * sizeof(uint32_t);
+ }
+ ~AnnotationSetRefList() OVERRIDE { }
+
+ std::vector<AnnotationSetItem*>* GetItems() { return items_.get(); }
+
+ void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
+
+ private:
+ std::unique_ptr<std::vector<AnnotationSetItem*>> items_;
+
+ DISALLOW_COPY_AND_ASSIGN(AnnotationSetRefList);
+};
class FieldAnnotation {
public:
@@ -657,11 +899,12 @@
: field_id_(field_id), annotation_set_item_(annotation_set_item) { }
FieldId* GetFieldId() const { return field_id_; }
- AnnotationSetItem* GetAnnotationSetItem() const { return annotation_set_item_.get(); }
+ AnnotationSetItem* GetAnnotationSetItem() const { return annotation_set_item_; }
private:
FieldId* field_id_;
- std::unique_ptr<AnnotationSetItem> annotation_set_item_;
+ AnnotationSetItem* annotation_set_item_;
+
DISALLOW_COPY_AND_ASSIGN(FieldAnnotation);
};
@@ -673,11 +916,12 @@
: method_id_(method_id), annotation_set_item_(annotation_set_item) { }
MethodId* GetMethodId() const { return method_id_; }
- AnnotationSetItem* GetAnnotationSetItem() const { return annotation_set_item_.get(); }
+ AnnotationSetItem* GetAnnotationSetItem() const { return annotation_set_item_; }
private:
MethodId* method_id_;
- std::unique_ptr<AnnotationSetItem> annotation_set_item_;
+ AnnotationSetItem* annotation_set_item_;
+
DISALLOW_COPY_AND_ASSIGN(MethodAnnotation);
};
@@ -685,15 +929,16 @@
class ParameterAnnotation {
public:
- ParameterAnnotation(MethodId* method_id, AnnotationSetItemVector* annotations)
+ ParameterAnnotation(MethodId* method_id, AnnotationSetRefList* annotations)
: method_id_(method_id), annotations_(annotations) { }
MethodId* GetMethodId() const { return method_id_; }
- AnnotationSetItemVector* GetAnnotations() { return annotations_.get(); }
+ AnnotationSetRefList* GetAnnotations() { return annotations_; }
private:
MethodId* method_id_;
- std::unique_ptr<AnnotationSetItemVector> annotations_;
+ AnnotationSetRefList* annotations_;
+
DISALLOW_COPY_AND_ASSIGN(ParameterAnnotation);
};
@@ -710,7 +955,7 @@
method_annotations_(method_annotations),
parameter_annotations_(parameter_annotations) { }
- AnnotationSetItem* GetClassAnnotation() const { return class_annotation_.get(); }
+ AnnotationSetItem* GetClassAnnotation() const { return class_annotation_; }
FieldAnnotationVector* GetFieldAnnotations() { return field_annotations_.get(); }
MethodAnnotationVector* GetMethodAnnotations() { return method_annotations_.get(); }
ParameterAnnotationVector* GetParameterAnnotations() { return parameter_annotations_.get(); }
@@ -718,10 +963,11 @@
void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
private:
- std::unique_ptr<AnnotationSetItem> class_annotation_;
+ AnnotationSetItem* class_annotation_;
std::unique_ptr<FieldAnnotationVector> field_annotations_;
std::unique_ptr<MethodAnnotationVector> method_annotations_;
std::unique_ptr<ParameterAnnotationVector> parameter_annotations_;
+
DISALLOW_COPY_AND_ASSIGN(AnnotationsDirectoryItem);
};
diff --git a/dexlayout/dex_ir_builder.cc b/dexlayout/dex_ir_builder.cc
index 30f57d9..e6868d7 100644
--- a/dexlayout/dex_ir_builder.cc
+++ b/dexlayout/dex_ir_builder.cc
@@ -24,401 +24,6 @@
namespace art {
namespace dex_ir {
-namespace {
-
-static uint64_t ReadVarWidth(const uint8_t** data, uint8_t length, bool sign_extend) {
- uint64_t value = 0;
- for (uint32_t i = 0; i <= length; i++) {
- value |= static_cast<uint64_t>(*(*data)++) << (i * 8);
- }
- if (sign_extend) {
- int shift = (7 - length) * 8;
- return (static_cast<int64_t>(value) << shift) >> shift;
- }
- return value;
-}
-
-// Prototype to break cyclic dependency.
-void ReadArrayItemVariant(Header& header,
- const uint8_t** data,
- uint8_t type,
- uint8_t length,
- ArrayItem::ArrayItemVariant* item);
-
-ArrayItem* ReadArrayItem(Header& header, const uint8_t** data, uint8_t type, uint8_t length) {
- ArrayItem* item = new ArrayItem(type);
- ReadArrayItemVariant(header, data, type, length, item->GetArrayItemVariant());
- return item;
-}
-
-ArrayItem* ReadArrayItem(Header& header, const uint8_t** data) {
- const uint8_t encoded_value = *(*data)++;
- const uint8_t type = encoded_value & 0x1f;
- ArrayItem* item = new ArrayItem(type);
- ReadArrayItemVariant(header, data, type, encoded_value >> 5, item->GetArrayItemVariant());
- return item;
-}
-
-void ReadArrayItemVariant(Header& header,
- const uint8_t** data,
- uint8_t type,
- uint8_t length,
- ArrayItem::ArrayItemVariant* item) {
- switch (type) {
- case DexFile::kDexAnnotationByte:
- item->u_.byte_val_ = static_cast<int8_t>(ReadVarWidth(data, length, false));
- break;
- case DexFile::kDexAnnotationShort:
- item->u_.short_val_ = static_cast<int16_t>(ReadVarWidth(data, length, true));
- break;
- case DexFile::kDexAnnotationChar:
- item->u_.char_val_ = static_cast<uint16_t>(ReadVarWidth(data, length, false));
- break;
- case DexFile::kDexAnnotationInt:
- item->u_.int_val_ = static_cast<int32_t>(ReadVarWidth(data, length, true));
- break;
- case DexFile::kDexAnnotationLong:
- item->u_.long_val_ = static_cast<int64_t>(ReadVarWidth(data, length, true));
- break;
- case DexFile::kDexAnnotationFloat: {
- // Fill on right.
- union {
- float f;
- uint32_t data;
- } conv;
- conv.data = static_cast<uint32_t>(ReadVarWidth(data, length, false)) << (3 - length) * 8;
- item->u_.float_val_ = conv.f;
- break;
- }
- case DexFile::kDexAnnotationDouble: {
- // Fill on right.
- union {
- double d;
- uint64_t data;
- } conv;
- conv.data = ReadVarWidth(data, length, false) << (7 - length) * 8;
- item->u_.double_val_ = conv.d;
- break;
- }
- case DexFile::kDexAnnotationString: {
- const uint32_t string_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
- item->u_.string_val_ = header.StringIds()[string_index].get();
- break;
- }
- case DexFile::kDexAnnotationType: {
- const uint32_t string_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
- item->u_.string_val_ = header.TypeIds()[string_index]->GetStringId();
- break;
- }
- case DexFile::kDexAnnotationField:
- case DexFile::kDexAnnotationEnum: {
- const uint32_t field_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
- item->u_.field_val_ = header.FieldIds()[field_index].get();
- break;
- }
- case DexFile::kDexAnnotationMethod: {
- const uint32_t method_index = static_cast<uint32_t>(ReadVarWidth(data, length, false));
- item->u_.method_val_ = header.MethodIds()[method_index].get();
- break;
- }
- case DexFile::kDexAnnotationArray: {
- item->annotation_array_val_.reset(new ArrayItemVector());
- // Decode all elements.
- const uint32_t size = DecodeUnsignedLeb128(data);
- for (uint32_t i = 0; i < size; i++) {
- item->annotation_array_val_->push_back(
- std::unique_ptr<ArrayItem>(ReadArrayItem(header, data)));
- }
- break;
- }
- case DexFile::kDexAnnotationAnnotation: {
- const uint32_t type_idx = DecodeUnsignedLeb128(data);
- item->annotation_annotation_val_.string_ = header.TypeIds()[type_idx]->GetStringId();
- item->annotation_annotation_val_.array_.reset(
- new std::vector<std::unique_ptr<ArrayItem::NameValuePair>>());
- // Decode all name=value pairs.
- const uint32_t size = DecodeUnsignedLeb128(data);
- for (uint32_t i = 0; i < size; i++) {
- const uint32_t name_index = DecodeUnsignedLeb128(data);
- item->annotation_annotation_val_.array_->push_back(
- std::unique_ptr<ArrayItem::NameValuePair>(
- new ArrayItem::NameValuePair(header.StringIds()[name_index].get(),
- ReadArrayItem(header, data))));
- }
- break;
- }
- case DexFile::kDexAnnotationNull:
- break;
- case DexFile::kDexAnnotationBoolean:
- item->u_.bool_val_ = (length != 0);
- break;
- default:
- break;
- }
-}
-
-static bool GetPositionsCb(void* context, const DexFile::PositionInfo& entry) {
- DebugInfoItem* debug_info = reinterpret_cast<DebugInfoItem*>(context);
- PositionInfoVector& positions = debug_info->GetPositionInfo();
- positions.push_back(std::unique_ptr<PositionInfo>(new PositionInfo(entry.address_, entry.line_)));
- return false;
-}
-
-static void GetLocalsCb(void* context, const DexFile::LocalInfo& entry) {
- DebugInfoItem* debug_info = reinterpret_cast<DebugInfoItem*>(context);
- LocalInfoVector& locals = debug_info->GetLocalInfo();
- const char* name = entry.name_ != nullptr ? entry.name_ : "(null)";
- const char* signature = entry.signature_ != nullptr ? entry.signature_ : "";
- locals.push_back(std::unique_ptr<LocalInfo>(
- new LocalInfo(name, entry.descriptor_, signature, entry.start_address_,
- entry.end_address_, entry.reg_)));
-}
-
-CodeItem* ReadCodeItem(const DexFile& dex_file,
- const DexFile::CodeItem& disk_code_item,
- Header& header) {
- uint16_t registers_size = disk_code_item.registers_size_;
- uint16_t ins_size = disk_code_item.ins_size_;
- uint16_t outs_size = disk_code_item.outs_size_;
- uint32_t tries_size = disk_code_item.tries_size_;
-
- const uint8_t* debug_info_stream = dex_file.GetDebugInfoStream(&disk_code_item);
- DebugInfoItem* debug_info = nullptr;
- if (debug_info_stream != nullptr) {
- debug_info = new DebugInfoItem();
- }
-
- uint32_t insns_size = disk_code_item.insns_size_in_code_units_;
- uint16_t* insns = new uint16_t[insns_size];
- memcpy(insns, disk_code_item.insns_, insns_size * sizeof(uint16_t));
-
- TryItemVector* tries = nullptr;
- if (tries_size > 0) {
- tries = new TryItemVector();
- for (uint32_t i = 0; i < tries_size; ++i) {
- const DexFile::TryItem* disk_try_item = dex_file.GetTryItems(disk_code_item, i);
- uint32_t start_addr = disk_try_item->start_addr_;
- uint16_t insn_count = disk_try_item->insn_count_;
- CatchHandlerVector* handlers = new CatchHandlerVector();
- for (CatchHandlerIterator it(disk_code_item, *disk_try_item); it.HasNext(); it.Next()) {
- const uint16_t type_index = it.GetHandlerTypeIndex();
- const TypeId* type_id = header.GetTypeIdOrNullPtr(type_index);
- handlers->push_back(std::unique_ptr<const CatchHandler>(
- new CatchHandler(type_id, it.GetHandlerAddress())));
- }
- TryItem* try_item = new TryItem(start_addr, insn_count, handlers);
- tries->push_back(std::unique_ptr<const TryItem>(try_item));
- }
- }
- return new CodeItem(registers_size, ins_size, outs_size, debug_info, insns_size, insns, tries);
-}
-
-MethodItem* GenerateMethodItem(const DexFile& dex_file,
- dex_ir::Header& header,
- ClassDataItemIterator& cdii) {
- MethodId* method_item = header.MethodIds()[cdii.GetMemberIndex()].get();
- uint32_t access_flags = cdii.GetRawMemberAccessFlags();
- const DexFile::CodeItem* disk_code_item = cdii.GetMethodCodeItem();
- CodeItem* code_item = nullptr;
- DebugInfoItem* debug_info = nullptr;
- if (disk_code_item != nullptr) {
- code_item = ReadCodeItem(dex_file, *disk_code_item, header);
- code_item->SetOffset(cdii.GetMethodCodeItemOffset());
- debug_info = code_item->DebugInfo();
- }
- if (debug_info != nullptr) {
- bool is_static = (access_flags & kAccStatic) != 0;
- dex_file.DecodeDebugLocalInfo(
- disk_code_item, is_static, cdii.GetMemberIndex(), GetLocalsCb, debug_info);
- dex_file.DecodeDebugPositionInfo(disk_code_item, GetPositionsCb, debug_info);
- }
- return new MethodItem(access_flags, method_item, code_item);
-}
-
-AnnotationSetItem* ReadAnnotationSetItem(const DexFile& dex_file,
- const DexFile::AnnotationSetItem& disk_annotations_item,
- Header& header) {
- if (disk_annotations_item.size_ == 0) {
- return nullptr;
- }
- AnnotationItemVector* items = new AnnotationItemVector();
- for (uint32_t i = 0; i < disk_annotations_item.size_; ++i) {
- const DexFile::AnnotationItem* annotation =
- dex_file.GetAnnotationItem(&disk_annotations_item, i);
- if (annotation == nullptr) {
- continue;
- }
- uint8_t visibility = annotation->visibility_;
- const uint8_t* annotation_data = annotation->annotation_;
- ArrayItem* array_item =
- ReadArrayItem(header, &annotation_data, DexFile::kDexAnnotationAnnotation, 0);
- items->push_back(std::unique_ptr<AnnotationItem>(new AnnotationItem(visibility, array_item)));
- }
- return new AnnotationSetItem(items);
-}
-
-ParameterAnnotation* ReadParameterAnnotation(
- const DexFile& dex_file,
- MethodId* method_id,
- const DexFile::AnnotationSetRefList* annotation_set_ref_list,
- Header& header) {
- AnnotationSetItemVector* annotations = new AnnotationSetItemVector();
- for (uint32_t i = 0; i < annotation_set_ref_list->size_; ++i) {
- const DexFile::AnnotationSetItem* annotation_set_item =
- dex_file.GetSetRefItemItem(&annotation_set_ref_list->list_[i]);
- annotations->push_back(std::unique_ptr<AnnotationSetItem>(
- ReadAnnotationSetItem(dex_file, *annotation_set_item, header)));
- }
- return new ParameterAnnotation(method_id, annotations);
-}
-
-AnnotationsDirectoryItem* ReadAnnotationsDirectoryItem(
- const DexFile& dex_file,
- const DexFile::AnnotationsDirectoryItem* disk_annotations_item,
- Header& header) {
- const DexFile::AnnotationSetItem* class_set_item =
- dex_file.GetClassAnnotationSet(disk_annotations_item);
- AnnotationSetItem* class_annotation = nullptr;
- if (class_set_item != nullptr) {
- class_annotation = ReadAnnotationSetItem(dex_file, *class_set_item, header);
- }
- const DexFile::FieldAnnotationsItem* fields =
- dex_file.GetFieldAnnotations(disk_annotations_item);
- FieldAnnotationVector* field_annotations = nullptr;
- if (fields != nullptr) {
- field_annotations = new FieldAnnotationVector();
- for (uint32_t i = 0; i < disk_annotations_item->fields_size_; ++i) {
- FieldId* field_id = header.FieldIds()[fields[i].field_idx_].get();
- const DexFile::AnnotationSetItem* field_set_item =
- dex_file.GetFieldAnnotationSetItem(fields[i]);
- AnnotationSetItem* annotation_set_item =
- ReadAnnotationSetItem(dex_file, *field_set_item, header);
- field_annotations->push_back(std::unique_ptr<FieldAnnotation>(
- new FieldAnnotation(field_id, annotation_set_item)));
- }
- }
- const DexFile::MethodAnnotationsItem* methods =
- dex_file.GetMethodAnnotations(disk_annotations_item);
- MethodAnnotationVector* method_annotations = nullptr;
- if (methods != nullptr) {
- method_annotations = new MethodAnnotationVector();
- for (uint32_t i = 0; i < disk_annotations_item->methods_size_; ++i) {
- MethodId* method_id = header.MethodIds()[methods[i].method_idx_].get();
- const DexFile::AnnotationSetItem* method_set_item =
- dex_file.GetMethodAnnotationSetItem(methods[i]);
- AnnotationSetItem* annotation_set_item =
- ReadAnnotationSetItem(dex_file, *method_set_item, header);
- method_annotations->push_back(std::unique_ptr<MethodAnnotation>(
- new MethodAnnotation(method_id, annotation_set_item)));
- }
- }
- const DexFile::ParameterAnnotationsItem* parameters =
- dex_file.GetParameterAnnotations(disk_annotations_item);
- ParameterAnnotationVector* parameter_annotations = nullptr;
- if (parameters != nullptr) {
- parameter_annotations = new ParameterAnnotationVector();
- for (uint32_t i = 0; i < disk_annotations_item->parameters_size_; ++i) {
- MethodId* method_id = header.MethodIds()[parameters[i].method_idx_].get();
- const DexFile::AnnotationSetRefList* list =
- dex_file.GetParameterAnnotationSetRefList(¶meters[i]);
- parameter_annotations->push_back(std::unique_ptr<ParameterAnnotation>(
- ReadParameterAnnotation(dex_file, method_id, list, header)));
- }
- }
-
- return new AnnotationsDirectoryItem(class_annotation,
- field_annotations,
- method_annotations,
- parameter_annotations);
-}
-
-ClassDef* ReadClassDef(const DexFile& dex_file,
- const DexFile::ClassDef& disk_class_def,
- Header& header) {
- const TypeId* class_type = header.TypeIds()[disk_class_def.class_idx_].get();
- uint32_t access_flags = disk_class_def.access_flags_;
- const TypeId* superclass = header.GetTypeIdOrNullPtr(disk_class_def.superclass_idx_);
-
- TypeIdVector* interfaces = nullptr;
- const DexFile::TypeList* type_list = dex_file.GetInterfacesList(disk_class_def);
- uint32_t interfaces_offset = disk_class_def.interfaces_off_;
- if (type_list != nullptr) {
- interfaces = new TypeIdVector();
- for (uint32_t index = 0; index < type_list->Size(); ++index) {
- interfaces->push_back(header.TypeIds()[type_list->GetTypeItem(index).type_idx_].get());
- }
- }
- const StringId* source_file = header.GetStringIdOrNullPtr(disk_class_def.source_file_idx_);
- // Annotations.
- AnnotationsDirectoryItem* annotations = nullptr;
- const DexFile::AnnotationsDirectoryItem* disk_annotations_directory_item =
- dex_file.GetAnnotationsDirectory(disk_class_def);
- if (disk_annotations_directory_item != nullptr) {
- annotations = ReadAnnotationsDirectoryItem(dex_file, disk_annotations_directory_item, header);
- annotations->SetOffset(disk_class_def.annotations_off_);
- }
- // Static field initializers.
- ArrayItemVector* static_values = nullptr;
- const uint8_t* static_data = dex_file.GetEncodedStaticFieldValuesArray(disk_class_def);
- if (static_data != nullptr) {
- uint32_t static_value_count = static_data == nullptr ? 0 : DecodeUnsignedLeb128(&static_data);
- if (static_value_count > 0) {
- static_values = new ArrayItemVector();
- for (uint32_t i = 0; i < static_value_count; ++i) {
- static_values->push_back(std::unique_ptr<ArrayItem>(ReadArrayItem(header, &static_data)));
- }
- }
- }
- // Read the fields and methods defined by the class, resolving the circular reference from those
- // to classes by setting class at the same time.
- const uint8_t* encoded_data = dex_file.GetClassData(disk_class_def);
- ClassData* class_data = nullptr;
- if (encoded_data != nullptr) {
- uint32_t offset = disk_class_def.class_data_off_;
- ClassDataItemIterator cdii(dex_file, encoded_data);
- // Static fields.
- FieldItemVector* static_fields = new FieldItemVector();
- for (uint32_t i = 0; cdii.HasNextStaticField(); i++, cdii.Next()) {
- FieldId* field_item = header.FieldIds()[cdii.GetMemberIndex()].get();
- uint32_t access_flags = cdii.GetRawMemberAccessFlags();
- static_fields->push_back(std::unique_ptr<FieldItem>(new FieldItem(access_flags, field_item)));
- }
- // Instance fields.
- FieldItemVector* instance_fields = new FieldItemVector();
- for (uint32_t i = 0; cdii.HasNextInstanceField(); i++, cdii.Next()) {
- FieldId* field_item = header.FieldIds()[cdii.GetMemberIndex()].get();
- uint32_t access_flags = cdii.GetRawMemberAccessFlags();
- instance_fields->push_back(
- std::unique_ptr<FieldItem>(new FieldItem(access_flags, field_item)));
- }
- // Direct methods.
- MethodItemVector* direct_methods = new MethodItemVector();
- for (uint32_t i = 0; cdii.HasNextDirectMethod(); i++, cdii.Next()) {
- direct_methods->push_back(
- std::unique_ptr<MethodItem>(GenerateMethodItem(dex_file, header, cdii)));
- }
- // Virtual methods.
- MethodItemVector* virtual_methods = new MethodItemVector();
- for (uint32_t i = 0; cdii.HasNextVirtualMethod(); i++, cdii.Next()) {
- virtual_methods->push_back(
- std::unique_ptr<MethodItem>(GenerateMethodItem(dex_file, header, cdii)));
- }
- class_data = new ClassData(static_fields, instance_fields, direct_methods, virtual_methods);
- class_data->SetOffset(offset);
- }
- return new ClassDef(class_type,
- access_flags,
- superclass,
- interfaces,
- interfaces_offset,
- source_file,
- annotations,
- static_values,
- class_data);
-}
-
-} // namespace
-
Header* DexIrBuilder(const DexFile& dex_file) {
const DexFile::Header& disk_header = dex_file.GetHeader();
Header* header = new Header(disk_header.magic_,
@@ -431,73 +36,37 @@
disk_header.link_off_,
disk_header.data_size_,
disk_header.data_off_);
+ Collections& collections = header->GetCollections();
// Walk the rest of the header fields.
// StringId table.
- std::vector<std::unique_ptr<StringId>>& string_ids = header->StringIds();
- header->SetStringIdsOffset(disk_header.string_ids_off_);
+ collections.SetStringIdsOffset(disk_header.string_ids_off_);
for (uint32_t i = 0; i < dex_file.NumStringIds(); ++i) {
- const DexFile::StringId& disk_string_id = dex_file.GetStringId(i);
- StringId* string_id = new StringId(dex_file.GetStringData(disk_string_id));
- string_id->SetOffset(i);
- string_ids.push_back(std::unique_ptr<StringId>(string_id));
+ collections.CreateStringId(dex_file, i);
}
// TypeId table.
- std::vector<std::unique_ptr<TypeId>>& type_ids = header->TypeIds();
- header->SetTypeIdsOffset(disk_header.type_ids_off_);
+ collections.SetTypeIdsOffset(disk_header.type_ids_off_);
for (uint32_t i = 0; i < dex_file.NumTypeIds(); ++i) {
- const DexFile::TypeId& disk_type_id = dex_file.GetTypeId(i);
- TypeId* type_id = new TypeId(header->StringIds()[disk_type_id.descriptor_idx_].get());
- type_id->SetOffset(i);
- type_ids.push_back(std::unique_ptr<TypeId>(type_id));
+ collections.CreateTypeId(dex_file, i);
}
// ProtoId table.
- std::vector<std::unique_ptr<ProtoId>>& proto_ids = header->ProtoIds();
- header->SetProtoIdsOffset(disk_header.proto_ids_off_);
+ collections.SetProtoIdsOffset(disk_header.proto_ids_off_);
for (uint32_t i = 0; i < dex_file.NumProtoIds(); ++i) {
- const DexFile::ProtoId& disk_proto_id = dex_file.GetProtoId(i);
- // Build the parameter type vector.
- TypeIdVector* parameters = new TypeIdVector();
- DexFileParameterIterator dfpi(dex_file, disk_proto_id);
- while (dfpi.HasNext()) {
- parameters->push_back(header->TypeIds()[dfpi.GetTypeIdx()].get());
- dfpi.Next();
- }
- ProtoId* proto_id = new ProtoId(header->StringIds()[disk_proto_id.shorty_idx_].get(),
- header->TypeIds()[disk_proto_id.return_type_idx_].get(),
- parameters);
- proto_id->SetOffset(i);
- proto_ids.push_back(std::unique_ptr<ProtoId>(proto_id));
+ collections.CreateProtoId(dex_file, i);
}
// FieldId table.
- std::vector<std::unique_ptr<FieldId>>& field_ids = header->FieldIds();
- header->SetFieldIdsOffset(disk_header.field_ids_off_);
+ collections.SetFieldIdsOffset(disk_header.field_ids_off_);
for (uint32_t i = 0; i < dex_file.NumFieldIds(); ++i) {
- const DexFile::FieldId& disk_field_id = dex_file.GetFieldId(i);
- FieldId* field_id = new FieldId(header->TypeIds()[disk_field_id.class_idx_].get(),
- header->TypeIds()[disk_field_id.type_idx_].get(),
- header->StringIds()[disk_field_id.name_idx_].get());
- field_id->SetOffset(i);
- field_ids.push_back(std::unique_ptr<FieldId>(field_id));
+ collections.CreateFieldId(dex_file, i);
}
// MethodId table.
- std::vector<std::unique_ptr<MethodId>>& method_ids = header->MethodIds();
- header->SetMethodIdsOffset(disk_header.method_ids_off_);
+ collections.SetMethodIdsOffset(disk_header.method_ids_off_);
for (uint32_t i = 0; i < dex_file.NumMethodIds(); ++i) {
- const DexFile::MethodId& disk_method_id = dex_file.GetMethodId(i);
- MethodId* method_id = new MethodId(header->TypeIds()[disk_method_id.class_idx_].get(),
- header->ProtoIds()[disk_method_id.proto_idx_].get(),
- header->StringIds()[disk_method_id.name_idx_].get());
- method_id->SetOffset(i);
- method_ids.push_back(std::unique_ptr<MethodId>(method_id));
+ collections.CreateMethodId(dex_file, i);
}
// ClassDef table.
- std::vector<std::unique_ptr<ClassDef>>& class_defs = header->ClassDefs();
- header->SetClassDefsOffset(disk_header.class_defs_off_);
+ collections.SetClassDefsOffset(disk_header.class_defs_off_);
for (uint32_t i = 0; i < dex_file.NumClassDefs(); ++i) {
- const DexFile::ClassDef& disk_class_def = dex_file.GetClassDef(i);
- ClassDef* class_def = ReadClassDef(dex_file, disk_class_def, *header);
- class_def->SetOffset(i);
- class_defs.push_back(std::unique_ptr<ClassDef>(class_def));
+ collections.CreateClassDef(dex_file, i);
}
return header;
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index 3a3f417..6f34a33 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -30,9 +30,11 @@
#include <sstream>
#include <vector>
+#include "base/unix_file/fd_file.h"
#include "dex_ir_builder.h"
#include "dex_file-inl.h"
#include "dex_instruction-inl.h"
+#include "os.h"
#include "utils.h"
namespace art {
@@ -348,10 +350,26 @@
} // for
}
+// Forward declare to resolve circular dependence.
+static void DumpEncodedValue(const dex_ir::EncodedValue* data);
+
+/*
+ * Dumps encoded annotation.
+ */
+static void DumpEncodedAnnotation(dex_ir::EncodedAnnotation* annotation) {
+ fputs(annotation->GetType()->GetStringId()->Data(), out_file_);
+ // Display all name=value pairs.
+ for (auto& subannotation : *annotation->GetAnnotationElements()) {
+ fputc(' ', out_file_);
+ fputs(subannotation->GetName()->Data(), out_file_);
+ fputc('=', out_file_);
+ DumpEncodedValue(subannotation->GetValue());
+ }
+}
/*
* Dumps encoded value.
*/
-static void DumpEncodedValue(const dex_ir::ArrayItem* data) {
+static void DumpEncodedValue(const dex_ir::EncodedValue* data) {
switch (data->Type()) {
case DexFile::kDexAnnotationByte:
fprintf(out_file_, "%" PRId8, data->GetByte());
@@ -386,8 +404,8 @@
break;
}
case DexFile::kDexAnnotationType: {
- dex_ir::StringId* string_id = data->GetStringId();
- fputs(string_id->Data(), out_file_);
+ dex_ir::TypeId* type_id = data->GetTypeId();
+ fputs(type_id->GetStringId()->Data(), out_file_);
break;
}
case DexFile::kDexAnnotationField:
@@ -404,22 +422,15 @@
case DexFile::kDexAnnotationArray: {
fputc('{', out_file_);
// Display all elements.
- for (auto& array : *data->GetAnnotationArray()) {
+ for (auto& value : *data->GetEncodedArray()->GetEncodedValues()) {
fputc(' ', out_file_);
- DumpEncodedValue(array.get());
+ DumpEncodedValue(value.get());
}
fputs(" }", out_file_);
break;
}
case DexFile::kDexAnnotationAnnotation: {
- fputs(data->GetAnnotationAnnotationString()->Data(), out_file_);
- // Display all name=value pairs.
- for (auto& subannotation : *data->GetAnnotationAnnotationNameValuePairArray()) {
- fputc(' ', out_file_);
- fputs(subannotation->Name()->Data(), out_file_);
- fputc('=', out_file_);
- DumpEncodedValue(subannotation->Value());
- }
+ DumpEncodedAnnotation(data->GetEncodedAnnotation());
break;
}
case DexFile::kDexAnnotationNull:
@@ -437,8 +448,9 @@
/*
* Dumps the file header.
*/
-static void DumpFileHeader(const dex_ir::Header* header) {
+static void DumpFileHeader(dex_ir::Header* header) {
char sanitized[8 * 2 + 1];
+ dex_ir::Collections& collections = header->GetCollections();
fprintf(out_file_, "DEX file header:\n");
Asciify(sanitized, header->Magic(), 8);
fprintf(out_file_, "magic : '%s'\n", sanitized);
@@ -452,24 +464,24 @@
fprintf(out_file_, "link_size : %d\n", header->LinkSize());
fprintf(out_file_, "link_off : %d (0x%06x)\n",
header->LinkOffset(), header->LinkOffset());
- fprintf(out_file_, "string_ids_size : %d\n", header->StringIdsSize());
+ fprintf(out_file_, "string_ids_size : %d\n", collections.StringIdsSize());
fprintf(out_file_, "string_ids_off : %d (0x%06x)\n",
- header->StringIdsOffset(), header->StringIdsOffset());
- fprintf(out_file_, "type_ids_size : %d\n", header->TypeIdsSize());
+ collections.StringIdsOffset(), collections.StringIdsOffset());
+ fprintf(out_file_, "type_ids_size : %d\n", collections.TypeIdsSize());
fprintf(out_file_, "type_ids_off : %d (0x%06x)\n",
- header->TypeIdsOffset(), header->TypeIdsOffset());
- fprintf(out_file_, "proto_ids_size : %d\n", header->ProtoIdsSize());
+ collections.TypeIdsOffset(), collections.TypeIdsOffset());
+ fprintf(out_file_, "proto_ids_size : %d\n", collections.ProtoIdsSize());
fprintf(out_file_, "proto_ids_off : %d (0x%06x)\n",
- header->ProtoIdsOffset(), header->ProtoIdsOffset());
- fprintf(out_file_, "field_ids_size : %d\n", header->FieldIdsSize());
+ collections.ProtoIdsOffset(), collections.ProtoIdsOffset());
+ fprintf(out_file_, "field_ids_size : %d\n", collections.FieldIdsSize());
fprintf(out_file_, "field_ids_off : %d (0x%06x)\n",
- header->FieldIdsOffset(), header->FieldIdsOffset());
- fprintf(out_file_, "method_ids_size : %d\n", header->MethodIdsSize());
+ collections.FieldIdsOffset(), collections.FieldIdsOffset());
+ fprintf(out_file_, "method_ids_size : %d\n", collections.MethodIdsSize());
fprintf(out_file_, "method_ids_off : %d (0x%06x)\n",
- header->MethodIdsOffset(), header->MethodIdsOffset());
- fprintf(out_file_, "class_defs_size : %d\n", header->ClassDefsSize());
+ collections.MethodIdsOffset(), collections.MethodIdsOffset());
+ fprintf(out_file_, "class_defs_size : %d\n", collections.ClassDefsSize());
fprintf(out_file_, "class_defs_off : %d (0x%06x)\n",
- header->ClassDefsOffset(), header->ClassDefsOffset());
+ collections.ClassDefsOffset(), collections.ClassDefsOffset());
fprintf(out_file_, "data_size : %d\n", header->DataSize());
fprintf(out_file_, "data_off : %d (0x%06x)\n\n",
header->DataOffset(), header->DataOffset());
@@ -480,19 +492,19 @@
*/
static void DumpClassDef(dex_ir::Header* header, int idx) {
// General class information.
- dex_ir::ClassDef* class_def = header->ClassDefs()[idx].get();
+ dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
fprintf(out_file_, "Class #%d header:\n", idx);
- fprintf(out_file_, "class_idx : %d\n", class_def->ClassType()->GetOffset());
+ fprintf(out_file_, "class_idx : %d\n", class_def->ClassType()->GetIndex());
fprintf(out_file_, "access_flags : %d (0x%04x)\n",
class_def->GetAccessFlags(), class_def->GetAccessFlags());
uint32_t superclass_idx = class_def->Superclass() == nullptr ?
- DexFile::kDexNoIndex16 : class_def->Superclass()->GetOffset();
+ DexFile::kDexNoIndex16 : class_def->Superclass()->GetIndex();
fprintf(out_file_, "superclass_idx : %d\n", superclass_idx);
fprintf(out_file_, "interfaces_off : %d (0x%06x)\n",
class_def->InterfacesOffset(), class_def->InterfacesOffset());
uint32_t source_file_offset = 0xffffffffU;
if (class_def->SourceFile() != nullptr) {
- source_file_offset = class_def->SourceFile()->GetOffset();
+ source_file_offset = class_def->SourceFile()->GetIndex();
}
fprintf(out_file_, "source_file_idx : %d\n", source_file_offset);
uint32_t annotations_offset = 0;
@@ -541,7 +553,7 @@
fputs(" empty-annotation-set\n", out_file_);
return;
}
- for (std::unique_ptr<dex_ir::AnnotationItem>& annotation : *set_item->GetItems()) {
+ for (dex_ir::AnnotationItem* annotation : *set_item->GetItems()) {
if (annotation == nullptr) {
continue;
}
@@ -552,10 +564,7 @@
case DexFile::kDexVisibilitySystem: fputs("VISIBILITY_SYSTEM ", out_file_); break;
default: fputs("VISIBILITY_UNKNOWN ", out_file_); break;
} // switch
- // Decode raw bytes in annotation.
- // const uint8_t* rData = annotation->annotation_;
- dex_ir::ArrayItem* data = annotation->GetItem();
- DumpEncodedValue(data);
+ DumpEncodedAnnotation(annotation->GetAnnotation());
fputc('\n', out_file_);
}
}
@@ -564,7 +573,7 @@
* Dumps class annotations.
*/
static void DumpClassAnnotations(dex_ir::Header* header, int idx) {
- dex_ir::ClassDef* class_def = header->ClassDefs()[idx].get();
+ dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
dex_ir::AnnotationsDirectoryItem* annotations_directory = class_def->Annotations();
if (annotations_directory == nullptr) {
return; // none
@@ -587,7 +596,7 @@
if (fields != nullptr) {
for (auto& field : *fields) {
const dex_ir::FieldId* field_id = field->GetFieldId();
- const uint32_t field_idx = field_id->GetOffset();
+ const uint32_t field_idx = field_id->GetIndex();
const char* field_name = field_id->Name()->Data();
fprintf(out_file_, "Annotations on field #%u '%s'\n", field_idx, field_name);
DumpAnnotationSetItem(field->GetAnnotationSetItem());
@@ -598,7 +607,7 @@
if (methods != nullptr) {
for (auto& method : *methods) {
const dex_ir::MethodId* method_id = method->GetMethodId();
- const uint32_t method_idx = method_id->GetOffset();
+ const uint32_t method_idx = method_id->GetIndex();
const char* method_name = method_id->Name()->Data();
fprintf(out_file_, "Annotations on method #%u '%s'\n", method_idx, method_name);
DumpAnnotationSetItem(method->GetAnnotationSetItem());
@@ -609,13 +618,13 @@
if (parameters != nullptr) {
for (auto& parameter : *parameters) {
const dex_ir::MethodId* method_id = parameter->GetMethodId();
- const uint32_t method_idx = method_id->GetOffset();
+ const uint32_t method_idx = method_id->GetIndex();
const char* method_name = method_id->Name()->Data();
fprintf(out_file_, "Annotations on method #%u '%s' parameters\n", method_idx, method_name);
uint32_t j = 0;
- for (auto& annotation : *parameter->GetAnnotations()) {
+ for (dex_ir::AnnotationSetItem* annotation : *parameter->GetAnnotations()->GetItems()) {
fprintf(out_file_, "#%u\n", j);
- DumpAnnotationSetItem(annotation.get());
+ DumpAnnotationSetItem(annotation);
++j;
}
}
@@ -748,24 +757,24 @@
outSize = snprintf(buf.get(), buf_size, "<no-index>");
break;
case Instruction::kIndexTypeRef:
- if (index < header->TypeIdsSize()) {
- const char* tp = header->TypeIds()[index]->GetStringId()->Data();
+ if (index < header->GetCollections().TypeIdsSize()) {
+ const char* tp = header->GetCollections().GetTypeId(index)->GetStringId()->Data();
outSize = snprintf(buf.get(), buf_size, "%s // type@%0*x", tp, width, index);
} else {
outSize = snprintf(buf.get(), buf_size, "<type?> // type@%0*x", width, index);
}
break;
case Instruction::kIndexStringRef:
- if (index < header->StringIdsSize()) {
- const char* st = header->StringIds()[index]->Data();
+ if (index < header->GetCollections().StringIdsSize()) {
+ const char* st = header->GetCollections().GetStringId(index)->Data();
outSize = snprintf(buf.get(), buf_size, "\"%s\" // string@%0*x", st, width, index);
} else {
outSize = snprintf(buf.get(), buf_size, "<string?> // string@%0*x", width, index);
}
break;
case Instruction::kIndexMethodRef:
- if (index < header->MethodIdsSize()) {
- dex_ir::MethodId* method_id = header->MethodIds()[index].get();
+ if (index < header->GetCollections().MethodIdsSize()) {
+ dex_ir::MethodId* method_id = header->GetCollections().GetMethodId(index);
const char* name = method_id->Name()->Data();
std::string type_descriptor = GetSignatureForProtoId(method_id->Proto());
const char* back_descriptor = method_id->Class()->GetStringId()->Data();
@@ -776,8 +785,8 @@
}
break;
case Instruction::kIndexFieldRef:
- if (index < header->FieldIdsSize()) {
- dex_ir::FieldId* field_id = header->FieldIds()[index].get();
+ if (index < header->GetCollections().FieldIdsSize()) {
+ dex_ir::FieldId* field_id = header->GetCollections().GetFieldId(index);
const char* name = field_id->Name()->Data();
const char* type_descriptor = field_id->Type()->GetStringId()->Data();
const char* back_descriptor = field_id->Class()->GetStringId()->Data();
@@ -1028,7 +1037,7 @@
*/
static void DumpBytecodes(dex_ir::Header* header, uint32_t idx,
const dex_ir::CodeItem* code, uint32_t code_offset) {
- dex_ir::MethodId* method_id = header->MethodIds()[idx].get();
+ dex_ir::MethodId* method_id = header->GetCollections().GetMethodId(idx);
const char* name = method_id->Name()->Data();
std::string type_descriptor = GetSignatureForProtoId(method_id->Proto());
const char* back_descriptor = method_id->Class()->GetStringId()->Data();
@@ -1088,7 +1097,7 @@
return;
}
- dex_ir::MethodId* method_id = header->MethodIds()[idx].get();
+ dex_ir::MethodId* method_id = header->GetCollections().GetMethodId(idx);
const char* name = method_id->Name()->Data();
char* type_descriptor = strdup(GetSignatureForProtoId(method_id->Proto()).c_str());
const char* back_descriptor = method_id->Class()->GetStringId()->Data();
@@ -1187,13 +1196,13 @@
* Dumps a static (class) field.
*/
static void DumpSField(dex_ir::Header* header, uint32_t idx, uint32_t flags,
- int i, dex_ir::ArrayItem* init) {
+ int i, dex_ir::EncodedValue* init) {
// Bail for anything private if export only requested.
if (options_.exports_only_ && (flags & (kAccPublic | kAccProtected)) == 0) {
return;
}
- dex_ir::FieldId* field_id = header->FieldIds()[idx].get();
+ dex_ir::FieldId* field_id = header->GetCollections().GetFieldId(idx);
const char* name = field_id->Name()->Data();
const char* type_descriptor = field_id->Type()->GetStringId()->Data();
const char* back_descriptor = field_id->Class()->GetStringId()->Data();
@@ -1293,7 +1302,7 @@
dex_ir::Header* header,
int idx,
char** last_package) {
- dex_ir::ClassDef* class_def = header->ClassDefs()[idx].get();
+ dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
// Omitting non-public class.
if (options_.exports_only_ && (class_def->GetAccessFlags() & kAccPublic) == 0) {
return;
@@ -1316,7 +1325,8 @@
// up the classes, sort them, and dump them alphabetically so the
// package name wouldn't jump around, but that's not a great plan
// for something that needs to run on the device.
- const char* class_descriptor = header->ClassDefs()[idx]->ClassType()->GetStringId()->Data();
+ const char* class_descriptor =
+ header->GetCollections().GetClassDef(idx)->ClassType()->GetStringId()->Data();
if (!(class_descriptor[0] == 'L' &&
class_descriptor[strlen(class_descriptor)-1] == ';')) {
// Arrays and primitives should not be defined explicitly. Keep going?
@@ -1386,7 +1396,7 @@
}
// Interfaces.
- dex_ir::TypeIdVector* interfaces = class_def->Interfaces();
+ const dex_ir::TypeIdVector* interfaces = class_def->Interfaces();
if (interfaces != nullptr) {
for (uint32_t i = 0; i < interfaces->size(); i++) {
DumpInterface((*interfaces)[i], i);
@@ -1396,8 +1406,10 @@
// Fields and methods.
dex_ir::ClassData* class_data = class_def->GetClassData();
// Prepare data for static fields.
- std::vector<std::unique_ptr<dex_ir::ArrayItem>>* static_values = class_def->StaticValues();
- const uint32_t static_values_size = (static_values == nullptr) ? 0 : static_values->size();
+ dex_ir::EncodedArrayItem* static_values = class_def->StaticValues();
+ dex_ir::EncodedValueVector* encoded_values =
+ static_values == nullptr ? nullptr : static_values->GetEncodedValues();
+ const uint32_t encoded_values_size = (encoded_values == nullptr) ? 0 : encoded_values->size();
// Static fields.
if (options_.output_format_ == kOutputPlain) {
@@ -1408,10 +1420,10 @@
if (static_fields != nullptr) {
for (uint32_t i = 0; i < static_fields->size(); i++) {
DumpSField(header,
- (*static_fields)[i]->GetFieldId()->GetOffset(),
+ (*static_fields)[i]->GetFieldId()->GetIndex(),
(*static_fields)[i]->GetAccessFlags(),
i,
- i < static_values_size ? (*static_values)[i].get() : nullptr);
+ i < encoded_values_size ? (*encoded_values)[i].get() : nullptr);
} // for
}
}
@@ -1425,7 +1437,7 @@
if (instance_fields != nullptr) {
for (uint32_t i = 0; i < instance_fields->size(); i++) {
DumpIField(header,
- (*instance_fields)[i]->GetFieldId()->GetOffset(),
+ (*instance_fields)[i]->GetFieldId()->GetIndex(),
(*instance_fields)[i]->GetAccessFlags(),
i);
} // for
@@ -1441,7 +1453,7 @@
if (direct_methods != nullptr) {
for (uint32_t i = 0; i < direct_methods->size(); i++) {
DumpMethod(header,
- (*direct_methods)[i]->GetMethodId()->GetOffset(),
+ (*direct_methods)[i]->GetMethodId()->GetIndex(),
(*direct_methods)[i]->GetAccessFlags(),
(*direct_methods)[i]->GetCodeItem(),
i);
@@ -1458,7 +1470,7 @@
if (virtual_methods != nullptr) {
for (uint32_t i = 0; i < virtual_methods->size(); i++) {
DumpMethod(header,
- (*virtual_methods)[i]->GetMethodId()->GetOffset(),
+ (*virtual_methods)[i]->GetMethodId()->GetIndex(),
(*virtual_methods)[i]->GetAccessFlags(),
(*virtual_methods)[i]->GetCodeItem(),
i);
@@ -1474,7 +1486,7 @@
}
const dex_ir::StringId* source_file = class_def->SourceFile();
fprintf(out_file_, " source_file_idx : %d (%s)\n\n",
- source_file == nullptr ? 0xffffffffU : source_file->GetOffset(), file_name);
+ source_file == nullptr ? 0xffffffffU : source_file->GetIndex(), file_name);
} else if (options_.output_format_ == kOutputXml) {
fprintf(out_file_, "</class>\n");
}
@@ -1483,6 +1495,96 @@
}
/*
+static uint32_t GetDataSectionOffset(dex_ir::Header& header) {
+ return dex_ir::Header::ItemSize() +
+ header.GetCollections().StringIdsSize() * dex_ir::StringId::ItemSize() +
+ header.GetCollections().TypeIdsSize() * dex_ir::TypeId::ItemSize() +
+ header.GetCollections().ProtoIdsSize() * dex_ir::ProtoId::ItemSize() +
+ header.GetCollections().FieldIdsSize() * dex_ir::FieldId::ItemSize() +
+ header.GetCollections().MethodIdsSize() * dex_ir::MethodId::ItemSize() +
+ header.GetCollections().ClassDefsSize() * dex_ir::ClassDef::ItemSize();
+}
+
+static bool Align(File* file, uint32_t& offset) {
+ uint8_t zero_buffer[] = { 0, 0, 0 };
+ uint32_t zeroes = (-offset) & 3;
+ if (zeroes > 0) {
+ if (!file->PwriteFully(zero_buffer, zeroes, offset)) {
+ return false;
+ }
+ offset += zeroes;
+ }
+ return true;
+}
+
+static bool WriteStrings(File* dex_file, dex_ir::Header& header,
+ uint32_t& index_offset, uint32_t& data_offset) {
+ uint32_t index = 0;
+ uint32_t index_buffer[1];
+ uint32_t string_length;
+ uint32_t length_length;
+ uint8_t length_buffer[8];
+ for (std::unique_ptr<dex_ir::StringId>& string_id : header.GetCollections().StringIds()) {
+ string_id->SetOffset(index);
+ index_buffer[0] = data_offset;
+ string_length = strlen(string_id->Data());
+ length_length = UnsignedLeb128Size(string_length);
+ EncodeUnsignedLeb128(length_buffer, string_length);
+
+ if (!dex_file->PwriteFully(index_buffer, 4, index_offset) ||
+ !dex_file->PwriteFully(length_buffer, length_length, data_offset) ||
+ !dex_file->PwriteFully(string_id->Data(), string_length, data_offset + length_length)) {
+ return false;
+ }
+
+ index++;
+ index_offset += 4;
+ data_offset += string_length + length_length;
+ }
+ return true;
+}
+
+static bool WriteTypes(File* dex_file, dex_ir::Header& header, uint32_t& index_offset) {
+ uint32_t index = 0;
+ uint32_t index_buffer[1];
+ for (std::unique_ptr<dex_ir::TypeId>& type_id : header.GetCollections().TypeIds()) {
+ type_id->SetIndex(index);
+ index_buffer[0] = type_id->GetStringId()->GetOffset();
+
+ if (!dex_file->PwriteFully(index_buffer, 4, index_offset)) {
+ return false;
+ }
+
+ index++;
+ index_offset += 4;
+ }
+ return true;
+}
+
+static bool WriteTypeLists(File* dex_file, dex_ir::Header& header, uint32_t& data_offset) {
+ if (!Align(dex_file, data_offset)) {
+ return false;
+ }
+
+ return true;
+}
+
+static void OutputDexFile(dex_ir::Header& header, const char* file_name) {
+ LOG(INFO) << "FILE NAME: " << file_name;
+ std::unique_ptr<File> dex_file(OS::CreateEmptyFileWriteOnly(file_name));
+ if (dex_file == nullptr) {
+ fprintf(stderr, "Can't open %s\n", file_name);
+ return;
+ }
+
+ uint32_t index_offset = dex_ir::Header::ItemSize();
+ uint32_t data_offset = GetDataSectionOffset(header);
+ WriteStrings(dex_file.get(), header, index_offset, data_offset);
+ WriteTypes(dex_file.get(), header, index_offset);
+}
+*/
+
+/*
* Dumps the requested sections of the file.
*/
static void ProcessDexFile(const char* file_name, const DexFile* dex_file) {
@@ -1504,7 +1606,7 @@
// Iterate over all classes.
char* package = nullptr;
- const uint32_t class_defs_size = header->ClassDefsSize();
+ const uint32_t class_defs_size = header->GetCollections().ClassDefsSize();
for (uint32_t i = 0; i < class_defs_size; i++) {
DumpClass(dex_file, header.get(), i, &package);
} // for
@@ -1519,6 +1621,14 @@
if (options_.output_format_ == kOutputXml) {
fprintf(out_file_, "</api>\n");
}
+
+ /*
+ // Output dex file.
+ if (options_.output_dex_files_) {
+ std::string output_dex_filename = dex_file->GetLocation() + ".out";
+ OutputDexFile(*header, output_dex_filename.c_str());
+ }
+ */
}
/*
diff --git a/dexlayout/dexlayout.h b/dexlayout/dexlayout.h
index bae587d..736d230 100644
--- a/dexlayout/dexlayout.h
+++ b/dexlayout/dexlayout.h
@@ -41,6 +41,7 @@
bool disassemble_;
bool exports_only_;
bool ignore_bad_checksum_;
+ bool output_dex_files_;
bool show_annotations_;
bool show_cfg_;
bool show_file_headers_;
diff --git a/dexlayout/dexlayout_main.cc b/dexlayout/dexlayout_main.cc
index 286a0c6..ec5edf4 100644
--- a/dexlayout/dexlayout_main.cc
+++ b/dexlayout/dexlayout_main.cc
@@ -26,8 +26,8 @@
#include <string.h>
#include <unistd.h>
+#include "base/logging.h"
#include "mem_map.h"
-#include "runtime.h"
namespace art {
@@ -38,7 +38,7 @@
*/
static void Usage(void) {
fprintf(stderr, "Copyright (C) 2007 The Android Open Source Project\n\n");
- fprintf(stderr, "%s: [-a] [-c] [-d] [-e] [-f] [-h] [-i] [-l layout] [-o outfile]"
+ fprintf(stderr, "%s: [-a] [-c] [-d] [-e] [-f] [-h] [-i] [-l layout] [-o outfile] [-w]"
" dexfile...\n\n", kProgramName);
fprintf(stderr, " -a : display annotations\n");
fprintf(stderr, " -b : build dex_ir\n");
@@ -51,6 +51,7 @@
fprintf(stderr, " -i : ignore checksum failures\n");
fprintf(stderr, " -l : output layout, either 'plain' or 'xml'\n");
fprintf(stderr, " -o : output file name (defaults to stdout)\n");
+ fprintf(stderr, " -w : output dex files\n");
}
/*
@@ -68,7 +69,7 @@
// Parse all arguments.
while (1) {
- const int ic = getopt(argc, argv, "abcdefghil:o:");
+ const int ic = getopt(argc, argv, "abcdefghil:o:w");
if (ic < 0) {
break; // done
}
@@ -113,6 +114,9 @@
case 'o': // output file
options_.output_file_name_ = optarg;
break;
+ case 'w': // output dex files
+ options_.output_dex_files_ = true;
+ break;
default:
want_usage = true;
break;
diff --git a/dexlist/Android.bp b/dexlist/Android.bp
index ddf01db..52b1ee9 100644
--- a/dexlist/Android.bp
+++ b/dexlist/Android.bp
@@ -23,7 +23,7 @@
art_cc_test {
name: "art_dexlist_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["dexlist_test.cc"],
}
diff --git a/disassembler/Android.bp b/disassembler/Android.bp
index b074d9f..8dfada2 100644
--- a/disassembler/Android.bp
+++ b/disassembler/Android.bp
@@ -38,7 +38,8 @@
name: "libart-disassembler",
defaults: ["libart-disassembler-defaults"],
shared_libs: [
- // For disassembler_arm64.
+ // For disassembler_arm*.
+ "libvixl-arm",
"libvixl-arm64",
],
}
@@ -50,7 +51,8 @@
"art_debug_defaults",
],
shared_libs: [
- // For disassembler_arm64.
+ // For disassembler_arm*.
+ "libvixld-arm",
"libvixld-arm64",
],
}
diff --git a/disassembler/disassembler_arm.cc b/disassembler/disassembler_arm.cc
index c3e288d..925047f 100644
--- a/disassembler/disassembler_arm.cc
+++ b/disassembler/disassembler_arm.cc
@@ -16,1938 +16,232 @@
#include "disassembler_arm.h"
-#include <inttypes.h>
-
-#include <ostream>
-#include <sstream>
+#include <memory>
+#include <string>
#include "android-base/logging.h"
-#include "android-base/stringprintf.h"
#include "arch/arm/registers_arm.h"
#include "base/bit_utils.h"
-using android::base::StringPrintf;
+#pragma GCC diagnostic push
+#pragma GCC diagnostic ignored "-Wshadow"
+#include "aarch32/instructions-aarch32.h"
+#include "aarch32/disasm-aarch32.h"
+#pragma GCC diagnostic pop
namespace art {
namespace arm {
-size_t DisassemblerArm::Dump(std::ostream& os, const uint8_t* begin) {
- if ((reinterpret_cast<intptr_t>(begin) & 1) == 0) {
- DumpArm(os, begin);
- return 4;
- } else {
- // remove thumb specifier bits
- begin = reinterpret_cast<const uint8_t*>(reinterpret_cast<uintptr_t>(begin) & ~1);
- return DumpThumb16(os, begin);
- }
-}
+using vixl::aarch32::MemOperand;
+using vixl::aarch32::PrintDisassembler;
+using vixl::aarch32::pc;
-void DisassemblerArm::Dump(std::ostream& os, const uint8_t* begin, const uint8_t* end) {
- if ((reinterpret_cast<intptr_t>(begin) & 1) == 0) {
- for (const uint8_t* cur = begin; cur < end; cur += 4) {
- DumpArm(os, cur);
+static const vixl::aarch32::Register tr(TR);
+
+class DisassemblerArm::CustomDisassembler FINAL : public PrintDisassembler {
+ class CustomDisassemblerStream FINAL : public DisassemblerStream {
+ public:
+ CustomDisassemblerStream(std::ostream& os,
+ const CustomDisassembler* disasm,
+ const DisassemblerOptions* options)
+ : DisassemblerStream(os), disasm_(disasm), options_(options) {}
+
+ DisassemblerStream& operator<<(const PrintLabel& label) OVERRIDE {
+ const LocationType type = label.GetLocationType();
+
+ switch (type) {
+ case kLoadByteLocation:
+ case kLoadHalfWordLocation:
+ case kLoadWordLocation:
+ case kLoadDoubleWordLocation:
+ case kLoadSignedByteLocation:
+ case kLoadSignedHalfWordLocation:
+ case kLoadSinglePrecisionLocation:
+ case kLoadDoublePrecisionLocation:
+ case kVld1Location:
+ case kVld2Location:
+ case kVld3Location:
+ case kVld4Location: {
+ const uintptr_t pc_delta = disasm_->IsT32()
+ ? vixl::aarch32::kT32PcDelta
+ : vixl::aarch32::kA32PcDelta;
+ const int32_t offset = label.GetLabel()->GetLocation();
+
+ os() << "[pc, #" << offset - pc_delta << "]";
+ PrintLiteral(type, offset);
+ return *this;
+ }
+ default:
+ return DisassemblerStream::operator<<(label);
+ }
}
- } else {
- // remove thumb specifier bits
- begin = reinterpret_cast<const uint8_t*>(reinterpret_cast<uintptr_t>(begin) & ~1);
- end = reinterpret_cast<const uint8_t*>(reinterpret_cast<uintptr_t>(end) & ~1);
- for (const uint8_t* cur = begin; cur < end;) {
- cur += DumpThumb16(os, cur);
- }
- }
-}
-static const char* kConditionCodeNames[] = {
- "eq", // 0000 - equal
- "ne", // 0001 - not-equal
- "cs", // 0010 - carry-set, greater than, equal or unordered
- "cc", // 0011 - carry-clear, less than
- "mi", // 0100 - minus, negative
- "pl", // 0101 - plus, positive or zero
- "vs", // 0110 - overflow
- "vc", // 0111 - no overflow
- "hi", // 1000 - unsigned higher
- "ls", // 1001 - unsigned lower or same
- "ge", // 1010 - signed greater than or equal
- "lt", // 1011 - signed less than
- "gt", // 1100 - signed greater than
- "le", // 1101 - signed less than or equal
- "", // 1110 - always
- "nv", // 1111 - never (mostly obsolete, but might be a clue that we're mistranslating)
-};
-
-void DisassemblerArm::DumpCond(std::ostream& os, uint32_t cond) {
- if (cond < 15) {
- os << kConditionCodeNames[cond];
- } else {
- os << "Unexpected condition: " << cond;
- }
-}
-
-void DisassemblerArm::DumpMemoryDomain(std::ostream& os, uint32_t domain) {
- switch (domain) {
- case 15U /* 0b1111 */: os << "sy"; break;
- case 14U /* 0b1110 */: os << "st"; break;
- case 11U /* 0b1011 */: os << "ish"; break;
- case 10U /* 0b1010 */: os << "ishst"; break;
- case 7U /* 0b0111 */: os << "nsh"; break;
- case 6U /* 0b0110 */: os << "nshst"; break;
- case 3U /* 0b0011 */: os << "osh"; break;
- case 2U /* 0b0010 */: os << "oshst"; break;
- }
-}
-
-void DisassemblerArm::DumpBranchTarget(std::ostream& os, const uint8_t* instr_ptr, int32_t imm32) {
- os << StringPrintf("%+d (", imm32) << FormatInstructionPointer(instr_ptr + imm32) << ")";
-}
-
-static uint32_t ReadU16(const uint8_t* ptr) {
- return ptr[0] | (ptr[1] << 8);
-}
-
-static uint32_t ReadU32(const uint8_t* ptr) {
- return ptr[0] | (ptr[1] << 8) | (ptr[2] << 16) | (ptr[3] << 24);
-}
-
-static const char* kDataProcessingOperations[] = {
- "and", "eor", "sub", "rsb", "add", "adc", "sbc", "rsc",
- "tst", "teq", "cmp", "cmn", "orr", "mov", "bic", "mvn",
-};
-
-static const char* kThumbDataProcessingOperations[] = {
- "and", "eor", "lsl", "lsr", "asr", "adc", "sbc", "ror",
- "tst", "rsb", "cmp", "cmn", "orr", "mul", "bic", "mvn",
-};
-
-static const char* const kThumb2ShiftOperations[] = {
- "lsl", "lsr", "asr", "ror"
-};
-
-static const char* kThumbReverseOperations[] = {
- "rev", "rev16", "rbit", "revsh"
-};
-
-struct ArmRegister {
- explicit ArmRegister(uint32_t r_in) : r(r_in) { CHECK_LE(r_in, 15U); }
- ArmRegister(uint32_t instruction, uint32_t at_bit) : r((instruction >> at_bit) & 0xf) {
- CHECK_LE(r, 15U);
- }
- uint32_t r;
-};
-std::ostream& operator<<(std::ostream& os, const ArmRegister& r) {
- if (r.r == 13) {
- os << "sp";
- } else if (r.r == 14) {
- os << "lr";
- } else if (r.r == 15) {
- os << "pc";
- } else {
- os << "r" << r.r;
- }
- return os;
-}
-
-struct ThumbRegister : ArmRegister {
- ThumbRegister(uint16_t instruction, uint16_t at_bit) : ArmRegister((instruction >> at_bit) & 0x7) {}
-};
-
-struct RmLslImm2 {
- explicit RmLslImm2(uint32_t instr) : imm2((instr >> 4) & 0x3), rm(instr & 0xf) {}
- uint32_t imm2;
- ArmRegister rm;
-};
-std::ostream& operator<<(std::ostream& os, const RmLslImm2& r) {
- os << r.rm;
- if (r.imm2 != 0) {
- os << ", lsl #" << r.imm2;
- }
- return os;
-}
-
-struct ShiftedImmediate {
- explicit ShiftedImmediate(uint32_t instruction) {
- uint32_t rotate = ((instruction >> 8) & 0xf);
- uint32_t imm = (instruction & 0xff);
- value = (imm >> (2 * rotate)) | (imm << (32 - (2 * rotate)));
- }
- uint32_t value;
-};
-std::ostream& operator<<(std::ostream& os, const ShiftedImmediate& rhs) {
- os << "#" << rhs.value;
- return os;
-}
-
-struct RegisterList {
- explicit RegisterList(uint32_t instruction) : register_list(instruction & 0xffff) {}
- uint32_t register_list;
-};
-std::ostream& operator<<(std::ostream& os, const RegisterList& rhs) {
- if (rhs.register_list == 0) {
- os << "<no register list?>";
- return os;
- }
- os << "{";
- bool first = true;
- for (size_t i = 0; i < 16; i++) {
- if ((rhs.register_list & (1 << i)) != 0) {
- if (first) {
- first = false;
+ DisassemblerStream& operator<<(const vixl::aarch32::Register reg) OVERRIDE {
+ if (reg.Is(tr)) {
+ os() << "tr";
+ return *this;
} else {
- os << ", ";
+ return DisassemblerStream::operator<<(reg);
}
- os << ArmRegister(i);
}
- }
- os << "}";
- return os;
-}
-struct FpRegister {
- FpRegister(uint32_t instr, uint16_t at_bit, uint16_t extra_at_bit) {
- size = (instr >> 8) & 1;
- uint32_t Vn = (instr >> at_bit) & 0xF;
- uint32_t N = (instr >> extra_at_bit) & 1;
- r = (size != 0 ? ((N << 4) | Vn) : ((Vn << 1) | N));
- }
- FpRegister(uint32_t instr, uint16_t at_bit, uint16_t extra_at_bit, uint32_t forced_size) {
- size = forced_size;
- uint32_t Vn = (instr >> at_bit) & 0xF;
- uint32_t N = (instr >> extra_at_bit) & 1;
- r = (size != 0 ? ((N << 4) | Vn) : ((Vn << 1) | N));
- }
- FpRegister(const FpRegister& other, uint32_t offset)
- : size(other.size), r(other.r + offset) {}
+ DisassemblerStream& operator<<(const MemOperand& operand) OVERRIDE {
+ // VIXL must use a PrintLabel object whenever the base register is PC;
+ // the following check verifies this invariant, and guards against bugs.
+ DCHECK(!operand.GetBaseRegister().Is(pc));
+ DisassemblerStream::operator<<(operand);
- uint32_t size; // 0 = f32, 1 = f64
- uint32_t r;
-};
-std::ostream& operator<<(std::ostream& os, const FpRegister& rhs) {
- return os << ((rhs.size != 0) ? "d" : "s") << rhs.r;
-}
+ if (operand.GetBaseRegister().Is(tr) && operand.IsImmediate()) {
+ os() << " ; ";
+ options_->thread_offset_name_function_(os(), operand.GetOffsetImmediate());
+ }
-struct FpRegisterRange {
- explicit FpRegisterRange(uint32_t instr)
- : first(instr, 12, 22), imm8(instr & 0xFF) {}
- FpRegister first;
- uint32_t imm8;
-};
-std::ostream& operator<<(std::ostream& os, const FpRegisterRange& rhs) {
- os << "{" << rhs.first;
- int count = (rhs.first.size != 0 ? ((rhs.imm8 + 1u) >> 1) : rhs.imm8);
- if (count > 1) {
- os << "-" << FpRegister(rhs.first, count - 1);
- }
- if (rhs.imm8 == 0) {
- os << " (EMPTY)";
- } else if (rhs.first.size != 0 && (rhs.imm8 & 1) != 0) {
- os << rhs.first << " (HALF)";
- }
- os << "}";
- return os;
-}
-
-void DisassemblerArm::DumpArm(std::ostream& os, const uint8_t* instr_ptr) {
- uint32_t instruction = ReadU32(instr_ptr);
- uint32_t cond = (instruction >> 28) & 0xf;
- uint32_t op1 = (instruction >> 25) & 0x7;
- std::string opcode;
- std::string suffixes;
- std::ostringstream args;
- switch (op1) {
- case 0:
- case 1: // Data processing instructions.
- {
- if ((instruction & 0x0ff000f0) == 0x01200070) { // BKPT
- opcode = "bkpt";
- uint32_t imm12 = (instruction >> 8) & 0xfff;
- uint32_t imm4 = (instruction & 0xf);
- args << '#' << ((imm12 << 4) | imm4);
- break;
- }
- if ((instruction & 0x0fffffd0) == 0x012fff10) { // BX and BLX (register)
- opcode = (((instruction >> 5) & 1) ? "blx" : "bx");
- args << ArmRegister(instruction & 0xf);
- break;
- }
- bool i = (instruction & (1 << 25)) != 0;
- bool s = (instruction & (1 << 20)) != 0;
- uint32_t op = (instruction >> 21) & 0xf;
- opcode = kDataProcessingOperations[op];
- bool implicit_s = ((op & ~3) == 8); // TST, TEQ, CMP, and CMN.
- bool is_mov = op == 13U /* 0b1101 */ || op == 15U /* 0b1111 */;
- if (is_mov) {
- // Show only Rd and Rm.
- if (s) {
- suffixes += 's';
- }
- args << ArmRegister(instruction, 12) << ", ";
- if (i) {
- args << ShiftedImmediate(instruction);
- } else {
- // TODO: Shifted register.
- args << ArmRegister(instruction, 16) << ", " << ArmRegister(instruction, 0);
- }
- } else {
- if (implicit_s) {
- // Rd is unused (and not shown), and we don't show the 's' suffix either.
- } else {
- if (s) {
- suffixes += 's';
- }
- args << ArmRegister(instruction, 12) << ", ";
- }
- if (i) {
- args << ArmRegister(instruction, 16) << ", " << ShiftedImmediate(instruction);
- } else {
- // TODO: Shifted register.
- args << ArmRegister(instruction, 16) << ", " << ArmRegister(instruction, 0);
- }
- }
- }
- break;
- case 2: // Load/store word and unsigned byte.
- {
- bool p = (instruction & (1 << 24)) != 0;
- bool b = (instruction & (1 << 22)) != 0;
- bool w = (instruction & (1 << 21)) != 0;
- bool l = (instruction & (1 << 20)) != 0;
- opcode = StringPrintf("%s%s", (l ? "ldr" : "str"), (b ? "b" : ""));
- args << ArmRegister(instruction, 12) << ", ";
- ArmRegister rn(instruction, 16);
- if (rn.r == 0xf) {
- UNIMPLEMENTED(FATAL) << "literals";
- } else {
- bool wback = !p || w;
- uint32_t offset = (instruction & 0xfff);
- if (p && !wback) {
- args << "[" << rn << ", #" << offset << "]";
- } else if (p && wback) {
- args << "[" << rn << ", #" << offset << "]!";
- } else if (!p && wback) {
- args << "[" << rn << "], #" << offset;
- } else {
- LOG(FATAL) << p << " " << w;
- }
- if (rn.r == 9) {
- args << " ; ";
- GetDisassemblerOptions()->thread_offset_name_function_(args, offset);
- }
- }
- }
- break;
- case 4: // Load/store multiple.
- {
- bool p = (instruction & (1 << 24)) != 0;
- bool u = (instruction & (1 << 23)) != 0;
- bool w = (instruction & (1 << 21)) != 0;
- bool l = (instruction & (1 << 20)) != 0;
- opcode = StringPrintf("%s%c%c", (l ? "ldm" : "stm"), (u ? 'i' : 'd'), (p ? 'b' : 'a'));
- args << ArmRegister(instruction, 16) << (w ? "!" : "") << ", " << RegisterList(instruction);
- }
- break;
- case 5: // Branch/branch with link.
- {
- bool bl = (instruction & (1 << 24)) != 0;
- opcode = (bl ? "bl" : "b");
- int32_t imm26 = (instruction & 0xffffff) << 2;
- int32_t imm32 = (imm26 << 6) >> 6; // Sign extend.
- DumpBranchTarget(args, instr_ptr + 8, imm32);
- }
- break;
- default:
- opcode = "???";
- break;
+ return *this;
}
- opcode += kConditionCodeNames[cond];
- opcode += suffixes;
- // TODO: a more complete ARM disassembler could generate wider opcodes.
- os << FormatInstructionPointer(instr_ptr)
- << StringPrintf(": %08x\t%-7s ", instruction, opcode.c_str())
- << args.str() << '\n';
-}
-int32_t ThumbExpand(int32_t imm12) {
- if ((imm12 & 0xC00) == 0) {
- switch ((imm12 >> 8) & 3) {
- case 0:
- return imm12 & 0xFF;
- case 1:
- return ((imm12 & 0xFF) << 16) | (imm12 & 0xFF);
- case 2:
- return ((imm12 & 0xFF) << 24) | ((imm12 & 0xFF) << 8);
- default: // 3
- return ((imm12 & 0xFF) << 24) | ((imm12 & 0xFF) << 16) | ((imm12 & 0xFF) << 8) |
- (imm12 & 0xFF);
+ DisassemblerStream& operator<<(const vixl::aarch32::AlignedMemOperand& operand) OVERRIDE {
+ // VIXL must use a PrintLabel object whenever the base register is PC;
+ // the following check verifies this invariant, and guards against bugs.
+ DCHECK(!operand.GetBaseRegister().Is(pc));
+ return DisassemblerStream::operator<<(operand);
}
- } else {
- uint32_t val = 0x80 | (imm12 & 0x7F);
- int32_t rotate = (imm12 >> 7) & 0x1F;
- return (val >> rotate) | (val << (32 - rotate));
+
+ private:
+ void PrintLiteral(LocationType type, int32_t offset);
+
+ const CustomDisassembler* disasm_;
+ const DisassemblerOptions* options_;
+ };
+
+ public:
+ CustomDisassembler(std::ostream& os, const DisassemblerOptions* options)
+ // vixl::aarch32::Disassembler::~Disassembler() will delete the stream.
+ : PrintDisassembler(new CustomDisassemblerStream(os, this, options)) {}
+
+ void PrintPc(uint32_t prog_ctr) OVERRIDE {
+ os() << "0x" << std::hex << std::setw(8) << std::setfill('0') << prog_ctr << ": ";
}
-}
-uint32_t VFPExpand32(uint32_t imm8) {
- CHECK_EQ(imm8 & 0xffu, imm8);
- uint32_t bit_a = (imm8 >> 7) & 1;
- uint32_t bit_b = (imm8 >> 6) & 1;
- uint32_t slice = imm8 & 0x3f;
- return (bit_a << 31) | ((1 << 30) - (bit_b << 25)) | (slice << 19);
-}
+ bool IsT32() const {
+ return is_t32_;
+ }
-static uint64_t VFPExpand64(uint32_t imm8) {
- CHECK_EQ(imm8 & 0xffu, imm8);
- uint64_t bit_a = (imm8 >> 7) & 1;
- uint64_t bit_b = (imm8 >> 6) & 1;
- uint64_t slice = imm8 & 0x3f;
- return (bit_a << 63) | ((UINT64_C(1) << 62) - (bit_b << 54)) | (slice << 48);
-}
+ void SetT32(bool is_t32) {
+ is_t32_ = is_t32;
+ }
-enum T2LitType {
- kT2LitInvalid,
- kT2LitUByte,
- kT2LitSByte,
- kT2LitUHalf,
- kT2LitSHalf,
- kT2LitUWord,
- kT2LitSWord,
- kT2LitHexWord,
- kT2LitULong,
- kT2LitSLong,
- kT2LitHexLong,
+ private:
+ bool is_t32_;
};
-std::ostream& operator<<(std::ostream& os, T2LitType type) {
- return os << static_cast<int>(type);
-}
-void DumpThumb2Literal(std::ostream& args,
- const uint8_t* instr_ptr,
- const uintptr_t lo_adr,
- const uintptr_t hi_adr,
- uint32_t U,
- uint32_t imm32,
- T2LitType type) {
- // Literal offsets (imm32) are not required to be aligned so we may need unaligned access.
+void DisassemblerArm::CustomDisassembler::CustomDisassemblerStream::PrintLiteral(LocationType type,
+ int32_t offset) {
+ // Literal offsets are not required to be aligned, so we may need unaligned access.
typedef const int16_t unaligned_int16_t __attribute__ ((aligned (1)));
typedef const uint16_t unaligned_uint16_t __attribute__ ((aligned (1)));
typedef const int32_t unaligned_int32_t __attribute__ ((aligned (1)));
- typedef const uint32_t unaligned_uint32_t __attribute__ ((aligned (1)));
typedef const int64_t unaligned_int64_t __attribute__ ((aligned (1)));
- typedef const uint64_t unaligned_uint64_t __attribute__ ((aligned (1)));
+ typedef const float unaligned_float __attribute__ ((aligned (1)));
+ typedef const double unaligned_double __attribute__ ((aligned (1)));
- // Get address of literal. Bail if not within expected buffer range to
- // avoid trying to fetch invalid literals (we can encounter this when
- // interpreting raw data as instructions).
- uintptr_t pc = RoundDown(reinterpret_cast<intptr_t>(instr_ptr) + 4, 4);
- uintptr_t lit_adr = U ? pc + imm32 : pc - imm32;
- if (lit_adr < lo_adr || lit_adr >= hi_adr) {
- args << " ; (?)";
- return;
+ // Zeros are used for the LocationType values this function does not care about.
+ const size_t literal_size[kVst4Location + 1] = {
+ 0, 0, 0, 0, sizeof(uint8_t), sizeof(unaligned_uint16_t), sizeof(unaligned_int32_t),
+ sizeof(unaligned_int64_t), sizeof(int8_t), sizeof(unaligned_int16_t),
+ sizeof(unaligned_float), sizeof(unaligned_double)};
+ const uintptr_t begin = reinterpret_cast<uintptr_t>(options_->base_address_);
+ const uintptr_t end = reinterpret_cast<uintptr_t>(options_->end_address_);
+ uintptr_t literal_addr = RoundDown(disasm_->GetPc(), vixl::aarch32::kRegSizeInBytes) + offset;
+
+ if (!options_->absolute_addresses_) {
+ literal_addr += begin;
}
- args << " ; ";
- switch (type) {
- case kT2LitUByte:
- args << *reinterpret_cast<const uint8_t*>(lit_adr);
- break;
- case kT2LitSByte:
- args << *reinterpret_cast<const int8_t*>(lit_adr);
- break;
- case kT2LitUHalf:
- args << *reinterpret_cast<const unaligned_uint16_t*>(lit_adr);
- break;
- case kT2LitSHalf:
- args << *reinterpret_cast<const unaligned_int16_t*>(lit_adr);
- break;
- case kT2LitUWord:
- args << *reinterpret_cast<const unaligned_uint32_t*>(lit_adr);
- break;
- case kT2LitSWord:
- args << *reinterpret_cast<const unaligned_int32_t*>(lit_adr);
- break;
- case kT2LitHexWord:
- args << StringPrintf("0x%08x", *reinterpret_cast<const unaligned_uint32_t*>(lit_adr));
- break;
- case kT2LitULong:
- args << *reinterpret_cast<const unaligned_uint64_t*>(lit_adr);
- break;
- case kT2LitSLong:
- args << *reinterpret_cast<const unaligned_int64_t*>(lit_adr);
- break;
- case kT2LitHexLong:
- args << StringPrintf("0x%" PRIx64, *reinterpret_cast<unaligned_int64_t*>(lit_adr));
- break;
- default:
- LOG(FATAL) << "Invalid type: " << type;
- break;
+ os() << " ; ";
+
+ // Bail out if not within expected buffer range to avoid trying to fetch invalid literals
+ // (we can encounter them when interpreting raw data as instructions).
+ if (literal_addr < begin || literal_addr > end - literal_size[type]) {
+ os() << "(?)";
+ } else {
+ switch (type) {
+ case kLoadByteLocation:
+ os() << *reinterpret_cast<const uint8_t*>(literal_addr);
+ break;
+ case kLoadHalfWordLocation:
+ os() << *reinterpret_cast<unaligned_uint16_t*>(literal_addr);
+ break;
+ case kLoadWordLocation: {
+ const int32_t value = *reinterpret_cast<unaligned_int32_t*>(literal_addr);
+ os() << "0x" << std::hex << std::setw(8) << std::setfill('0') << value;
+ break;
+ }
+ case kLoadDoubleWordLocation: {
+ const int64_t value = *reinterpret_cast<unaligned_int64_t*>(literal_addr);
+ os() << "0x" << std::hex << std::setw(16) << std::setfill('0') << value;
+ break;
+ }
+ case kLoadSignedByteLocation:
+ os() << *reinterpret_cast<const int8_t*>(literal_addr);
+ break;
+ case kLoadSignedHalfWordLocation:
+ os() << *reinterpret_cast<unaligned_int16_t*>(literal_addr);
+ break;
+ case kLoadSinglePrecisionLocation:
+ os() << *reinterpret_cast<unaligned_float*>(literal_addr);
+ break;
+ case kLoadDoublePrecisionLocation:
+ os() << *reinterpret_cast<unaligned_double*>(literal_addr);
+ break;
+ default:
+ UNIMPLEMENTED(FATAL) << "Unexpected literal type: " << type;
+ }
}
}
-size_t DisassemblerArm::DumpThumb32(std::ostream& os, const uint8_t* instr_ptr) {
- uint32_t instr = (ReadU16(instr_ptr) << 16) | ReadU16(instr_ptr + 2);
- // |111|1 1|1000000|0000|1111110000000000|
- // |5 3|2 1|0987654|3 0|5 0 5 0|
- // |---|---|-------|----|----------------|
- // |332|2 2|2222222|1111|1111110000000000|
- // |1 9|8 7|6543210|9 6|5 0 5 0|
- // |---|---|-------|----|----------------|
- // |111|op1| op2 | | |
- uint32_t op1 = (instr >> 27) & 3;
- if (op1 == 0) {
- return DumpThumb16(os, instr_ptr);
- }
+DisassemblerArm::DisassemblerArm(DisassemblerOptions* options)
+ : Disassembler(options), disasm_(std::make_unique<CustomDisassembler>(output_, options)) {}
- // Set valid address range of backing buffer.
- const uintptr_t lo_adr = reinterpret_cast<intptr_t>(GetDisassemblerOptions()->base_address_);
- const uintptr_t hi_adr = reinterpret_cast<intptr_t>(GetDisassemblerOptions()->end_address_);
+size_t DisassemblerArm::Dump(std::ostream& os, const uint8_t* begin) {
+ uintptr_t next;
+ // Remove the Thumb specifier bit; no effect if begin does not point to T32 code.
+ const uintptr_t instr_ptr = reinterpret_cast<uintptr_t>(begin) & ~1;
- uint32_t op2 = (instr >> 20) & 0x7F;
- std::ostringstream opcode;
- std::ostringstream args;
- switch (op1) {
- case 0:
- break;
- case 1:
- if ((op2 & 0x64) == 0) { // 00x x0xx
- // |111|11|10|00|0|00|0000|1111110000000000|
- // |5 3|21|09|87|6|54|3 0|5 0 5 0|
- // |---|--|--|--|-|--|----|----------------|
- // |332|22|22|22|2|22|1111|1111110000000000|
- // |1 9|87|65|43|2|10|9 6|5 0 5 0|
- // |---|--|--|--|-|--|----|----------------|
- // |111|01|00|op|0|WL| Rn | |
- // |111|01| op2 | | |
- // STM - 111 01 00-01-0-W0 nnnn rrrrrrrrrrrrrrrr
- // LDM - 111 01 00-01-0-W1 nnnn rrrrrrrrrrrrrrrr
- // PUSH- 111 01 00-01-0-10 1101 0M0rrrrrrrrrrrrr
- // POP - 111 01 00-01-0-11 1101 PM0rrrrrrrrrrrrr
- uint32_t op = (instr >> 23) & 3;
- uint32_t W = (instr >> 21) & 1;
- uint32_t L = (instr >> 20) & 1;
- ArmRegister Rn(instr, 16);
- if (op == 1 || op == 2) {
- if (op == 1) {
- if (L == 0) {
- opcode << "stm";
- args << Rn << (W == 0 ? "" : "!") << ", ";
- } else {
- if (Rn.r != 13) {
- opcode << "ldm";
- args << Rn << (W == 0 ? "" : "!") << ", ";
- } else {
- opcode << "pop";
- }
- }
- } else {
- if (L == 0) {
- if (Rn.r != 13) {
- opcode << "stmdb";
- args << Rn << (W == 0 ? "" : "!") << ", ";
- } else {
- opcode << "push";
- }
- } else {
- opcode << "ldmdb";
- args << Rn << (W == 0 ? "" : "!") << ", ";
- }
- }
- args << RegisterList(instr);
- }
- } else if ((op2 & 0x64) == 4) { // 00x x1xx
- uint32_t op3 = (instr >> 23) & 3;
- uint32_t op4 = (instr >> 20) & 3;
- // uint32_t op5 = (instr >> 4) & 0xF;
- ArmRegister Rn(instr, 16);
- ArmRegister Rt(instr, 12);
- ArmRegister Rd(instr, 8);
- uint32_t imm8 = instr & 0xFF;
- if ((op3 & 2) == 2) { // 1x
- int W = (instr >> 21) & 1;
- int U = (instr >> 23) & 1;
- int P = (instr >> 24) & 1;
+ disasm_->SetT32((reinterpret_cast<uintptr_t>(begin) & 1) != 0);
+ disasm_->JumpToPc(GetPc(instr_ptr));
- if ((op4 & 1) == 1) {
- opcode << "ldrd";
- } else {
- opcode << "strd";
- }
- args << Rt << "," << Rd << ", [" << Rn;
- const char *sign = U ? "+" : "-";
- if (P == 0 && W == 1) {
- args << "], #" << sign << (imm8 << 2);
- } else {
- args << ", #" << sign << (imm8 << 2) << "]";
- if (W == 1) {
- args << "!";
- }
- }
- } else { // 0x
- switch (op4) {
- case 0:
- if (op3 == 0) { // op3 is 00, op4 is 00
- opcode << "strex";
- args << Rd << ", " << Rt << ", [" << Rn << ", #" << (imm8 << 2) << "]";
- if (Rd.r == 13 || Rd.r == 15 || Rt.r == 13 || Rt.r == 15 || Rn.r == 15 ||
- Rd.r == Rn.r || Rd.r == Rt.r) {
- args << " (UNPREDICTABLE)";
- }
- } else { // op3 is 01, op4 is 00
- // this is one of strexb, strexh or strexd
- int op5 = (instr >> 4) & 0xf;
- switch (op5) {
- case 4:
- case 5:
- opcode << ((op5 == 4) ? "strexb" : "strexh");
- Rd = ArmRegister(instr, 0);
- args << Rd << ", " << Rt << ", [" << Rn << "]";
- if (Rd.r == 13 || Rd.r == 15 || Rt.r == 13 || Rt.r == 15 || Rn.r == 15 ||
- Rd.r == Rn.r || Rd.r == Rt.r || (instr & 0xf00) != 0xf00) {
- args << " (UNPREDICTABLE)";
- }
- break;
- case 7:
- opcode << "strexd";
- ArmRegister Rt2 = Rd;
- Rd = ArmRegister(instr, 0);
- args << Rd << ", " << Rt << ", " << Rt2 << ", [" << Rn << "]";
- if (Rd.r == 13 || Rd.r == 15 || Rt.r == 13 || Rt.r == 15 ||
- Rt2.r == 13 || Rt2.r == 15 || Rn.r == 15 ||
- Rd.r == Rn.r || Rd.r == Rt.r || Rd.r == Rt2.r) {
- args << " (UNPREDICTABLE)";
- }
- break;
- }
- }
- break;
- case 1:
- if (op3 == 0) { // op3 is 00, op4 is 01
- opcode << "ldrex";
- args << Rt << ", [" << Rn << ", #" << (imm8 << 2) << "]";
- if (Rt.r == 13 || Rt.r == 15 || Rn.r == 15 || (instr & 0xf00) != 0xf00) {
- args << " (UNPREDICTABLE)";
- }
- } else { // op3 is 01, op4 is 01
- // this is one of strexb, strexh or strexd
- int op5 = (instr >> 4) & 0xf;
- switch (op5) {
- case 0:
- opcode << "tbb";
- break;
- case 1:
- opcode << "tbh";
- break;
- case 4:
- case 5:
- opcode << ((op5 == 4) ? "ldrexb" : "ldrexh");
- args << Rt << ", [" << Rn << "]";
- if (Rt.r == 13 || Rt.r == 15 || Rn.r == 15 || (instr & 0xf0f) != 0xf0f) {
- args << " (UNPREDICTABLE)";
- }
- break;
- case 7:
- opcode << "ldrexd";
- args << Rt << ", " << Rd /* Rt2 */ << ", [" << Rn << "]";
- if (Rt.r == 13 || Rt.r == 15 || Rd.r == 13 /* Rt2 */ || Rd.r == 15 /* Rt2 */ ||
- Rn.r == 15 || (instr & 0x00f) != 0x00f) {
- args << " (UNPREDICTABLE)";
- }
- break;
- }
- }
- break;
- case 2: // op3 is 0x, op4 is 10
- case 3: // op3 is 0x, op4 is 11
- if (op4 == 2) {
- opcode << "strd";
- } else {
- opcode << "ldrd";
- }
- int W = (instr >> 21) & 1;
- int U = (instr >> 23) & 1;
- int P = (instr >> 24) & 1;
-
- args << Rt << "," << Rd << ", [" << Rn;
- const char *sign = U ? "+" : "-";
- if (P == 0 && W == 1) {
- args << "], #" << sign << imm8;
- } else {
- args << ", #" << sign << imm8 << "]";
- if (W == 1) {
- args << "!";
- }
- }
- break;
- }
- }
-
- } else if ((op2 & 0x60) == 0x20) { // 01x xxxx
- // Data-processing (shifted register)
- // |111|1110|0000|0|0000|1111|1100|00|00|0000|
- // |5 3|2109|8765|4|3 0|5 |10 8|7 |5 |3 0|
- // |---|----|----|-|----|----|----|--|--|----|
- // |332|2222|2222|2|1111|1111|1100|00|00|0000|
- // |1 9|8765|4321|0|9 6|5 |10 8|7 |5 |3 0|
- // |---|----|----|-|----|----|----|--|--|----|
- // |111|0101| op3|S| Rn |imm3| Rd |i2|ty| Rm |
- uint32_t op3 = (instr >> 21) & 0xF;
- uint32_t S = (instr >> 20) & 1;
- uint32_t imm3 = ((instr >> 12) & 0x7);
- uint32_t imm2 = ((instr >> 6) & 0x3);
- uint32_t imm5 = ((imm3 << 2) | imm2);
- uint32_t shift_type = ((instr >> 4) & 0x3);
- ArmRegister Rd(instr, 8);
- ArmRegister Rn(instr, 16);
- ArmRegister Rm(instr, 0);
- switch (op3) {
- case 0x0:
- if (Rd.r != 0xF) {
- opcode << "and";
- } else {
- if (S != 1U) {
- opcode << "UNKNOWN TST-" << S;
- break;
- }
- opcode << "tst";
- S = 0; // don't print 's'
- }
- break;
- case 0x1: opcode << "bic"; break;
- case 0x2:
- if (Rn.r != 0xF) {
- opcode << "orr";
- } else {
- // TODO: use canonical form if there is a shift (lsl, ...).
- opcode << "mov";
- }
- break;
- case 0x3:
- if (Rn.r != 0xF) {
- opcode << "orn";
- } else {
- opcode << "mvn";
- }
- break;
- case 0x4:
- if (Rd.r != 0xF) {
- opcode << "eor";
- } else {
- if (S != 1U) {
- opcode << "UNKNOWN TEQ-" << S;
- break;
- }
- opcode << "teq";
- S = 0; // don't print 's'
- }
- break;
- case 0x6: opcode << "pkh"; break;
- case 0x8:
- if (Rd.r != 0xF) {
- opcode << "add";
- } else {
- if (S != 1U) {
- opcode << "UNKNOWN CMN-" << S;
- break;
- }
- opcode << "cmn";
- S = 0; // don't print 's'
- }
- break;
- case 0xA: opcode << "adc"; break;
- case 0xB: opcode << "sbc"; break;
- case 0xD:
- if (Rd.r != 0xF) {
- opcode << "sub";
- } else {
- if (S != 1U) {
- opcode << "UNKNOWN CMP-" << S;
- break;
- }
- opcode << "cmp";
- S = 0; // don't print 's'
- }
- break;
- case 0xE: opcode << "rsb"; break;
- default: opcode << "UNKNOWN DPSR-" << op3; break;
- }
-
- if (S == 1) {
- opcode << "s";
- }
- opcode << ".w";
-
- if (Rd.r != 0xF) {
- args << Rd << ", ";
- }
- if (Rn.r != 0xF) {
- args << Rn << ", ";
- }
- args << Rm;
-
- // Shift operand.
- bool noShift = (imm5 == 0 && shift_type == 0x0);
- if (!noShift) {
- args << ", ";
- if (shift_type == 0x3u && imm5 == 0u) {
- args << "rrx";
- } else {
- args << kThumb2ShiftOperations[shift_type] << " #" << ((0 != imm5) ? imm5 : 32);
- }
- }
-
- } else if ((op2 & 0x40) == 0x40) { // 1xx xxxx
- // Co-processor instructions
- // |111|1|11|000000|0000|1111|1100|000|0 |0000|
- // |5 3|2|10|987654|3 0|54 2|10 8|7 5|4 | 0|
- // |---|-|--|------|----|----|----|---|---|----|
- // |332|2|22|222222|1111|1111|1100|000|0 |0000|
- // |1 9|8|76|543210|9 6|54 2|10 8|7 5|4 | 0|
- // |---|-|--|------|----|----|----|---|---|----|
- // |111| |11| op3 | Rn | |copr| |op4| |
- uint32_t op3 = (instr >> 20) & 0x3F;
- uint32_t coproc = (instr >> 8) & 0xF;
- uint32_t op4 = (instr >> 4) & 0x1;
-
- if (coproc == 0xA || coproc == 0xB) { // 101x
- if (op3 < 0x20 && (op3 & ~5) != 0) { // 0xxxxx and not 000x0x
- // Extension register load/store instructions
- // |1111|110|00000|0000|1111|110|0|00000000|
- // |5 2|1 9|87654|3 0|5 2|1 9|8|7 0|
- // |----|---|-----|----|----|---|-|--------|
- // |3322|222|22222|1111|1111|110|0|00000000|
- // |1 8|7 5|4 0|9 6|5 2|1 9|8|7 0|
- // |----|---|-----|----|----|---|-|--------|
- // |1110|110|PUDWL| Rn | Vd |101|S| imm8 |
- uint32_t P = (instr >> 24) & 1;
- uint32_t U = (instr >> 23) & 1;
- uint32_t W = (instr >> 21) & 1;
- if (P == U && W == 1) {
- opcode << "UNDEFINED";
- } else {
- uint32_t L = (instr >> 20) & 1;
- uint32_t S = (instr >> 8) & 1;
- ArmRegister Rn(instr, 16);
- if (P == 1 && W == 0) { // VLDR
- FpRegister d(instr, 12, 22);
- uint32_t imm8 = instr & 0xFF;
- opcode << (L == 1 ? "vldr" : "vstr");
- args << d << ", [" << Rn << ", #" << ((U == 1) ? "" : "-")
- << (imm8 << 2) << "]";
- if (Rn.r == 15 && U == 1) {
- DumpThumb2Literal(args, instr_ptr, lo_adr, hi_adr, U, imm8 << 2, kT2LitHexLong);
- }
- } else if (Rn.r == 13 && W == 1 && U == L) { // VPUSH/VPOP
- opcode << (L == 1 ? "vpop" : "vpush");
- args << FpRegisterRange(instr);
- } else { // VLDM
- opcode << (L == 1 ? "vldm" : "vstm");
- args << Rn << ((W == 1) ? "!" : "") << ", "
- << FpRegisterRange(instr);
- }
- opcode << (S == 1 ? ".f64" : ".f32");
- }
- } else if ((op3 >> 1) == 2) { // 00010x
- if ((instr & 0xD0) == 0x10) {
- // 64bit transfers between ARM core and extension registers.
- uint32_t L = (instr >> 20) & 1;
- uint32_t S = (instr >> 8) & 1;
- ArmRegister Rt2(instr, 16);
- ArmRegister Rt(instr, 12);
- FpRegister m(instr, 0, 5);
- opcode << "vmov" << (S ? ".f64" : ".f32");
- if (L == 1) {
- args << Rt << ", " << Rt2 << ", ";
- }
- if (S) {
- args << m;
- } else {
- args << m << ", " << FpRegister(m, 1);
- }
- if (L == 0) {
- args << ", " << Rt << ", " << Rt2;
- }
- if (Rt.r == 15 || Rt.r == 13 || Rt2.r == 15 || Rt2.r == 13 ||
- (S == 0 && m.r == 31) || (L == 1 && Rt.r == Rt2.r)) {
- args << " (UNPREDICTABLE)";
- }
- }
- } else if ((op3 >> 4) == 2 && op4 == 0) { // 10xxxx, op = 0
- // fp data processing
- // VMLA, VMLS, VMUL, VNMUL, VADD, VSUB, VDIV, VMOV, ...
- // |1111|1100|0|0|00|0000|1111|110|0|0|0|0|0|0000|
- // |5 2|1 8|7|6|54|3 0|5 2|1 9|8|7|6|5|4|3 0|
- // |----|----|-|-|--|----|----|---|-|-|-|-|-|----|
- // |3322|2222|2|2|22|1111|1111|110|0|0|0|0|0|0000|
- // |1 8|7 4|3|2|10|9 6|5 2|1 9|8|7|6|5|4|3 0|
- // |----|----|-|-|--|----|----|---|-|-|-|-|-|----|
- // |1110|1110| op3 | Vn | Vd |101|S|N|Q|M|0| Vm |
- // |1110|1110|0|D|00| Vn | Vd |101|S|N|0|M|0| Vm | VMLA
- // |1110|1110|0|D|00| Vn | Vd |101|S|N|1|M|0| Vm | VMLS
- // |1110|1110|0|D|10| Vn | Vd |101|S|N|0|M|0| Vm | VMUL
- // |1110|1110|0|D|10| Vn | Vd |101|S|N|1|M|0| Vm | VNMUL
- // |1110|1110|0|D|11| Vn | Vd |101|S|N|0|M|0| Vm | VADD
- // |1110|1110|0|D|11| Vn | Vd |101|S|N|1|M|0| Vm | VSUB
- // |1110|1110|1|D|00| Vn | Vd |101|S|N|0|M|0| Vm | VDIV
- // |1110|1110|1|D|11| iH | Vd |101|S|0|0|0|0| iL | VMOV (imm)
- // |1110|1110|1|D|11|op5 | Vd |101|S|.|1|M|0| Vm | ... (see below)
- uint32_t S = (instr >> 8) & 1;
- uint32_t Q = (instr >> 6) & 1;
- FpRegister d(instr, 12, 22);
- FpRegister n(instr, 16, 7);
- FpRegister m(instr, 0, 5);
- if ((op3 & 0xB) == 0) { // 100x00
- opcode << (Q == 0 ? "vmla" : "vmls") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << n << ", " << m;
- } else if ((op3 & 0xB) == 0x2) { // 100x10
- opcode << (Q == 0 ? "vmul" : "vnmul") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << n << ", " << m;
- } else if ((op3 & 0xB) == 0x3) { // 100x11
- opcode << (Q == 0 ? "vadd" : "vsub") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << n << ", " << m;
- } else if ((op3 & 0xB) == 0x8 && Q == 0) { // 101x00, Q == 0
- opcode << "vdiv" << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << n << ", " << m;
- } else if ((op3 & 0xB) == 0xB && Q == 0) { // 101x11, Q == 0
- uint32_t imm8 = ((instr & 0xf0000u) >> 12) | (instr & 0xfu);
- opcode << "vmov" << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << (S != 0 ? StringPrintf("0x%016" PRIx64, VFPExpand64(imm8))
- : StringPrintf("0x%08x", VFPExpand32(imm8)));
- if ((instr & 0xa0) != 0) {
- args << " (UNPREDICTABLE)";
- }
- } else if ((op3 & 0xB) == 0xB && Q == 1) { // 101x11, Q == 1
- // VNEG, VSQRT, VCMP, VCMPE, VCVT (floating-point conversion)
- // |1111|1100|0|0|00|0000|1111|110|0|0 |0|0|0|0000|
- // |5 2|1 8|7|6|54|3 0|5 2|1 9|8|7 |6|5|4|3 0|
- // |----|----|-|-|--|----|----|---|-|- |-|-|-|----|
- // |3322|2222|2|2|22|1111|1111|110|0|0 |0|0|0|0000|
- // |1 8|7 4|3|2|10|9 6|5 2|1 9|8|7 |6|5|4|3 0|
- // |----|----|-|-|--|----|----|---|-|- |-|-|-|----|
- // |1110|1110|1|D|11|0000| Vd |101|S|0 |1|M|0| Vm | VMOV (reg)
- // |1110|1110|1|D|11|0000| Vd |101|S|1 |1|M|0| Vm | VABS
- // |1110|1110|1|D|11|0001| Vd |101|S|0 |1|M|0| Vm | VNEG
- // |1110|1110|1|D|11|0001| Vd |101|S|1 |1|M|0| Vm | VSQRT
- // |1110|1110|1|D|11|0100| Vd |101|S|op|1|M|0| Vm | VCMP
- // |1110|1110|1|D|11|0101| Vd |101|S|op|1|0|0|0000| VCMPE
- // |1110|1110|1|D|11|op5 | Vd |101|S|op|1|M|0| Vm | VCVT
- uint32_t op5 = (instr >> 16) & 0xF;
- uint32_t op = (instr >> 7) & 1;
- // Register types in VCVT instructions rely on the combination of op5 and S.
- FpRegister Dd(instr, 12, 22, 1);
- FpRegister Sd(instr, 12, 22, 0);
- FpRegister Dm(instr, 0, 5, 1);
- FpRegister Sm(instr, 0, 5, 0);
- if (op5 == 0) {
- opcode << (op == 0 ? "vmov" : "vabs") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << m;
- } else if (op5 == 1) {
- opcode << (op != 0 ? "vsqrt" : "vneg") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << m;
- } else if (op5 == 4) {
- opcode << "vcmp" << ((op != 0) ? "e" : "") << (S != 0 ? ".f64" : ".f32");
- args << d << ", " << m;
- } else if (op5 == 5) {
- opcode << "vcmp" << ((op != 0) ? "e" : "") << (S != 0 ? ".f64" : ".f32");
- args << d << ", #0.0";
- if ((instr & 0x2f) != 0) {
- args << " (UNPREDICTABLE)";
- }
- } else if (op5 == 0xD) {
- if (S == 1) {
- // vcvt{r}.s32.f64
- opcode << "vcvt" << (op == 0 ? "r" : "") << ".s32.f64";
- args << Sd << ", " << Dm;
- } else {
- // vcvt{r}.s32.f32
- opcode << "vcvt" << (op == 0 ? "r" : "") << ".s32.f32";
- args << Sd << ", " << Sm;
- }
- } else if (op5 == 0xC) {
- if (S == 1) {
- // vcvt{r}.u32.f64
- opcode << "vcvt" << (op == 0 ? "r" : "") << ".u32.f64";
- args << Sd << ", " << Dm;
- } else {
- // vcvt{r}.u32.f32
- opcode << "vcvt" << (op == 0 ? "r" : "") << ".u32.f32";
- args << Sd << ", " << Sm;
- }
- } else if (op5 == 0x8) {
- if (S == 1) {
- // vcvt.f64.<Tm>
- opcode << "vcvt.f64." << (op == 0 ? "u" : "s") << "32";
- args << Dd << ", " << Sm;
- } else {
- // vcvt.f32.<Tm>
- opcode << "vcvt.f32." << (op == 0 ? "u" : "s") << "32";
- args << Sd << ", " << Sm;
- }
- } else if (op5 == 0x7) {
- if (op == 1) {
- if (S == 1) {
- // vcvt.f64.f32
- opcode << "vcvt.f64.f32";
- args << Dd << ", " << Sm;
- } else {
- // vcvt.f32.f64
- opcode << "vcvt.f32.f64";
- args << Sd << ", " << Dm;
- }
- }
- } else if ((op5 & 0xa) == 0xa) {
- opcode << "vcvt";
- args << "[undecoded: floating <-> fixed]";
- }
- }
- } else if ((op3 >> 4) == 2 && op4 == 1) { // 10xxxx, op = 1
- if (coproc == 10 && (op3 & 0xE) == 0) {
- // VMOV (between ARM core register and single-precision register)
- // |1111|1100|000|0 |0000|1111|1100|0|00|0|0000|
- // |5 |1 8|7 5|4 |3 0|5 2|1 8|7|65|4|3 0|
- // |----|----|---|- |----|----|----|-|--|-|----|
- // |3322|2222|222|2 |1111|1111|1100|0|00|0|0000|
- // |1 8|7 4|3 1|0 |9 6|5 2|1 8|7|65|4|3 0|
- // |----|----|---|- |----|----|----|-|--|-|----|
- // |1110|1110|000|op| Vn | Rt |1010|N|00|1|0000|
- uint32_t op = op3 & 1;
- ArmRegister Rt(instr, 12);
- FpRegister n(instr, 16, 7);
- opcode << "vmov.f32";
- if (op) {
- args << Rt << ", " << n;
- } else {
- args << n << ", " << Rt;
- }
- if (Rt.r == 13 || Rt.r == 15 || (instr & 0x6F) != 0) {
- args << " (UNPREDICTABLE)";
- }
- } else if (coproc == 10 && op3 == 0x2F) {
- // VMRS
- // |1111|11000000|0000|1111|1100|000|0|0000|
- // |5 |1 4|3 0|5 2|1 8|7 5|4|3 0|
- // |----|--------|----|----|----|---|-|----|
- // |3322|22222222|1111|1111|1100|000|0|0000|
- // |1 8|7 0|9 6|5 2|1 8|7 5|4|3 0|
- // |----|--------|----|----|----|---|-|----|
- // |1110|11101111|reg | Rt |1010|000|1|0000| - last 7 0s are (0)
- uint32_t spec_reg = (instr >> 16) & 0xF;
- ArmRegister Rt(instr, 12);
- opcode << "vmrs";
- if (spec_reg == 1) {
- if (Rt.r == 15) {
- args << "APSR_nzcv, FPSCR";
- } else if (Rt.r == 13) {
- args << Rt << ", FPSCR (UNPREDICTABLE)";
- } else {
- args << Rt << ", FPSCR";
- }
- } else {
- args << "(PRIVILEGED)";
- }
- } else if (coproc == 11 && (op3 & 0x9) != 8) {
- // VMOV (ARM core register to scalar or vice versa; 8/16/32-bit)
- }
- }
- }
- }
- break;
- case 2:
- if ((instr & 0x8000) == 0 && (op2 & 0x20) == 0) {
- // Data-processing (modified immediate)
- // |111|11|10|0000|0|0000|1|111|1100|00000000|
- // |5 3|21|09|8765|4|3 0|5|4 2|10 8|7 5 0|
- // |---|--|--|----|-|----|-|---|----|--------|
- // |332|22|22|2222|2|1111|1|111|1100|00000000|
- // |1 9|87|65|4321|0|9 6|5|4 2|10 8|7 5 0|
- // |---|--|--|----|-|----|-|---|----|--------|
- // |111|10|i0| op3|S| Rn |0|iii| Rd |iiiiiiii|
- // 111 10 x0 xxxx x xxxx opxxx xxxx xxxxxxxx
- uint32_t i = (instr >> 26) & 1;
- uint32_t op3 = (instr >> 21) & 0xF;
- uint32_t S = (instr >> 20) & 1;
- ArmRegister Rn(instr, 16);
- uint32_t imm3 = (instr >> 12) & 7;
- ArmRegister Rd(instr, 8);
- uint32_t imm8 = instr & 0xFF;
- int32_t imm32 = (i << 11) | (imm3 << 8) | imm8;
- if (Rn.r == 0xF && (op3 == 0x2 || op3 == 0x3)) {
- if (op3 == 0x2) {
- opcode << "mov";
- if (S == 1) {
- opcode << "s";
- }
- opcode << ".w";
- } else {
- opcode << "mvn";
- if (S == 1) {
- opcode << "s";
- }
- }
- args << Rd << ", #" << ThumbExpand(imm32);
- } else if (Rd.r == 0xF && S == 1 &&
- (op3 == 0x0 || op3 == 0x4 || op3 == 0x8 || op3 == 0xD)) {
- if (op3 == 0x0) {
- opcode << "tst";
- } else if (op3 == 0x4) {
- opcode << "teq";
- } else if (op3 == 0x8) {
- opcode << "cmn.w";
- } else {
- opcode << "cmp.w";
- }
- args << Rn << ", #" << ThumbExpand(imm32);
- } else {
- switch (op3) {
- case 0x0: opcode << "and"; break;
- case 0x1: opcode << "bic"; break;
- case 0x2: opcode << "orr"; break;
- case 0x3: opcode << "orn"; break;
- case 0x4: opcode << "eor"; break;
- case 0x8: opcode << "add"; break;
- case 0xA: opcode << "adc"; break;
- case 0xB: opcode << "sbc"; break;
- case 0xD: opcode << "sub"; break;
- case 0xE: opcode << "rsb"; break;
- default: opcode << "UNKNOWN DPMI-" << op3; break;
- }
- if (S == 1) {
- opcode << "s";
- }
- args << Rd << ", " << Rn << ", #" << ThumbExpand(imm32);
- }
- } else if ((instr & 0x8000) == 0 && (op2 & 0x20) != 0) {
- // Data-processing (plain binary immediate)
- // |111|11|10|00000|0000|1|111110000000000|
- // |5 3|21|09|87654|3 0|5|4 0 5 0|
- // |---|--|--|-----|----|-|---------------|
- // |332|22|22|22222|1111|1|111110000000000|
- // |1 9|87|65|43210|9 6|5|4 0 5 0|
- // |---|--|--|-----|----|-|---------------|
- // |111|10|x1| op3 | Rn |0|xxxxxxxxxxxxxxx|
- uint32_t op3 = (instr >> 20) & 0x1F;
- switch (op3) {
- case 0x00: case 0x0A: {
- // ADD/SUB.W Rd, Rn #imm12 - 111 10 i1 0101 0 nnnn 0 iii dddd iiiiiiii
- ArmRegister Rd(instr, 8);
- ArmRegister Rn(instr, 16);
- uint32_t i = (instr >> 26) & 1;
- uint32_t imm3 = (instr >> 12) & 0x7;
- uint32_t imm8 = instr & 0xFF;
- uint32_t imm12 = (i << 11) | (imm3 << 8) | imm8;
- if (Rn.r != 0xF) {
- opcode << (op3 == 0 ? "addw" : "subw");
- args << Rd << ", " << Rn << ", #" << imm12;
- } else {
- opcode << "adr";
- args << Rd << ", ";
- DumpBranchTarget(args, instr_ptr + 4, (op3 == 0) ? imm12 : -imm12);
- }
- break;
- }
- case 0x04: case 0x0C: {
- // MOVW/T Rd, #imm16 - 111 10 i0 0010 0 iiii 0 iii dddd iiiiiiii
- ArmRegister Rd(instr, 8);
- uint32_t i = (instr >> 26) & 1;
- uint32_t imm3 = (instr >> 12) & 0x7;
- uint32_t imm8 = instr & 0xFF;
- uint32_t Rn = (instr >> 16) & 0xF;
- uint32_t imm16 = (Rn << 12) | (i << 11) | (imm3 << 8) | imm8;
- opcode << (op3 == 0x04 ? "movw" : "movt");
- args << Rd << ", #" << imm16;
- break;
- }
- case 0x16: case 0x14: case 0x1C: {
- // BFI Rd, Rn, #lsb, #width - 111 10 0 11 011 0 nnnn 0 iii dddd ii 0 iiiii
- // SBFX Rd, Rn, #lsb, #width - 111 10 0 11 010 0 nnnn 0 iii dddd ii 0 iiiii
- // UBFX Rd, Rn, #lsb, #width - 111 10 0 11 110 0 nnnn 0 iii dddd ii 0 iiiii
- ArmRegister Rd(instr, 8);
- ArmRegister Rn(instr, 16);
- uint32_t msb = instr & 0x1F;
- uint32_t imm2 = (instr >> 6) & 0x3;
- uint32_t imm3 = (instr >> 12) & 0x7;
- uint32_t lsb = (imm3 << 2) | imm2;
- uint32_t width = msb - lsb + 1;
- if (op3 == 0x16) {
- if (Rn.r != 0xF) {
- opcode << "bfi";
- args << Rd << ", " << Rn << ", #" << lsb << ", #" << width;
- } else {
- opcode << "bfc";
- args << Rd << ", #" << lsb << ", #" << width;
- }
- } else {
- opcode << ((op3 & 0x8) != 0u ? "ubfx" : "sbfx");
- args << Rd << ", " << Rn << ", #" << lsb << ", #" << width;
- if (Rd.r == 13 || Rd.r == 15 || Rn.r == 13 || Rn.r == 15 ||
- (instr & 0x04000020) != 0u) {
- args << " (UNPREDICTABLE)";
- }
- }
- break;
- }
- default:
- break;
- }
- } else {
- // Branches and miscellaneous control
- // |111|11|1000000|0000|1|111|1100|00000000|
- // |5 3|21|0987654|3 0|5|4 2|10 8|7 5 0|
- // |---|--|-------|----|-|---|----|--------|
- // |332|22|2222222|1111|1|111|1100|00000000|
- // |1 9|87|6543210|9 6|5|4 2|10 8|7 5 0|
- // |---|--|-------|----|-|---|----|--------|
- // |111|10| op2 | |1|op3|op4 | |
-
- uint32_t op3 = (instr >> 12) & 7;
- // uint32_t op4 = (instr >> 8) & 0xF;
- switch (op3) {
- case 0:
- if ((op2 & 0x38) != 0x38) {
- // Conditional branch
- // |111|11|1|0000|000000|1|1|1 |1|1 |10000000000|
- // |5 3|21|0|9876|543 0|5|4|3 |2|1 |0 5 0|
- // |---|--|-|----|------|-|-|--|-|--|-----------|
- // |332|22|2|2222|221111|1|1|1 |1|1 |10000000000|
- // |1 9|87|6|5432|109 6|5|4|3 |2|1 |0 5 0|
- // |---|--|-|----|------|-|-|--|-|--|-----------|
- // |111|10|S|cond| imm6 |1|0|J1|0|J2| imm11 |
- uint32_t S = (instr >> 26) & 1;
- uint32_t J2 = (instr >> 11) & 1;
- uint32_t J1 = (instr >> 13) & 1;
- uint32_t imm6 = (instr >> 16) & 0x3F;
- uint32_t imm11 = instr & 0x7FF;
- uint32_t cond = (instr >> 22) & 0xF;
- int32_t imm32 = (S << 20) | (J2 << 19) | (J1 << 18) | (imm6 << 12) | (imm11 << 1);
- imm32 = (imm32 << 11) >> 11; // sign extend 21bit immediate
- opcode << "b";
- DumpCond(opcode, cond);
- opcode << ".w";
- DumpBranchTarget(args, instr_ptr + 4, imm32);
- } else if (op2 == 0x3B) {
- // Miscellaneous control instructions
- uint32_t op5 = (instr >> 4) & 0xF;
- switch (op5) {
- case 4: opcode << "dsb"; DumpMemoryDomain(args, instr & 0xF); break;
- case 5: opcode << "dmb"; DumpMemoryDomain(args, instr & 0xF); break;
- case 6: opcode << "isb"; DumpMemoryDomain(args, instr & 0xF); break;
- }
- }
- break;
- case 2:
- if ((op2 & 0x38) == 0x38) {
- if (op2 == 0x7F) {
- opcode << "udf";
- }
- break;
- }
- FALLTHROUGH_INTENDED; // Else deliberate fall-through to B.
- case 1: case 3: {
- // B
- // |111|11|1|0000|000000|11|1 |1|1 |10000000000|
- // |5 3|21|0|9876|543 0|54|3 |2|1 |0 5 0|
- // |---|--|-|----|------|--|--|-|--|-----------|
- // |332|22|2|2222|221111|11|1 |1|1 |10000000000|
- // |1 9|87|6|5 2|10 6|54|3 |2|1 |0 5 0|
- // |---|--|-|----|------|--|--|-|--|-----------|
- // |111|10|S|cond| imm6 |10|J1|0|J2| imm11 |
- // |111|10|S| imm10 |10|J1|1|J2| imm11 |
- uint32_t S = (instr >> 26) & 1;
- uint32_t cond = (instr >> 22) & 0xF;
- uint32_t J2 = (instr >> 11) & 1;
- uint32_t form = (instr >> 12) & 1;
- uint32_t J1 = (instr >> 13) & 1;
- uint32_t imm10 = (instr >> 16) & 0x3FF;
- uint32_t imm6 = (instr >> 16) & 0x3F;
- uint32_t imm11 = instr & 0x7FF;
- opcode << "b";
- int32_t imm32;
- if (form == 0) {
- DumpCond(opcode, cond);
- imm32 = (S << 20) | (J2 << 19) | (J1 << 18) | (imm6 << 12) | (imm11 << 1);
- imm32 = (imm32 << 11) >> 11; // sign extend 21 bit immediate.
- } else {
- uint32_t I1 = (J1 ^ S) ^ 1;
- uint32_t I2 = (J2 ^ S) ^ 1;
- imm32 = (S << 24) | (I1 << 23) | (I2 << 22) | (imm10 << 12) | (imm11 << 1);
- imm32 = (imm32 << 7) >> 7; // sign extend 25 bit immediate.
- }
- opcode << ".w";
- DumpBranchTarget(args, instr_ptr + 4, imm32);
- break;
- }
- case 4: case 6: case 5: case 7: {
- // BL, BLX (immediate)
- // |111|11|1|0000000000|11|1 |1|1 |10000000000|
- // |5 3|21|0|9876543 0|54|3 |2|1 |0 5 0|
- // |---|--|-|----------|--|--|-|--|-----------|
- // |332|22|2|2222221111|11|1 |1|1 |10000000000|
- // |1 9|87|6|5 0 6|54|3 |2|1 |0 5 0|
- // |---|--|-|----------|--|--|-|--|-----------|
- // |111|10|S| imm10 |11|J1|L|J2| imm11 |
- uint32_t S = (instr >> 26) & 1;
- uint32_t J2 = (instr >> 11) & 1;
- uint32_t L = (instr >> 12) & 1;
- uint32_t J1 = (instr >> 13) & 1;
- uint32_t imm10 = (instr >> 16) & 0x3FF;
- uint32_t imm11 = instr & 0x7FF;
- if (L == 0) {
- opcode << "bx";
- } else {
- opcode << "blx";
- }
- uint32_t I1 = ~(J1 ^ S);
- uint32_t I2 = ~(J2 ^ S);
- int32_t imm32 = (S << 24) | (I1 << 23) | (I2 << 22) | (imm10 << 12) | (imm11 << 1);
- imm32 = (imm32 << 8) >> 8; // sign extend 24 bit immediate.
- DumpBranchTarget(args, instr_ptr + 4, imm32);
- break;
- }
- }
- }
- break;
- case 3:
- switch (op2) {
- case 0x07: case 0x0F: case 0x17: case 0x1F: { // Explicitly UNDEFINED, A6.3.
- opcode << "UNDEFINED";
- break;
- }
- case 0x06: case 0x0E: { // "Store single data item" undefined opcodes, A6.3.10.
- opcode << "UNDEFINED [store]";
- break;
- }
- case 0x15: case 0x1D: { // "Load word" undefined opcodes, A6.3.7.
- opcode << "UNDEFINED [load]";
- break;
- }
- case 0x10: case 0x12: case 0x14: case 0x16: case 0x18: case 0x1A: case 0x1C: case 0x1E: {
- opcode << "UNKNOWN " << op2 << " [SIMD]";
- break;
- }
- case 0x01: case 0x00: case 0x09: case 0x08: // {LD,ST}RB{,T}
- case 0x03: case 0x02: case 0x0B: case 0x0A: // {LD,ST}RH{,T}
- case 0x05: case 0x04: case 0x0D: case 0x0C: // {LD,ST}R{,T}
- case 0x11: case 0x19: // LDRSB{,T} (no signed store)
- case 0x13: case 0x1B: { // LDRSH{,T} (no signed store)
- // Load:
- // (Store is the same except that l==0 and always s==0 below.)
- // 00s.whl (sign, word, half, load)
- // LDR{S}B imm12: 11111|00s1001| Rn | Rt |imm12 (0x09)
- // LDR{S}B imm8: 11111|00s0001| Rn | Rt |1PUW|imm8 (0x01)
- // LDR{S}BT imm8: 11111|00s0001| Rn | Rt |1110|imm8 (0x01)
- // LDR{S}B lit: 11111|00sU001|1111| Rt |imm12 (0x01/0x09)
- // LDR{S}B reg: 11111|00s0001| Rn | Rt |000000|imm2| Rm (0x01)
- // LDR{S}H imm12: 11111|00s1011| Rn | Rt |imm12 (0x0B)
- // LDR{S}H imm8: 11111|00s0011| Rn | Rt |1PUW|imm8 (0x03)
- // LDR{S}HT imm8: 11111|00s0011| Rn | Rt |1110|imm8 (0x03)
- // LDR{S}H lit: 11111|00sU011|1111| Rt |imm12 (0x03/0x0B)
- // LDR{S}H reg: 11111|00s0011| Rn | Rt |000000|imm2| Rm (0x03)
- // LDR imm12: 11111|0001101| Rn | Rt |imm12 (0x0D)
- // LDR imm8: 11111|0000101| Rn | Rt |1PUW|imm8 (0x05)
- // LDRT imm8: 11111|0000101| Rn | Rt |1110|imm8 (0x05)
- // LDR lit: 11111|000U101|1111| Rt |imm12 (0x05/0x0D)
- // LDR reg: 11111|0000101| Rn | Rt |000000|imm2| Rm (0x05)
- //
- // If Rt == 15, instead of load we have preload:
- // PLD{W} imm12: 11111|00010W1| Rn |1111|imm12 (0x09/0x0B)
- // PLD{W} imm8: 11111|00000W1| Rn |1111|1100|imm8 (0x01/0x03); -imm8
- // PLD lit: 11111|000U001|1111|1111|imm12 (0x01/0x09)
- // PLD{W} reg: 11111|00000W1| Rn |1111|000000|imm2| Rm (0x01/0x03)
- // PLI imm12: 11111|0011001| Rn |1111|imm12 (0x19)
- // PLI imm8: 11111|0010001| Rn |1111|1100|imm8 (0x11); -imm8
- // PLI lit: 11111|001U001|1111|1111|imm12 (0x01/0x09)
- // PLI reg: 11111|0010001| Rn |1111|000000|imm2| Rm (0x01/0x03)
-
- bool is_load = HasBitSet(instr, 20);
- bool is_half = HasBitSet(instr, 21); // W for PLD/PLDW.
- bool is_word = HasBitSet(instr, 22);
- bool is_signed = HasBitSet(instr, 24);
- ArmRegister Rn(instr, 16);
- ArmRegister Rt(instr, 12);
- uint32_t imm12 = instr & 0xFFF;
- uint32_t U = (instr >> 23) & 1; // U for imm12
- uint32_t imm8 = instr & 0xFF;
- uint32_t op4 = (instr >> 8) & 0xF; // 1PUW for imm8
- if (Rt.r == PC && is_load && !is_word) {
- // PLD, PLDW, PLI
- const char* pld_pli = (is_signed ? "pli" : "pld");
- const char* w = (is_half ? "w" : "");
- if (is_signed && !is_half) {
- opcode << "UNDEFINED [PLI+W]";
- } else if (Rn.r == PC || U != 0u) {
- opcode << pld_pli << w;
- args << "[" << Rn << ", #" << (U != 0u ? "" : "-") << imm12 << "]";
- if (Rn.r == PC && is_half) {
- args << " (UNPREDICTABLE)";
- }
- } else if ((instr & 0xFC0) == 0) {
- opcode << pld_pli << w;
- RmLslImm2 Rm(instr);
- args << "[" << Rn << ", " << Rm << "]";
- } else if (op4 == 0xC) {
- opcode << pld_pli << w;
- args << "[" << Rn << ", #-" << imm8 << "]";
- } else {
- opcode << "UNDEFINED [~" << pld_pli << "]";
- }
- break;
- }
- const char* ldr_str = is_load ? "ldr" : "str";
- const char* sign = is_signed ? "s" : "";
- const char* type = is_word ? "" : is_half ? "h" : "b";
- bool unpred = (Rt.r == SP && !is_word) || (Rt.r == PC && !is_load);
- if (Rn.r == PC && !is_load) {
- opcode << "UNDEFINED [STR-lit]";
- unpred = false;
- } else if (Rn.r == PC || U != 0u) {
- // Load/store with imm12 (load literal if Rn.r == PC; there's no store literal).
- opcode << ldr_str << sign << type << ".w";
- args << Rt << ", [" << Rn << ", #" << (U != 0u ? "" : "-") << imm12 << "]";
- if (Rn.r == TR && is_load) {
- args << " ; ";
- GetDisassemblerOptions()->thread_offset_name_function_(args, imm12);
- } else if (Rn.r == PC) {
- T2LitType lit_type[] = {
- kT2LitUByte, kT2LitUHalf, kT2LitHexWord, kT2LitInvalid,
- kT2LitUByte, kT2LitUHalf, kT2LitHexWord, kT2LitInvalid,
- kT2LitSByte, kT2LitSHalf, kT2LitInvalid, kT2LitInvalid,
- kT2LitSByte, kT2LitSHalf, kT2LitInvalid, kT2LitInvalid,
- };
- DCHECK_LT(op2 >> 1, arraysize(lit_type));
- DCHECK_NE(lit_type[op2 >> 1], kT2LitInvalid);
- DumpThumb2Literal(args, instr_ptr, lo_adr, hi_adr, U, imm12, lit_type[op2 >> 1]);
- }
- } else if ((instr & 0xFC0) == 0) {
- opcode << ldr_str << sign << type << ".w";
- RmLslImm2 Rm(instr);
- args << Rt << ", [" << Rn << ", " << Rm << "]";
- unpred = unpred || (Rm.rm.r == SP) || (Rm.rm.r == PC);
- } else if (is_word && Rn.r == SP && imm8 == 4 && op4 == (is_load ? 0xB : 0xD)) {
- opcode << (is_load ? "pop" : "push") << ".w";
- args << Rn;
- unpred = unpred || (Rn.r == SP);
- } else if ((op4 & 5) == 0) {
- opcode << "UNDEFINED [P = W = 0 for " << ldr_str << "]";
- unpred = false;
- } else {
- uint32_t P = (instr >> 10) & 1;
- U = (instr >> 9) & 1;
- uint32_t W = (instr >> 8) & 1;
- bool pre_index = (P != 0 && W == 1);
- bool post_index = (P == 0 && W == 1);
- const char* t = (P != 0 && U != 0 && W == 0) ? "t" : ""; // Unprivileged load/store?
- opcode << ldr_str << sign << type << t << ".w";
- args << Rt << ", [" << Rn << (post_index ? "]" : "") << ", #" << (U != 0 ? "" : "-")
- << imm8 << (post_index ? "" : "]") << (pre_index ? "!" : "");
- unpred = (W != 0 && Rn.r == Rt.r);
- }
- if (unpred) {
- args << " (UNPREDICTABLE)";
- }
- break;
- }
- case 0x29: { // 0101001
- // |111|11|1000000|0000|1111|1100|00|0 0|0000|
- // |5 3|21|0 4|3 0|5 2|1 8|76|5 4|3 0|
- // |---|--|-------|----|----|----|--|---|----|
- // |332|22|2222222|1111|1111|1100|00|0 0|0000|
- // |1 9|87|6 0|9 6|5 2|1 8|76|5 4|3 0|
- // |---|--|-------|----|----|----|--|---|----|
- // |111|11|0101001| Rm |1111| Rd |11|op3| Rm |
- // REV - 111 11 0101001 mmmm 1111 dddd 1000 mmmm
- // REV16 - 111 11 0101001 mmmm 1111 dddd 1001 mmmm
- // RBIT - 111 11 0101001 mmmm 1111 dddd 1010 mmmm
- // REVSH - 111 11 0101001 mmmm 1111 dddd 1011 mmmm
- if ((instr & 0xf0c0) == 0xf080) {
- uint32_t op3 = (instr >> 4) & 3;
- opcode << kThumbReverseOperations[op3];
- ArmRegister Rm(instr, 0);
- ArmRegister Rd(instr, 8);
- args << Rd << ", " << Rm;
- ArmRegister Rm2(instr, 16);
- if (Rm.r != Rm2.r || Rm.r == 13 || Rm.r == 15 || Rd.r == 13 || Rd.r == 15) {
- args << " (UNPREDICTABLE)";
- }
- } // else unknown instruction
- break;
- }
- case 0x2B: { // 0101011
- // CLZ - 111 11 0101011 mmmm 1111 dddd 1000 mmmm
- if ((instr & 0xf0f0) == 0xf080) {
- opcode << "clz";
- ArmRegister Rm(instr, 0);
- ArmRegister Rd(instr, 8);
- args << Rd << ", " << Rm;
- ArmRegister Rm2(instr, 16);
- if (Rm.r != Rm2.r || Rm.r == 13 || Rm.r == 15 || Rd.r == 13 || Rd.r == 15) {
- args << " (UNPREDICTABLE)";
- }
- }
- break;
- }
- case 0x7B: case 0x7F: {
- FpRegister d(instr, 12, 22);
- FpRegister m(instr, 0, 5);
- uint32_t sz = (instr >> 18) & 0x3; // Decode size bits.
- uint32_t size = (sz == 0) ? 8 : sz << 4;
- uint32_t opc2 = (instr >> 7) & 0xF;
- uint32_t Q = (instr >> 6) & 1;
- if (Q == 0 && opc2 == 0xA && size == 8) { // 1010, VCNT
- opcode << "vcnt." << size;
- args << d << ", " << m;
- } else if (Q == 0 && (opc2 == 0x4 || opc2 == 0x5) && size <= 32) { // 010x, VPADDL
- bool op = HasBitSet(instr, 7);
- opcode << "vpaddl." << (op ? "u" : "s") << size;
- args << d << ", " << m;
- } else {
- opcode << "UNKNOWN " << op2;
- }
- break;
- }
- default: // more formats
- if ((op2 >> 4) == 2) { // 010xxxx
- // data processing (register)
- if ((instr & 0x0080f0f0) == 0x0000f000) {
- // LSL, LSR, ASR, ROR
- uint32_t shift_op = (instr >> 21) & 3;
- uint32_t S = (instr >> 20) & 1;
- ArmRegister Rd(instr, 8);
- ArmRegister Rn(instr, 16);
- ArmRegister Rm(instr, 0);
- opcode << kThumb2ShiftOperations[shift_op] << (S != 0 ? "s" : "");
- args << Rd << ", " << Rn << ", " << Rm;
- }
- } else if ((op2 >> 3) == 6) { // 0110xxx
- // Multiply, multiply accumulate, and absolute difference
- op1 = (instr >> 20) & 0x7;
- op2 = (instr >> 4) & 0x1;
- ArmRegister Ra(instr, 12);
- ArmRegister Rn(instr, 16);
- ArmRegister Rm(instr, 0);
- ArmRegister Rd(instr, 8);
- switch (op1) {
- case 0:
- if (op2 == 0) {
- if (Ra.r == 0xf) {
- opcode << "mul";
- args << Rd << ", " << Rn << ", " << Rm;
- } else {
- opcode << "mla";
- args << Rd << ", " << Rn << ", " << Rm << ", " << Ra;
- }
- } else {
- opcode << "mls";
- args << Rd << ", " << Rn << ", " << Rm << ", " << Ra;
- }
- break;
- case 1:
- case 2:
- case 3:
- case 4:
- case 5:
- case 6:
- break; // do these sometime
- }
- } else if ((op2 >> 3) == 7) { // 0111xxx
- // Long multiply, long multiply accumulate, and divide
- op1 = (instr >> 20) & 0x7;
- op2 = (instr >> 4) & 0xf;
- ArmRegister Rn(instr, 16);
- ArmRegister Rm(instr, 0);
- ArmRegister Rd(instr, 8);
- ArmRegister RdHi(instr, 8);
- ArmRegister RdLo(instr, 12);
- switch (op1) {
- case 0:
- opcode << "smull";
- args << RdLo << ", " << RdHi << ", " << Rn << ", " << Rm;
- break;
- case 1:
- opcode << "sdiv";
- args << Rd << ", " << Rn << ", " << Rm;
- break;
- case 2:
- opcode << "umull";
- args << RdLo << ", " << RdHi << ", " << Rn << ", " << Rm;
- break;
- case 3:
- opcode << "udiv";
- args << Rd << ", " << Rn << ", " << Rm;
- break;
- case 4:
- case 5:
- case 6:
- break; // TODO: when we generate these...
- }
- }
- }
- break;
- default:
- break;
- }
-
- // Apply any IT-block conditions to the opcode if necessary.
- if (!it_conditions_.empty()) {
- opcode << it_conditions_.back();
- it_conditions_.pop_back();
- }
- if (opcode.str().size() == 0) {
- opcode << "UNKNOWN " << op2;
- }
-
- os << FormatInstructionPointer(instr_ptr)
- << StringPrintf(": %08x\t%-7s ", instr, opcode.str().c_str())
- << args.str() << '\n';
- return 4;
-} // NOLINT(readability/fn_size)
-
-size_t DisassemblerArm::DumpThumb16(std::ostream& os, const uint8_t* instr_ptr) {
- uint16_t instr = ReadU16(instr_ptr);
- bool is_32bit = ((instr & 0xF000) == 0xF000) || ((instr & 0xF800) == 0xE800);
- if (is_32bit) {
- return DumpThumb32(os, instr_ptr);
+ if (disasm_->IsT32()) {
+ const uint16_t* const ip = reinterpret_cast<const uint16_t*>(instr_ptr);
+ next = reinterpret_cast<uintptr_t>(disasm_->DecodeT32At(ip));
} else {
- std::ostringstream opcode;
- std::ostringstream args;
- uint16_t opcode1 = instr >> 10;
- if (opcode1 < 0x10) {
- // shift (immediate), add, subtract, move, and compare
- uint16_t opcode2 = instr >> 9;
- switch (opcode2) {
- case 0x0: case 0x1: case 0x2: case 0x3: case 0x4: case 0x5: case 0x6: case 0x7:
- case 0x8: case 0x9: case 0xA: case 0xB: {
- // Logical shift left - 00 000xx iii mmm ddd
- // Logical shift right - 00 001xx iii mmm ddd
- // Arithmetic shift right - 00 010xx iii mmm ddd
- uint16_t imm5 = (instr >> 6) & 0x1F;
- ThumbRegister rm(instr, 3);
- ThumbRegister Rd(instr, 0);
- if (opcode2 <= 3) {
- opcode << "lsls";
- } else if (opcode2 <= 7) {
- opcode << "lsrs";
- } else {
- opcode << "asrs";
- }
- args << Rd << ", " << rm << ", #" << imm5;
- break;
- }
- case 0xC: case 0xD: case 0xE: case 0xF: {
- // Add register - 00 01100 mmm nnn ddd
- // Sub register - 00 01101 mmm nnn ddd
- // Add 3-bit immediate - 00 01110 iii nnn ddd
- // Sub 3-bit immediate - 00 01111 iii nnn ddd
- uint16_t imm3_or_Rm = (instr >> 6) & 7;
- ThumbRegister Rn(instr, 3);
- ThumbRegister Rd(instr, 0);
- if ((opcode2 & 2) != 0 && imm3_or_Rm == 0) {
- opcode << "mov";
- } else {
- if ((opcode2 & 1) == 0) {
- opcode << "adds";
- } else {
- opcode << "subs";
- }
- }
- args << Rd << ", " << Rn;
- if ((opcode2 & 2) == 0) {
- ArmRegister Rm(imm3_or_Rm);
- args << ", " << Rm;
- } else if (imm3_or_Rm != 0) {
- args << ", #" << imm3_or_Rm;
- }
- break;
- }
- case 0x10: case 0x11: case 0x12: case 0x13:
- case 0x14: case 0x15: case 0x16: case 0x17:
- case 0x18: case 0x19: case 0x1A: case 0x1B:
- case 0x1C: case 0x1D: case 0x1E: case 0x1F: {
- // MOVS Rd, #imm8 - 00100 ddd iiiiiiii
- // CMP Rn, #imm8 - 00101 nnn iiiiiiii
- // ADDS Rn, #imm8 - 00110 nnn iiiiiiii
- // SUBS Rn, #imm8 - 00111 nnn iiiiiiii
- ThumbRegister Rn(instr, 8);
- uint16_t imm8 = instr & 0xFF;
- switch (opcode2 >> 2) {
- case 4: opcode << "movs"; break;
- case 5: opcode << "cmp"; break;
- case 6: opcode << "adds"; break;
- case 7: opcode << "subs"; break;
- }
- args << Rn << ", #" << imm8;
- break;
- }
- default:
- break;
- }
- } else if (opcode1 == 0x10) {
- // Data-processing
- uint16_t opcode2 = (instr >> 6) & 0xF;
- ThumbRegister rm(instr, 3);
- ThumbRegister rdn(instr, 0);
- opcode << kThumbDataProcessingOperations[opcode2];
- args << rdn << ", " << rm;
- } else if (opcode1 == 0x11) {
- // Special data instructions and branch and exchange
- uint16_t opcode2 = (instr >> 6) & 0x0F;
- switch (opcode2) {
- case 0x0: case 0x1: case 0x2: case 0x3: {
- // Add low registers - 010001 0000 xxxxxx
- // Add high registers - 010001 0001/001x xxxxxx
- uint16_t DN = (instr >> 7) & 1;
- ArmRegister rm(instr, 3);
- uint16_t Rdn = instr & 7;
- ArmRegister DN_Rdn((DN << 3) | Rdn);
- opcode << "add";
- args << DN_Rdn << ", " << rm;
- break;
- }
- case 0x8: case 0x9: case 0xA: case 0xB: {
- // Move low registers - 010001 1000 xxxxxx
- // Move high registers - 010001 1001/101x xxxxxx
- uint16_t DN = (instr >> 7) & 1;
- ArmRegister rm(instr, 3);
- uint16_t Rdn = instr & 7;
- ArmRegister DN_Rdn((DN << 3) | Rdn);
- opcode << "mov";
- args << DN_Rdn << ", " << rm;
- break;
- }
- case 0x5: case 0x6: case 0x7: {
- // Compare high registers - 010001 0101/011x xxxxxx
- uint16_t N = (instr >> 7) & 1;
- ArmRegister rm(instr, 3);
- uint16_t Rn = instr & 7;
- ArmRegister N_Rn((N << 3) | Rn);
- opcode << "cmp";
- args << N_Rn << ", " << rm;
- break;
- }
- case 0xC: case 0xD: case 0xE: case 0xF: {
- // Branch and exchange - 010001 110x xxxxxx
- // Branch with link and exchange - 010001 111x xxxxxx
- ArmRegister rm(instr, 3);
- opcode << ((opcode2 & 0x2) == 0 ? "bx" : "blx");
- args << rm;
- break;
- }
- default:
- break;
- }
- } else if (opcode1 == 0x12 || opcode1 == 0x13) { // 01001x
- const uintptr_t lo_adr = reinterpret_cast<intptr_t>(GetDisassemblerOptions()->base_address_);
- const uintptr_t hi_adr = reinterpret_cast<intptr_t>(GetDisassemblerOptions()->end_address_);
- ThumbRegister Rt(instr, 8);
- uint16_t imm8 = instr & 0xFF;
- opcode << "ldr";
- args << Rt << ", [pc, #" << (imm8 << 2) << "]";
- DumpThumb2Literal(args, instr_ptr, lo_adr, hi_adr, /*U*/ 1u, imm8 << 2, kT2LitHexWord);
- } else if ((opcode1 >= 0x14 && opcode1 <= 0x17) || // 0101xx
- (opcode1 >= 0x18 && opcode1 <= 0x1f) || // 011xxx
- (opcode1 >= 0x20 && opcode1 <= 0x27)) { // 100xxx
- // Load/store single data item
- uint16_t opA = (instr >> 12) & 0xF;
- if (opA == 0x5) {
- uint16_t opB = (instr >> 9) & 0x7;
- ThumbRegister Rm(instr, 6);
- ThumbRegister Rn(instr, 3);
- ThumbRegister Rt(instr, 0);
- switch (opB) {
- case 0: opcode << "str"; break;
- case 1: opcode << "strh"; break;
- case 2: opcode << "strb"; break;
- case 3: opcode << "ldrsb"; break;
- case 4: opcode << "ldr"; break;
- case 5: opcode << "ldrh"; break;
- case 6: opcode << "ldrb"; break;
- case 7: opcode << "ldrsh"; break;
- }
- args << Rt << ", [" << Rn << ", " << Rm << "]";
- } else if (opA == 9) {
- uint16_t opB = (instr >> 11) & 1;
- ThumbRegister Rt(instr, 8);
- uint16_t imm8 = instr & 0xFF;
- opcode << (opB == 0 ? "str" : "ldr");
- args << Rt << ", [sp, #" << (imm8 << 2) << "]";
- } else {
- uint16_t imm5 = (instr >> 6) & 0x1F;
- uint16_t opB = (instr >> 11) & 1;
- ThumbRegister Rn(instr, 3);
- ThumbRegister Rt(instr, 0);
- switch (opA) {
- case 6:
- imm5 <<= 2;
- opcode << (opB == 0 ? "str" : "ldr");
- break;
- case 7:
- imm5 <<= 0;
- opcode << (opB == 0 ? "strb" : "ldrb");
- break;
- case 8:
- imm5 <<= 1;
- opcode << (opB == 0 ? "strh" : "ldrh");
- break;
- }
- args << Rt << ", [" << Rn << ", #" << imm5 << "]";
- }
- } else if (opcode1 >= 0x34 && opcode1 <= 0x37) { // 1101xx
- int8_t imm8 = instr & 0xFF;
- uint32_t cond = (instr >> 8) & 0xF;
- opcode << "b";
- DumpCond(opcode, cond);
- DumpBranchTarget(args, instr_ptr + 4, (imm8 << 1));
- } else if ((instr & 0xF800) == 0xA800) {
- // Generate SP-relative address
- ThumbRegister rd(instr, 8);
- int imm8 = instr & 0xFF;
- opcode << "add";
- args << rd << ", sp, #" << (imm8 << 2);
- } else if ((instr & 0xF000) == 0xB000) {
- // Miscellaneous 16-bit instructions
- uint16_t opcode2 = (instr >> 5) & 0x7F;
- switch (opcode2) {
- case 0x00: case 0x01: case 0x02: case 0x03: case 0x04: case 0x05: case 0x06: case 0x07: {
- // Add immediate to SP - 1011 00000 ii iiiii
- // Subtract immediate from SP - 1011 00001 ii iiiii
- int imm7 = instr & 0x7F;
- opcode << ((opcode2 & 4) == 0 ? "add" : "sub");
- args << "sp, sp, #" << (imm7 << 2);
- break;
- }
- case 0x08: case 0x09: case 0x0A: case 0x0B: // 0001xxx
- case 0x0C: case 0x0D: case 0x0E: case 0x0F:
- case 0x18: case 0x19: case 0x1A: case 0x1B: // 0011xxx
- case 0x1C: case 0x1D: case 0x1E: case 0x1F:
- case 0x48: case 0x49: case 0x4A: case 0x4B: // 1001xxx
- case 0x4C: case 0x4D: case 0x4E: case 0x4F:
- case 0x58: case 0x59: case 0x5A: case 0x5B: // 1011xxx
- case 0x5C: case 0x5D: case 0x5E: case 0x5F: {
- // CBNZ, CBZ
- uint16_t op = (instr >> 11) & 1;
- uint16_t i = (instr >> 9) & 1;
- uint16_t imm5 = (instr >> 3) & 0x1F;
- ThumbRegister Rn(instr, 0);
- opcode << (op != 0 ? "cbnz" : "cbz");
- uint32_t imm32 = (i << 6) | (imm5 << 1);
- args << Rn << ", ";
- DumpBranchTarget(args, instr_ptr + 4, imm32);
- break;
- }
- case 0x20: case 0x21: case 0x22: case 0x23: case 0x24: case 0x25: case 0x26: case 0x27:
- case 0x28: case 0x29: case 0x2A: case 0x2B: case 0x2C: case 0x2D: case 0x2E: case 0x2F: {
- opcode << "push";
- args << RegisterList((instr & 0xFF) | ((instr & 0x100) << 6));
- break;
- }
- case 0x60: case 0x61: case 0x62: case 0x63: case 0x64: case 0x65: case 0x66: case 0x67:
- case 0x68: case 0x69: case 0x6A: case 0x6B: case 0x6C: case 0x6D: case 0x6E: case 0x6F: {
- opcode << "pop";
- args << RegisterList((instr & 0xFF) | ((instr & 0x100) << 7));
- break;
- }
- case 0x70: case 0x71: case 0x72: case 0x73: case 0x74: case 0x75: case 0x76: case 0x77: {
- opcode << "bkpt";
- args << "#" << (instr & 0xFF);
- break;
- }
- case 0x50: case 0x51: // 101000x
- case 0x52: case 0x53: // 101001x
- case 0x56: case 0x57: { // 101011x
- uint16_t op = (instr >> 6) & 3;
- opcode << kThumbReverseOperations[op];
- ThumbRegister Rm(instr, 3);
- ThumbRegister Rd(instr, 0);
- args << Rd << ", " << Rm;
- break;
- }
- case 0x78: case 0x79: case 0x7A: case 0x7B: // 1111xxx
- case 0x7C: case 0x7D: case 0x7E: case 0x7F: {
- // If-Then, and hints
- uint16_t opA = (instr >> 4) & 0xF;
- uint16_t opB = instr & 0xF;
- if (opB == 0) {
- switch (opA) {
- case 0: opcode << "nop"; break;
- case 1: opcode << "yield"; break;
- case 2: opcode << "wfe"; break;
- case 3: opcode << "sev"; break;
- default: break;
- }
- } else {
- uint32_t first_cond = opA;
- uint32_t mask = opB;
- opcode << "it";
-
- // Flesh out the base "it" opcode with the specific collection of 't's and 'e's,
- // and store up the actual condition codes we'll want to add to the next few opcodes.
- size_t count = 3 - CTZ(mask);
- it_conditions_.resize(count + 2); // Plus the implicit 't', plus the "" for the IT itself.
- for (size_t i = 0; i < count; ++i) {
- bool positive_cond = ((first_cond & 1) != 0);
- bool positive_mask = ((mask & (1 << (3 - i))) != 0);
- if (positive_mask == positive_cond) {
- opcode << 't';
- it_conditions_[i] = kConditionCodeNames[first_cond];
- } else {
- opcode << 'e';
- it_conditions_[i] = kConditionCodeNames[first_cond ^ 1];
- }
- }
- it_conditions_[count] = kConditionCodeNames[first_cond]; // The implicit 't'.
-
- it_conditions_[count + 1] = ""; // No condition code for the IT itself...
- DumpCond(args, first_cond); // ...because it's considered an argument.
- }
- break;
- }
- default:
- break;
- }
- } else if (((instr & 0xF000) == 0x5000) || ((instr & 0xE000) == 0x6000) ||
- ((instr & 0xE000) == 0x8000)) {
- // Load/store single data item
- uint16_t opA = instr >> 12;
- // uint16_t opB = (instr >> 9) & 7;
- switch (opA) {
- case 0x6: {
- // STR Rt, [Rn, #imm] - 01100 iiiii nnn ttt
- // LDR Rt, [Rn, #imm] - 01101 iiiii nnn ttt
- uint16_t imm5 = (instr >> 6) & 0x1F;
- ThumbRegister Rn(instr, 3);
- ThumbRegister Rt(instr, 0);
- opcode << ((instr & 0x800) == 0 ? "str" : "ldr");
- args << Rt << ", [" << Rn << ", #" << (imm5 << 2) << "]";
- break;
- }
- case 0x9: {
- // STR Rt, [SP, #imm] - 01100 ttt iiiiiiii
- // LDR Rt, [SP, #imm] - 01101 ttt iiiiiiii
- uint16_t imm8 = instr & 0xFF;
- ThumbRegister Rt(instr, 8);
- opcode << ((instr & 0x800) == 0 ? "str" : "ldr");
- args << Rt << ", [sp, #" << (imm8 << 2) << "]";
- break;
- }
- default:
- break;
- }
- } else if (opcode1 == 0x38 || opcode1 == 0x39) {
- uint16_t imm11 = instr & 0x7FFF;
- int32_t imm32 = imm11 << 1;
- imm32 = (imm32 << 20) >> 20; // sign extend 12 bit immediate
- opcode << "b";
- DumpBranchTarget(args, instr_ptr + 4, imm32);
- }
-
- // Apply any IT-block conditions to the opcode if necessary.
- if (!it_conditions_.empty()) {
- opcode << it_conditions_.back();
- it_conditions_.pop_back();
- }
-
- os << FormatInstructionPointer(instr_ptr)
- << StringPrintf(": %04x \t%-7s ", instr, opcode.str().c_str())
- << args.str() << '\n';
+ const uint32_t* const ip = reinterpret_cast<const uint32_t*>(instr_ptr);
+ next = reinterpret_cast<uintptr_t>(disasm_->DecodeA32At(ip));
}
- return 2;
+
+ os << output_.str();
+ output_.str(std::string());
+ return next - instr_ptr;
+}
+
+void DisassemblerArm::Dump(std::ostream& os, const uint8_t* begin, const uint8_t* end) {
+ DCHECK_LE(begin, end);
+
+ // Remove the Thumb specifier bit; no effect if begin does not point to T32 code.
+ const uintptr_t base = reinterpret_cast<uintptr_t>(begin) & ~1;
+
+ disasm_->SetT32((reinterpret_cast<uintptr_t>(begin) & 1) != 0);
+ disasm_->JumpToPc(GetPc(base));
+
+ if (disasm_->IsT32()) {
+ // The Thumb specifier bits cancel each other.
+ disasm_->DisassembleT32Buffer(reinterpret_cast<const uint16_t*>(base), end - begin);
+ } else {
+ disasm_->DisassembleA32Buffer(reinterpret_cast<const uint32_t*>(base), end - begin);
+ }
+
+ os << output_.str();
+ output_.str(std::string());
}
} // namespace arm
diff --git a/disassembler/disassembler_arm.h b/disassembler/disassembler_arm.h
index f870e8e..237b577 100644
--- a/disassembler/disassembler_arm.h
+++ b/disassembler/disassembler_arm.h
@@ -17,32 +17,33 @@
#ifndef ART_DISASSEMBLER_DISASSEMBLER_ARM_H_
#define ART_DISASSEMBLER_DISASSEMBLER_ARM_H_
-#include <vector>
+#include <memory>
+#include <sstream>
+#include "base/macros.h"
#include "disassembler.h"
namespace art {
namespace arm {
class DisassemblerArm FINAL : public Disassembler {
+ class CustomDisassembler;
+
public:
- explicit DisassemblerArm(DisassemblerOptions* options) : Disassembler(options) {}
+ explicit DisassemblerArm(DisassemblerOptions* options);
size_t Dump(std::ostream& os, const uint8_t* begin) OVERRIDE;
void Dump(std::ostream& os, const uint8_t* begin, const uint8_t* end) OVERRIDE;
private:
- void DumpArm(std::ostream& os, const uint8_t* instr);
+ uintptr_t GetPc(uintptr_t instr_ptr) const {
+ return GetDisassemblerOptions()->absolute_addresses_
+ ? instr_ptr
+ : instr_ptr - reinterpret_cast<uintptr_t>(GetDisassemblerOptions()->base_address_);
+ }
- // Returns the size of the instruction just decoded
- size_t DumpThumb16(std::ostream& os, const uint8_t* instr);
- size_t DumpThumb32(std::ostream& os, const uint8_t* instr_ptr);
-
- void DumpBranchTarget(std::ostream& os, const uint8_t* instr_ptr, int32_t imm32);
- void DumpCond(std::ostream& os, uint32_t cond);
- void DumpMemoryDomain(std::ostream& os, uint32_t domain);
-
- std::vector<const char*> it_conditions_;
+ std::ostringstream output_;
+ std::unique_ptr<CustomDisassembler> disasm_;
DISALLOW_COPY_AND_ASSIGN(DisassemblerArm);
};
diff --git a/imgdiag/Android.bp b/imgdiag/Android.bp
index 639b8e8..7837d66 100644
--- a/imgdiag/Android.bp
+++ b/imgdiag/Android.bp
@@ -73,7 +73,7 @@
art_cc_test {
name: "art_imgdiag_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["imgdiag_test.cc"],
}
diff --git a/oatdump/Android.bp b/oatdump/Android.bp
index 02a51a6..dd6331c 100644
--- a/oatdump/Android.bp
+++ b/oatdump/Android.bp
@@ -53,6 +53,7 @@
art_cc_binary {
name: "oatdumps",
defaults: ["oatdump-defaults"],
+ device_supported: false,
target: {
darwin: {
enabled: false,
@@ -73,6 +74,7 @@
"art_debug_defaults",
"oatdump-defaults",
],
+ device_supported: false,
target: {
darwin: {
enabled: false,
@@ -90,7 +92,7 @@
art_cc_test {
name: "art_oatdump_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["oatdump_test.cc"],
}
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index db6a709..d8ac581 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -526,7 +526,7 @@
} else {
const char* descriptor = m->GetDeclaringClassDescriptor();
const DexFile::ClassDef* class_def =
- dex_file->FindClassDef(descriptor, ComputeModifiedUtf8Hash(descriptor));
+ OatDexFile::FindClassDef(*dex_file, descriptor, ComputeModifiedUtf8Hash(descriptor));
if (class_def != nullptr) {
uint16_t class_def_index = dex_file->GetIndexForClassDef(*class_def);
const OatFile::OatClass oat_class = oat_dex_file->GetOatClass(class_def_index);
@@ -742,7 +742,7 @@
if (oat_dex_file.GetLookupTableData() != nullptr) {
uint32_t table_offset = dchecked_integral_cast<uint32_t>(
oat_dex_file.GetLookupTableData() - oat_file_begin);
- uint32_t table_size = TypeLookupTable::RawDataLength(*dex_file);
+ uint32_t table_size = TypeLookupTable::RawDataLength(dex_file->NumClassDefs());
os << StringPrintf("type-table: 0x%08x..0x%08x\n",
table_offset,
table_offset + table_size - 1);
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index 5240011..1af3660 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -37,8 +37,8 @@
#include "elf_file_impl.h"
#include "gc/space/image_space.h"
#include "image-inl.h"
-#include "mirror/abstract_method.h"
#include "mirror/dex_cache.h"
+#include "mirror/executable.h"
#include "mirror/object-inl.h"
#include "mirror/method.h"
#include "mirror/reference.h"
@@ -770,8 +770,8 @@
} else if (object->GetClass() == mirror::Method::StaticClass() ||
object->GetClass() == mirror::Constructor::StaticClass()) {
// Need to go update the ArtMethod.
- auto* dest = down_cast<mirror::AbstractMethod*>(copy);
- auto* src = down_cast<mirror::AbstractMethod*>(object);
+ auto* dest = down_cast<mirror::Executable*>(copy);
+ auto* src = down_cast<mirror::Executable*>(object);
dest->SetArtMethod(RelocatedAddressOfPointer(src->GetArtMethod()));
}
}
diff --git a/profman/Android.bp b/profman/Android.bp
index cd1aaab..322dda2 100644
--- a/profman/Android.bp
+++ b/profman/Android.bp
@@ -56,7 +56,7 @@
art_cc_test {
name: "art_profman_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: ["profile_assistant_test.cc"],
}
diff --git a/profman/profman.cc b/profman/profman.cc
index a5fefa7..7722e80 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -280,18 +280,11 @@
for (size_t i = 0; i < dex_locations_.size(); ++i) {
std::string error_msg;
std::vector<std::unique_ptr<const DexFile>> dex_files_for_location;
- std::unique_ptr<ZipArchive> zip_archive(ZipArchive::OpenFromFd(apks_fd_[i],
- dex_locations_[i].c_str(),
- &error_msg));
- if (zip_archive == nullptr) {
- LOG(WARNING) << "OpenFromFd failed for '" << dex_locations_[i] << "' " << error_msg;
- continue;
- }
- if (DexFile::OpenFromZip(*zip_archive,
- dex_locations_[i],
- kVerifyChecksum,
- &error_msg,
- &dex_files_for_location)) {
+ if (DexFile::OpenZip(apks_fd_[i],
+ dex_locations_[i],
+ kVerifyChecksum,
+ &error_msg,
+ &dex_files_for_location)) {
} else {
LOG(WARNING) << "OpenFromZip failed for '" << dex_locations_[i] << "' " << error_msg;
continue;
diff --git a/runtime/Android.bp b/runtime/Android.bp
index c00689b..6234a84 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -120,10 +120,10 @@
"linear_alloc.cc",
"mem_map.cc",
"memory_region.cc",
- "mirror/abstract_method.cc",
"mirror/array.cc",
"mirror/class.cc",
"mirror/dex_cache.cc",
+ "mirror/executable.cc",
"mirror/field.cc",
"mirror/method.cc",
"mirror/object.cc",
@@ -151,9 +151,9 @@
"native/java_lang_VMClassLoader.cc",
"native/java_lang_ref_FinalizerReference.cc",
"native/java_lang_ref_Reference.cc",
- "native/java_lang_reflect_AbstractMethod.cc",
"native/java_lang_reflect_Array.cc",
"native/java_lang_reflect_Constructor.cc",
+ "native/java_lang_reflect_Executable.cc",
"native/java_lang_reflect_Field.cc",
"native/java_lang_reflect_Method.cc",
"native/java_lang_reflect_Parameter.cc",
@@ -475,7 +475,7 @@
art_cc_test {
name: "art_runtime_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: [
"arch/arch_test.cc",
@@ -570,7 +570,7 @@
art_cc_test {
name: "art_runtime_compiler_tests",
defaults: [
- "art_test_defaults",
+ "art_gtest_defaults",
],
srcs: [
"jni_internal_test.cc",
diff --git a/runtime/arch/arm/asm_support_arm.S b/runtime/arch/arm/asm_support_arm.S
index 38ca76a..9eca862 100644
--- a/runtime/arch/arm/asm_support_arm.S
+++ b/runtime/arch/arm/asm_support_arm.S
@@ -68,14 +68,14 @@
.set .Lruntime_current3_used, 0
// The RUNTIME_CURRENT macros that are bound to the \name argument of DEF_ENTRY to ensure
// that label names are unique.
- .macro RUNTIME_CURRENT1 rDest, rTemp
- RUNTIME_CURRENT \name, 1, \rDest, \rTemp
+ .macro RUNTIME_CURRENT1 rDest
+ RUNTIME_CURRENT \name, 1, \rDest
.endm
- .macro RUNTIME_CURRENT2 rDest, rTemp
- RUNTIME_CURRENT \name, 2, \rDest, \rTemp
+ .macro RUNTIME_CURRENT2 rDest
+ RUNTIME_CURRENT \name, 2, \rDest
.endm
- .macro RUNTIME_CURRENT3 rDest, rTemp
- RUNTIME_CURRENT \name, 3, \rDest, \rTemp
+ .macro RUNTIME_CURRENT3 rDest
+ RUNTIME_CURRENT \name, 3, \rDest
.endm
.endm
diff --git a/runtime/arch/arm/quick_entrypoints_arm.S b/runtime/arch/arm/quick_entrypoints_arm.S
index 0b04480..5d53062 100644
--- a/runtime/arch/arm/quick_entrypoints_arm.S
+++ b/runtime/arch/arm/quick_entrypoints_arm.S
@@ -272,6 +272,15 @@
END \c_name
.endm
+.macro NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING c_name, cxx_name
+ .extern \cxx_name
+ENTRY \c_name
+ SETUP_SAVE_EVERYTHING_FRAME r0 @ save all registers as basis for long jump context
+ mov r0, r9 @ pass Thread::Current
+ bl \cxx_name @ \cxx_name(Thread*)
+END \c_name
+.endm
+
.macro ONE_ARG_RUNTIME_EXCEPTION c_name, cxx_name
.extern \cxx_name
ENTRY \c_name
@@ -281,10 +290,10 @@
END \c_name
.endm
-.macro TWO_ARG_RUNTIME_EXCEPTION c_name, cxx_name
+.macro TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING c_name, cxx_name
.extern \cxx_name
ENTRY \c_name
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME r2 @ save all registers as basis for long jump context
+ SETUP_SAVE_EVERYTHING_FRAME r2 @ save all registers as basis for long jump context
mov r2, r9 @ pass Thread::Current
bl \cxx_name @ \cxx_name(Thread*)
END \c_name
@@ -361,7 +370,7 @@
/*
* Called by managed code to create and deliver a NullPointerException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
/*
* Call installed by a signal handler to create and deliver a NullPointerException.
@@ -398,19 +407,19 @@
/*
* Called by managed code to create and deliver an ArithmeticException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_div_zero, artThrowDivZeroFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_div_zero, artThrowDivZeroFromCode
/*
* Called by managed code to create and deliver an ArrayIndexOutOfBoundsException. Arg1 holds
* index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
/*
* Called by managed code to create and deliver a StringIndexOutOfBoundsException
* as if thrown from a call to String.charAt(). Arg1 holds index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_string_bounds, artThrowStringBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_string_bounds, artThrowStringBoundsFromCode
/*
* Called by managed code to create and deliver a StackOverflowError.
diff --git a/runtime/arch/arm64/quick_entrypoints_arm64.S b/runtime/arch/arm64/quick_entrypoints_arm64.S
index e9d03d7..eee949d 100644
--- a/runtime/arch/arm64/quick_entrypoints_arm64.S
+++ b/runtime/arch/arm64/quick_entrypoints_arm64.S
@@ -434,6 +434,17 @@
SETUP_SAVE_ALL_CALLEE_SAVES_FRAME // save all registers as basis for long jump context
mov x0, xSELF // pass Thread::Current
bl \cxx_name // \cxx_name(Thread*)
+ brk 0
+END \c_name
+.endm
+
+.macro NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING c_name, cxx_name
+ .extern \cxx_name
+ENTRY \c_name
+ SETUP_SAVE_EVERYTHING_FRAME // save all registers as basis for long jump context
+ mov x0, xSELF // pass Thread::Current
+ bl \cxx_name // \cxx_name(Thread*)
+ brk 0
END \c_name
.endm
@@ -447,10 +458,10 @@
END \c_name
.endm
-.macro TWO_ARG_RUNTIME_EXCEPTION c_name, cxx_name
+.macro TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING c_name, cxx_name
.extern \cxx_name
ENTRY \c_name
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME // save all registers as basis for long jump context
+ SETUP_SAVE_EVERYTHING_FRAME // save all registers as basis for long jump context
mov x2, xSELF // pass Thread::Current
bl \cxx_name // \cxx_name(arg1, arg2, Thread*)
brk 0
@@ -466,7 +477,7 @@
/*
* Called by managed code to create and deliver a NullPointerException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
/*
* Call installed by a signal handler to create and deliver a NullPointerException.
@@ -490,19 +501,19 @@
/*
* Called by managed code to create and deliver an ArithmeticException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_div_zero, artThrowDivZeroFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_div_zero, artThrowDivZeroFromCode
/*
* Called by managed code to create and deliver an ArrayIndexOutOfBoundsException. Arg1 holds
* index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
/*
* Called by managed code to create and deliver a StringIndexOutOfBoundsException
* as if thrown from a call to String.charAt(). Arg1 holds index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_string_bounds, artThrowStringBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_string_bounds, artThrowStringBoundsFromCode
/*
* Called by managed code to create and deliver a StackOverflowError.
diff --git a/runtime/arch/mips/asm_support_mips.S b/runtime/arch/mips/asm_support_mips.S
index 7955b1d..948b06c 100644
--- a/runtime/arch/mips/asm_support_mips.S
+++ b/runtime/arch/mips/asm_support_mips.S
@@ -26,22 +26,6 @@
// Register holding Thread::Current().
#define rSELF $s1
- // Declare a function called name, sets up $gp.
-.macro ENTRY name
- .type \name, %function
- .global \name
- // Cache alignment for function entry.
- .balign 16
-\name:
- .cfi_startproc
- // Ensure we get a sane starting CFA.
- .cfi_def_cfa $sp,0
- // Load $gp. We expect that ".set noreorder" is in effect.
- .cpload $t9
- // Declare a local convenience label to be branched to when $gp is already set up.
-.L\name\()_gp_set:
-.endm
-
// Declare a function called name, doesn't set up $gp.
.macro ENTRY_NO_GP_CUSTOM_CFA name, cfa_offset
.type \name, %function
@@ -59,6 +43,15 @@
ENTRY_NO_GP_CUSTOM_CFA \name, 0
.endm
+ // Declare a function called name, sets up $gp.
+.macro ENTRY name
+ ENTRY_NO_GP \name
+ // Load $gp. We expect that ".set noreorder" is in effect.
+ .cpload $t9
+ // Declare a local convenience label to be branched to when $gp is already set up.
+.L\name\()_gp_set:
+.endm
+
.macro END name
.cfi_endproc
.size \name, .-\name
diff --git a/runtime/arch/mips/fault_handler_mips.cc b/runtime/arch/mips/fault_handler_mips.cc
index b6a63ca..1792f31 100644
--- a/runtime/arch/mips/fault_handler_mips.cc
+++ b/runtime/arch/mips/fault_handler_mips.cc
@@ -90,7 +90,7 @@
sc->sc_regs[mips::RA] = sc->sc_pc + 4; // RA needs to point to gc map location
sc->sc_pc = reinterpret_cast<uintptr_t>(art_quick_throw_null_pointer_exception_from_signal);
- sc->sc_regs[mips::T9] = sc->sc_pc; // make sure T9 points to the function
+ // Note: This entrypoint does not rely on T9 pointing to it, so we may as well preserve T9.
VLOG(signals) << "Generating null pointer exception";
return true;
}
diff --git a/runtime/arch/mips/quick_entrypoints_mips.S b/runtime/arch/mips/quick_entrypoints_mips.S
index 4563004..c3c1882 100644
--- a/runtime/arch/mips/quick_entrypoints_mips.S
+++ b/runtime/arch/mips/quick_entrypoints_mips.S
@@ -710,8 +710,10 @@
* Called by managed code to create and deliver a NullPointerException
*/
.extern artThrowNullPointerExceptionFromCode
-ENTRY art_quick_throw_null_pointer_exception
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_null_pointer_exception
+ // Note that setting up $gp does not rely on $t9 here, so branching here directly is OK,
+ // even after clobbering any registers we don't need to preserve, such as $gp or $t0.
+ SETUP_SAVE_EVERYTHING_FRAME
la $t9, artThrowNullPointerExceptionFromCode
jalr $zero, $t9 # artThrowNullPointerExceptionFromCode(Thread*)
move $a0, rSELF # pass Thread::Current
@@ -735,8 +737,8 @@
* Called by managed code to create and deliver an ArithmeticException
*/
.extern artThrowDivZeroFromCode
-ENTRY art_quick_throw_div_zero
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_div_zero
+ SETUP_SAVE_EVERYTHING_FRAME
la $t9, artThrowDivZeroFromCode
jalr $zero, $t9 # artThrowDivZeroFromCode(Thread*)
move $a0, rSELF # pass Thread::Current
@@ -746,8 +748,10 @@
* Called by managed code to create and deliver an ArrayIndexOutOfBoundsException
*/
.extern artThrowArrayBoundsFromCode
-ENTRY art_quick_throw_array_bounds
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_array_bounds
+ // Note that setting up $gp does not rely on $t9 here, so branching here directly is OK,
+ // even after clobbering any registers we don't need to preserve, such as $gp or $t0.
+ SETUP_SAVE_EVERYTHING_FRAME
la $t9, artThrowArrayBoundsFromCode
jalr $zero, $t9 # artThrowArrayBoundsFromCode(index, limit, Thread*)
move $a2, rSELF # pass Thread::Current
@@ -758,8 +762,8 @@
* as if thrown from a call to String.charAt().
*/
.extern artThrowStringBoundsFromCode
-ENTRY art_quick_throw_string_bounds
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_string_bounds
+ SETUP_SAVE_EVERYTHING_FRAME
la $t9, artThrowStringBoundsFromCode
jalr $zero, $t9 # artThrowStringBoundsFromCode(index, limit, Thread*)
move $a2, rSELF # pass Thread::Current
@@ -1123,7 +1127,7 @@
*/
.extern artLockObjectFromCode
ENTRY art_quick_lock_object
- beqz $a0, .Lart_quick_throw_null_pointer_exception_gp_set
+ beqz $a0, art_quick_throw_null_pointer_exception
nop
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case we block
la $t9, artLockObjectFromCode
@@ -1133,7 +1137,7 @@
END art_quick_lock_object
ENTRY art_quick_lock_object_no_inline
- beqz $a0, .Lart_quick_throw_null_pointer_exception_gp_set
+ beqz $a0, art_quick_throw_null_pointer_exception
nop
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case we block
la $t9, artLockObjectFromCode
@@ -1147,7 +1151,7 @@
*/
.extern artUnlockObjectFromCode
ENTRY art_quick_unlock_object
- beqz $a0, .Lart_quick_throw_null_pointer_exception_gp_set
+ beqz $a0, art_quick_throw_null_pointer_exception
nop
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case exception allocation triggers GC
la $t9, artUnlockObjectFromCode
@@ -1157,7 +1161,7 @@
END art_quick_unlock_object
ENTRY art_quick_unlock_object_no_inline
- beqz $a0, .Lart_quick_throw_null_pointer_exception_gp_set
+ beqz $a0, art_quick_throw_null_pointer_exception
nop
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case exception allocation triggers GC
la $t9, artUnlockObjectFromCode
@@ -1280,7 +1284,7 @@
ENTRY art_quick_aput_obj_with_null_and_bound_check
bnez $a0, .Lart_quick_aput_obj_with_bound_check_gp_set
nop
- b .Lart_quick_throw_null_pointer_exception_gp_set
+ b art_quick_throw_null_pointer_exception
nop
END art_quick_aput_obj_with_null_and_bound_check
@@ -1290,7 +1294,7 @@
bnez $t1, .Lart_quick_aput_obj_gp_set
nop
move $a0, $a1
- b .Lart_quick_throw_array_bounds_gp_set
+ b art_quick_throw_array_bounds
move $a1, $t0
END art_quick_aput_obj_with_bound_check
diff --git a/runtime/arch/mips64/asm_support_mips64.S b/runtime/arch/mips64/asm_support_mips64.S
index 6c58fcf..35f20fb 100644
--- a/runtime/arch/mips64/asm_support_mips64.S
+++ b/runtime/arch/mips64/asm_support_mips64.S
@@ -27,24 +27,6 @@
#define rSELF $s1
- // Declare a function called name, sets up $gp.
- // This macro modifies t8.
-.macro ENTRY name
- .type \name, %function
- .global \name
- // Cache alignment for function entry.
- .balign 16
-\name:
- .cfi_startproc
- // Set up $gp and store the previous $gp value to $t8. It will be pushed to the
- // stack after the frame has been constructed.
- .cpsetup $t9, $t8, \name
- // Ensure we get a sane starting CFA.
- .cfi_def_cfa $sp,0
- // Declare a local convenience label to be branched to when $gp is already set up.
-.L\name\()_gp_set:
-.endm
-
// Declare a function called name, doesn't set up $gp.
.macro ENTRY_NO_GP_CUSTOM_CFA name, cfa_offset
.type \name, %function
@@ -62,6 +44,17 @@
ENTRY_NO_GP_CUSTOM_CFA \name, 0
.endm
+ // Declare a function called name, sets up $gp.
+ // This macro modifies t8.
+.macro ENTRY name
+ ENTRY_NO_GP \name
+ // Set up $gp and store the previous $gp value to $t8. It will be pushed to the
+ // stack after the frame has been constructed.
+ .cpsetup $t9, $t8, \name
+ // Declare a local convenience label to be branched to when $gp is already set up.
+.L\name\()_gp_set:
+.endm
+
.macro END name
.cfi_endproc
.size \name, .-\name
diff --git a/runtime/arch/mips64/fault_handler_mips64.cc b/runtime/arch/mips64/fault_handler_mips64.cc
index e52dc73..709cab5 100644
--- a/runtime/arch/mips64/fault_handler_mips64.cc
+++ b/runtime/arch/mips64/fault_handler_mips64.cc
@@ -91,7 +91,7 @@
sc->sc_regs[mips64::RA] = sc->sc_pc + 4; // RA needs to point to gc map location
sc->sc_pc = reinterpret_cast<uintptr_t>(art_quick_throw_null_pointer_exception_from_signal);
- sc->sc_regs[mips64::T9] = sc->sc_pc; // make sure T9 points to the function
+ // Note: This entrypoint does not rely on T9 pointing to it, so we may as well preserve T9.
VLOG(signals) << "Generating null pointer exception";
return true;
}
diff --git a/runtime/arch/mips64/quick_entrypoints_mips64.S b/runtime/arch/mips64/quick_entrypoints_mips64.S
index c16e855..8fc7bc3 100644
--- a/runtime/arch/mips64/quick_entrypoints_mips64.S
+++ b/runtime/arch/mips64/quick_entrypoints_mips64.S
@@ -817,9 +817,10 @@
* Called by managed code to create and deliver a NullPointerException
*/
.extern artThrowNullPointerExceptionFromCode
-ENTRY art_quick_throw_null_pointer_exception
-.Lart_quick_throw_null_pointer_exception_gp_set:
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_null_pointer_exception
+ // Note that setting up $gp does not rely on $t9 here, so branching here directly is OK,
+ // even after clobbering any registers we don't need to preserve, such as $gp or $t0.
+ SETUP_SAVE_EVERYTHING_FRAME
dla $t9, artThrowNullPointerExceptionFromCode
jalr $zero, $t9 # artThrowNullPointerExceptionFromCode(Thread*)
move $a0, rSELF # pass Thread::Current
@@ -842,8 +843,8 @@
* Called by managed code to create and deliver an ArithmeticException
*/
.extern artThrowDivZeroFromCode
-ENTRY art_quick_throw_div_zero
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_div_zero
+ SETUP_SAVE_EVERYTHING_FRAME
dla $t9, artThrowDivZeroFromCode
jalr $zero, $t9 # artThrowDivZeroFromCode(Thread*)
move $a0, rSELF # pass Thread::Current
@@ -854,9 +855,10 @@
* ArrayIndexOutOfBoundsException
*/
.extern artThrowArrayBoundsFromCode
-ENTRY art_quick_throw_array_bounds
-.Lart_quick_throw_array_bounds_gp_set:
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_array_bounds
+ // Note that setting up $gp does not rely on $t9 here, so branching here directly is OK,
+ // even after clobbering any registers we don't need to preserve, such as $gp or $t0.
+ SETUP_SAVE_EVERYTHING_FRAME
dla $t9, artThrowArrayBoundsFromCode
jalr $zero, $t9 # artThrowArrayBoundsFromCode(index, limit, Thread*)
move $a2, rSELF # pass Thread::Current
@@ -867,9 +869,8 @@
* as if thrown from a call to String.charAt().
*/
.extern artThrowStringBoundsFromCode
-ENTRY art_quick_throw_string_bounds
-.Lart_quick_throw_string_bounds_gp_set:
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME
+ENTRY_NO_GP art_quick_throw_string_bounds
+ SETUP_SAVE_EVERYTHING_FRAME
dla $t9, artThrowStringBoundsFromCode
jalr $zero, $t9 # artThrowStringBoundsFromCode(index, limit, Thread*)
move $a2, rSELF # pass Thread::Current
@@ -1210,18 +1211,20 @@
* Entry from managed code that calls artLockObjectFromCode, may block for GC.
*/
.extern artLockObjectFromCode
-ENTRY art_quick_lock_object
- beq $a0, $zero, .Lart_quick_throw_null_pointer_exception_gp_set
+ENTRY_NO_GP art_quick_lock_object
+ beq $a0, $zero, art_quick_throw_null_pointer_exception
nop
+ .cpsetup $t9, $t8, art_quick_lock_object
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case we block
jal artLockObjectFromCode # (Object* obj, Thread*)
move $a1, rSELF # pass Thread::Current
RETURN_IF_ZERO
END art_quick_lock_object
-ENTRY art_quick_lock_object_no_inline
- beq $a0, $zero, .Lart_quick_throw_null_pointer_exception_gp_set
+ENTRY_NO_GP art_quick_lock_object_no_inline
+ beq $a0, $zero, art_quick_throw_null_pointer_exception
nop
+ .cpsetup $t9, $t8, art_quick_lock_object_no_inline
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case we block
jal artLockObjectFromCode # (Object* obj, Thread*)
move $a1, rSELF # pass Thread::Current
@@ -1232,18 +1235,20 @@
* Entry from managed code that calls artUnlockObjectFromCode and delivers exception on failure.
*/
.extern artUnlockObjectFromCode
-ENTRY art_quick_unlock_object
- beq $a0, $zero, .Lart_quick_throw_null_pointer_exception_gp_set
+ENTRY_NO_GP art_quick_unlock_object
+ beq $a0, $zero, art_quick_throw_null_pointer_exception
nop
+ .cpsetup $t9, $t8, art_quick_unlock_object
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case exception allocation triggers GC
jal artUnlockObjectFromCode # (Object* obj, Thread*)
move $a1, rSELF # pass Thread::Current
RETURN_IF_ZERO
END art_quick_unlock_object
-ENTRY art_quick_unlock_object_no_inline
- beq $a0, $zero, .Lart_quick_throw_null_pointer_exception_gp_set
+ENTRY_NO_GP art_quick_unlock_object_no_inline
+ beq $a0, $zero, art_quick_throw_null_pointer_exception
nop
+ .cpsetup $t9, $t8, art_quick_unlock_object_no_inline
SETUP_SAVE_REFS_ONLY_FRAME # save callee saves in case exception allocation triggers GC
jal artUnlockObjectFromCode # (Object* obj, Thread*)
move $a1, rSELF # pass Thread::Current
@@ -1362,7 +1367,7 @@
ENTRY art_quick_aput_obj_with_null_and_bound_check
bne $a0, $zero, .Lart_quick_aput_obj_with_bound_check_gp_set
nop
- b .Lart_quick_throw_null_pointer_exception_gp_set
+ b art_quick_throw_null_pointer_exception
nop
END art_quick_aput_obj_with_null_and_bound_check
@@ -1372,7 +1377,7 @@
bne $t1, $zero, .Lart_quick_aput_obj_gp_set
nop
move $a0, $a1
- b .Lart_quick_throw_array_bounds_gp_set
+ b art_quick_throw_array_bounds
move $a1, $t0
END art_quick_aput_obj_with_bound_check
diff --git a/runtime/arch/x86/quick_entrypoints_x86.S b/runtime/arch/x86/quick_entrypoints_x86.S
index f3793e1..879d496 100644
--- a/runtime/arch/x86/quick_entrypoints_x86.S
+++ b/runtime/arch/x86/quick_entrypoints_x86.S
@@ -327,6 +327,19 @@
END_FUNCTION VAR(c_name)
END_MACRO
+MACRO2(NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING, c_name, cxx_name)
+ DEFINE_FUNCTION VAR(c_name)
+ SETUP_SAVE_EVERYTHING_FRAME ebx, ebx // save all registers as basis for long jump context
+ // Outgoing argument set up
+ subl MACRO_LITERAL(12), %esp // alignment padding
+ CFI_ADJUST_CFA_OFFSET(12)
+ pushl %fs:THREAD_SELF_OFFSET // pass Thread::Current()
+ CFI_ADJUST_CFA_OFFSET(4)
+ call CALLVAR(cxx_name) // cxx_name(Thread*)
+ UNREACHABLE
+ END_FUNCTION VAR(c_name)
+END_MACRO
+
MACRO2(ONE_ARG_RUNTIME_EXCEPTION, c_name, cxx_name)
DEFINE_FUNCTION VAR(c_name)
SETUP_SAVE_ALL_CALLEE_SAVES_FRAME ebx, ebx // save all registers as basis for long jump context
@@ -341,9 +354,9 @@
END_FUNCTION VAR(c_name)
END_MACRO
-MACRO2(TWO_ARG_RUNTIME_EXCEPTION, c_name, cxx_name)
+MACRO2(TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING, c_name, cxx_name)
DEFINE_FUNCTION VAR(c_name)
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME ebx, ebx // save all registers as basis for long jump context
+ SETUP_SAVE_EVERYTHING_FRAME ebx, ebx // save all registers as basis for long jump context
// Outgoing argument set up
PUSH eax // alignment padding
pushl %fs:THREAD_SELF_OFFSET // pass Thread::Current()
@@ -358,7 +371,7 @@
/*
* Called by managed code to create and deliver a NullPointerException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
/*
* Call installed by a signal handler to create and deliver a NullPointerException.
@@ -384,7 +397,7 @@
/*
* Called by managed code to create and deliver an ArithmeticException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_div_zero, artThrowDivZeroFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_div_zero, artThrowDivZeroFromCode
/*
* Called by managed code to create and deliver a StackOverflowError.
@@ -401,13 +414,13 @@
* Called by managed code to create and deliver an ArrayIndexOutOfBoundsException. Arg1 holds
* index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
/*
* Called by managed code to create and deliver a StringIndexOutOfBoundsException
* as if thrown from a call to String.charAt(). Arg1 holds index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_string_bounds, artThrowStringBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_string_bounds, artThrowStringBoundsFromCode
/*
* All generated callsites for interface invokes and invocation slow paths will load arguments
diff --git a/runtime/arch/x86_64/quick_entrypoints_x86_64.S b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
index bfba543..a11e402 100644
--- a/runtime/arch/x86_64/quick_entrypoints_x86_64.S
+++ b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
@@ -395,6 +395,16 @@
END_FUNCTION VAR(c_name)
END_MACRO
+MACRO2(NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING, c_name, cxx_name)
+ DEFINE_FUNCTION VAR(c_name)
+ SETUP_SAVE_EVERYTHING_FRAME // save all registers as basis for long jump context
+ // Outgoing argument set up
+ movq %gs:THREAD_SELF_OFFSET, %rdi // pass Thread::Current()
+ call CALLVAR(cxx_name) // cxx_name(Thread*)
+ UNREACHABLE
+ END_FUNCTION VAR(c_name)
+END_MACRO
+
MACRO2(ONE_ARG_RUNTIME_EXCEPTION, c_name, cxx_name)
DEFINE_FUNCTION VAR(c_name)
SETUP_SAVE_ALL_CALLEE_SAVES_FRAME // save all registers as basis for long jump context
@@ -405,9 +415,9 @@
END_FUNCTION VAR(c_name)
END_MACRO
-MACRO2(TWO_ARG_RUNTIME_EXCEPTION, c_name, cxx_name)
+MACRO2(TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING, c_name, cxx_name)
DEFINE_FUNCTION VAR(c_name)
- SETUP_SAVE_ALL_CALLEE_SAVES_FRAME // save all registers as basis for long jump context
+ SETUP_SAVE_EVERYTHING_FRAME // save all registers as basis for long jump context
// Outgoing argument set up
movq %gs:THREAD_SELF_OFFSET, %rdx // pass Thread::Current()
call CALLVAR(cxx_name) // cxx_name(Thread*)
@@ -418,7 +428,7 @@
/*
* Called by managed code to create and deliver a NullPointerException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_null_pointer_exception, artThrowNullPointerExceptionFromCode
/*
* Call installed by a signal handler to create and deliver a NullPointerException.
@@ -440,7 +450,7 @@
/*
* Called by managed code to create and deliver an ArithmeticException.
*/
-NO_ARG_RUNTIME_EXCEPTION art_quick_throw_div_zero, artThrowDivZeroFromCode
+NO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_div_zero, artThrowDivZeroFromCode
/*
* Called by managed code to create and deliver a StackOverflowError.
@@ -457,13 +467,13 @@
* Called by managed code to create and deliver an ArrayIndexOutOfBoundsException. Arg1 holds
* index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_array_bounds, artThrowArrayBoundsFromCode
/*
* Called by managed code to create and deliver a StringIndexOutOfBoundsException
* as if thrown from a call to String.charAt(). Arg1 holds index, arg2 holds limit.
*/
-TWO_ARG_RUNTIME_EXCEPTION art_quick_throw_string_bounds, artThrowStringBoundsFromCode
+TWO_ARG_RUNTIME_EXCEPTION_SAVE_EVERYTHING art_quick_throw_string_bounds, artThrowStringBoundsFromCode
/*
* All generated callsites for interface invokes and invocation slow paths will load arguments
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index fd6c37a..193bea1 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -34,8 +34,8 @@
#include "jit/jit_code_cache.h"
#include "jit/profiling_info.h"
#include "jni_internal.h"
-#include "mirror/abstract_method.h"
#include "mirror/class-inl.h"
+#include "mirror/executable.h"
#include "mirror/object_array-inl.h"
#include "mirror/object-inl.h"
#include "mirror/string.h"
@@ -52,9 +52,9 @@
ArtMethod* ArtMethod::FromReflectedMethod(const ScopedObjectAccessAlreadyRunnable& soa,
jobject jlr_method) {
- auto* abstract_method = soa.Decode<mirror::AbstractMethod*>(jlr_method);
- DCHECK(abstract_method != nullptr);
- return abstract_method->GetArtMethod();
+ auto* executable = soa.Decode<mirror::Executable*>(jlr_method);
+ DCHECK(executable != nullptr);
+ return executable->GetArtMethod();
}
mirror::String* ArtMethod::GetNameAsString(Thread* self) {
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 6d93736..845e39a 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -2242,7 +2242,7 @@
ClassPathEntry FindInClassPath(const char* descriptor,
size_t hash, const std::vector<const DexFile*>& class_path) {
for (const DexFile* dex_file : class_path) {
- const DexFile::ClassDef* dex_class_def = dex_file->FindClassDef(descriptor, hash);
+ const DexFile::ClassDef* dex_class_def = OatDexFile::FindClassDef(*dex_file, descriptor, hash);
if (dex_class_def != nullptr) {
return ClassPathEntry(dex_file, dex_class_def);
}
@@ -2343,7 +2343,8 @@
for (int32_t j = kDexFileIndexStart; j < long_array_size; ++j) {
const DexFile* cp_dex_file = reinterpret_cast<const DexFile*>(static_cast<uintptr_t>(
long_array->GetWithoutChecks(j)));
- const DexFile::ClassDef* dex_class_def = cp_dex_file->FindClassDef(descriptor, hash);
+ const DexFile::ClassDef* dex_class_def =
+ OatDexFile::FindClassDef(*cp_dex_file, descriptor, hash);
if (dex_class_def != nullptr) {
mirror::Class* klass = DefineClass(self,
descriptor,
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 5e0ee6f..7023081 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -28,7 +28,6 @@
#include "experimental_flags.h"
#include "entrypoints/entrypoint_utils-inl.h"
#include "gc/heap.h"
-#include "mirror/abstract_method.h"
#include "mirror/accessible_object.h"
#include "mirror/class-inl.h"
#include "mirror/dex_cache.h"
@@ -697,24 +696,18 @@
struct ExecutableOffsets : public CheckOffsets<mirror::Executable> {
ExecutableOffsets() : CheckOffsets<mirror::Executable>(
false, "Ljava/lang/reflect/Executable;") {
+ addOffset(OFFSETOF_MEMBER(mirror::Executable, access_flags_), "accessFlags");
+ addOffset(OFFSETOF_MEMBER(mirror::Executable, art_method_), "artMethod");
+ addOffset(OFFSETOF_MEMBER(mirror::Executable, declaring_class_), "declaringClass");
+ addOffset(OFFSETOF_MEMBER(mirror::Executable, declaring_class_of_overridden_method_),
+ "declaringClassOfOverriddenMethod");
+ addOffset(OFFSETOF_MEMBER(mirror::Executable, dex_method_index_), "dexMethodIndex");
addOffset(OFFSETOF_MEMBER(mirror::Executable, has_real_parameter_data_),
"hasRealParameterData");
addOffset(OFFSETOF_MEMBER(mirror::Executable, parameters_), "parameters");
};
};
-struct AbstractMethodOffsets : public CheckOffsets<mirror::AbstractMethod> {
- AbstractMethodOffsets() : CheckOffsets<mirror::AbstractMethod>(
- false, "Ljava/lang/reflect/AbstractMethod;") {
- addOffset(OFFSETOF_MEMBER(mirror::AbstractMethod, access_flags_), "accessFlags");
- addOffset(OFFSETOF_MEMBER(mirror::AbstractMethod, art_method_), "artMethod");
- addOffset(OFFSETOF_MEMBER(mirror::AbstractMethod, declaring_class_), "declaringClass");
- addOffset(OFFSETOF_MEMBER(mirror::AbstractMethod, declaring_class_of_overridden_method_),
- "declaringClassOfOverriddenMethod");
- addOffset(OFFSETOF_MEMBER(mirror::AbstractMethod, dex_method_index_), "dexMethodIndex");
- };
-};
-
// C++ fields must exactly match the fields in the Java classes. If this fails,
// reorder the fields in the C++ class. Managed class fields are ordered by
// ClassLinker::LinkFields.
@@ -733,7 +726,6 @@
EXPECT_TRUE(AccessibleObjectOffsets().Check());
EXPECT_TRUE(FieldOffsets().Check());
EXPECT_TRUE(ExecutableOffsets().Check());
- EXPECT_TRUE(AbstractMethodOffsets().Check());
}
TEST_F(ClassLinkerTest, FindClassNonexistent) {
@@ -1269,7 +1261,6 @@
old_dex_file->Size(),
location->ToModifiedUtf8(),
0u,
- nullptr,
nullptr));
{
WriterMutexLock mu(soa.Self(), *class_linker->DexLock());
diff --git a/runtime/common_runtime_test.cc b/runtime/common_runtime_test.cc
index 7234952..8a48604 100644
--- a/runtime/common_runtime_test.cc
+++ b/runtime/common_runtime_test.cc
@@ -76,9 +76,10 @@
file_.reset(new File(fd, GetFilename(), true));
}
-ScratchFile::ScratchFile(const ScratchFile& other, const char* suffix) {
- filename_ = other.GetFilename();
- filename_ += suffix;
+ScratchFile::ScratchFile(const ScratchFile& other, const char* suffix)
+ : ScratchFile(other.GetFilename() + suffix) {}
+
+ScratchFile::ScratchFile(const std::string& filename) : filename_(filename) {
int fd = open(filename_.c_str(), O_RDWR | O_CREAT, 0666);
CHECK_NE(-1, fd);
file_.reset(new File(fd, GetFilename(), true));
@@ -90,6 +91,18 @@
file_.reset(file);
}
+ScratchFile::ScratchFile(ScratchFile&& other) {
+ *this = std::move(other);
+}
+
+ScratchFile& ScratchFile::operator=(ScratchFile&& other) {
+ if (GetFile() != other.GetFile()) {
+ std::swap(filename_, other.filename_);
+ std::swap(file_, other.file_);
+ }
+ return *this;
+}
+
ScratchFile::~ScratchFile() {
Unlink();
}
diff --git a/runtime/common_runtime_test.h b/runtime/common_runtime_test.h
index b2090b7..2376e6a 100644
--- a/runtime/common_runtime_test.h
+++ b/runtime/common_runtime_test.h
@@ -40,8 +40,14 @@
public:
ScratchFile();
+ explicit ScratchFile(const std::string& filename);
+
ScratchFile(const ScratchFile& other, const char* suffix);
+ explicit ScratchFile(ScratchFile&& other);
+
+ ScratchFile& operator=(ScratchFile&& other);
+
explicit ScratchFile(File* file);
~ScratchFile();
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index b49c01c..6ed44fc 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -1761,22 +1761,32 @@
return error;
}
- mirror::Object* o = Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error);
- if ((!is_static && o == nullptr) || error != JDWP::ERR_NONE) {
+ Thread* self = Thread::Current();
+ StackHandleScope<2> hs(self);
+ MutableHandle<mirror::Object>
+ o(hs.NewHandle(Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error)));
+ if ((!is_static && o.Get() == nullptr) || error != JDWP::ERR_NONE) {
return JDWP::ERR_INVALID_OBJECT;
}
ArtField* f = FromFieldId(field_id);
mirror::Class* receiver_class = c;
- if (receiver_class == nullptr && o != nullptr) {
+ if (receiver_class == nullptr && o.Get() != nullptr) {
receiver_class = o->GetClass();
}
+
// TODO: should we give up now if receiver_class is null?
if (receiver_class != nullptr && !f->GetDeclaringClass()->IsAssignableFrom(receiver_class)) {
LOG(INFO) << "ERR_INVALID_FIELDID: " << PrettyField(f) << " " << PrettyClass(receiver_class);
return JDWP::ERR_INVALID_FIELDID;
}
+ // Ensure the field's class is initialized.
+ Handle<mirror::Class> klass(hs.NewHandle(f->GetDeclaringClass()));
+ if (!Runtime::Current()->GetClassLinker()->EnsureInitialized(self, klass, true, false)) {
+ LOG(WARNING) << "Not able to initialize class for SetValues: " << PrettyClass(klass.Get());
+ }
+
// The RI only enforces the static/non-static mismatch in one direction.
// TODO: should we change the tests and check both?
if (is_static) {
@@ -1790,10 +1800,10 @@
}
}
if (f->IsStatic()) {
- o = f->GetDeclaringClass();
+ o.Assign(f->GetDeclaringClass());
}
- JValue field_value(GetArtFieldValue(f, o));
+ JValue field_value(GetArtFieldValue(f, o.Get()));
JDWP::JdwpTag tag = BasicTagFromDescriptor(f->GetTypeDescriptor());
Dbg::OutputJValue(tag, &field_value, pReply);
return JDWP::ERR_NONE;
@@ -1883,12 +1893,21 @@
uint64_t value, int width, bool is_static)
REQUIRES_SHARED(Locks::mutator_lock_) {
JDWP::JdwpError error;
- mirror::Object* o = Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error);
- if ((!is_static && o == nullptr) || error != JDWP::ERR_NONE) {
+ Thread* self = Thread::Current();
+ StackHandleScope<2> hs(self);
+ MutableHandle<mirror::Object>
+ o(hs.NewHandle(Dbg::GetObjectRegistry()->Get<mirror::Object*>(object_id, &error)));
+ if ((!is_static && o.Get() == nullptr) || error != JDWP::ERR_NONE) {
return JDWP::ERR_INVALID_OBJECT;
}
ArtField* f = FromFieldId(field_id);
+ // Ensure the field's class is initialized.
+ Handle<mirror::Class> klass(hs.NewHandle(f->GetDeclaringClass()));
+ if (!Runtime::Current()->GetClassLinker()->EnsureInitialized(self, klass, true, false)) {
+ LOG(WARNING) << "Not able to initialize class for SetValues: " << PrettyClass(klass.Get());
+ }
+
// The RI only enforces the static/non-static mismatch in one direction.
// TODO: should we change the tests and check both?
if (is_static) {
@@ -1902,9 +1921,9 @@
}
}
if (f->IsStatic()) {
- o = f->GetDeclaringClass();
+ o.Assign(f->GetDeclaringClass());
}
- return SetArtFieldValue(f, o, value, width);
+ return SetArtFieldValue(f, o.Get(), value, width);
}
JDWP::JdwpError Dbg::SetFieldValue(JDWP::ObjectId object_id, JDWP::FieldId field_id, uint64_t value,
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index ccc4c16..409fbba 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -32,14 +32,15 @@
#include "base/hash_map.h"
#include "base/logging.h"
#include "base/stl_util.h"
+#include "base/stringprintf.h"
#include "base/systrace.h"
#include "base/unix_file/fd_file.h"
-#include "class_linker-inl.h"
#include "dex_file-inl.h"
#include "dex_file_verifier.h"
#include "globals.h"
#include "jvalue.h"
#include "leb128.h"
+#include "oat_file.h"
#include "os.h"
#include "safe_map.h"
#include "thread.h"
@@ -51,6 +52,10 @@
namespace art {
+static constexpr OatDexFile* kNoOatDexFile = nullptr;
+
+const char* DexFile::kClassesDex = "classes.dex";
+
const uint8_t DexFile::kDexMagic[] = { 'd', 'e', 'x', '\n' };
const uint8_t DexFile::kDexMagicVersions[DexFile::kNumDexVersions][DexFile::kDexVersionLen] = {
{'0', '3', '5', '\0'},
@@ -117,64 +122,6 @@
return false;
}
-bool DexFile::Open(const char* filename,
- const char* location,
- bool verify_checksum,
- std::string* error_msg,
- std::vector<std::unique_ptr<const DexFile>>* dex_files) {
- ScopedTrace trace(std::string("Open dex file ") + location);
- DCHECK(dex_files != nullptr) << "DexFile::Open: out-param is nullptr";
- uint32_t magic;
- File fd = OpenAndReadMagic(filename, &magic, error_msg);
- if (fd.Fd() == -1) {
- DCHECK(!error_msg->empty());
- return false;
- }
- if (IsZipMagic(magic)) {
- return DexFile::OpenZip(fd.Release(), location, verify_checksum, error_msg, dex_files);
- }
- if (IsDexMagic(magic)) {
- std::unique_ptr<const DexFile> dex_file(DexFile::OpenFile(fd.Release(),
- location,
- /* verify */ true,
- verify_checksum,
- error_msg));
- if (dex_file.get() != nullptr) {
- dex_files->push_back(std::move(dex_file));
- return true;
- } else {
- return false;
- }
- }
- *error_msg = StringPrintf("Expected valid zip or dex file: '%s'", filename);
- return false;
-}
-
-static bool ContainsClassesDex(int fd, const char* filename) {
- std::string error_msg;
- std::unique_ptr<ZipArchive> zip_archive(ZipArchive::OpenFromFd(fd, filename, &error_msg));
- if (zip_archive.get() == nullptr) {
- return false;
- }
- std::unique_ptr<ZipEntry> zip_entry(zip_archive->Find(DexFile::kClassesDex, &error_msg));
- return (zip_entry.get() != nullptr);
-}
-
-bool DexFile::MaybeDex(const char* filename) {
- uint32_t magic;
- std::string error_msg;
- File fd = OpenAndReadMagic(filename, &magic, &error_msg);
- if (fd.Fd() == -1) {
- return false;
- }
- if (IsZipMagic(magic)) {
- return ContainsClassesDex(fd.Release(), filename);
- } else if (IsDexMagic(magic)) {
- return true;
- }
- return false;
-}
-
int DexFile::GetPermissions() const {
if (mem_map_.get() == nullptr) {
return 0;
@@ -205,7 +152,9 @@
}
}
-std::unique_ptr<const DexFile> DexFile::Open(const uint8_t* base, size_t size,
+
+std::unique_ptr<const DexFile> DexFile::Open(const uint8_t* base,
+ size_t size,
const std::string& location,
uint32_t location_checksum,
const OatDexFile* oat_dex_file,
@@ -213,118 +162,78 @@
bool verify_checksum,
std::string* error_msg) {
ScopedTrace trace(std::string("Open dex file from RAM ") + location);
- std::unique_ptr<const DexFile> dex_file = OpenMemory(base,
- size,
- location,
- location_checksum,
- nullptr,
- oat_dex_file,
- error_msg);
- if (dex_file == nullptr) {
- return nullptr;
- }
-
- if (verify && !DexFileVerifier::Verify(dex_file.get(),
- dex_file->Begin(),
- dex_file->Size(),
- location.c_str(),
- verify_checksum,
- error_msg)) {
- return nullptr;
- }
- return dex_file;
+ return OpenCommon(base,
+ size,
+ location,
+ location_checksum,
+ oat_dex_file,
+ verify,
+ verify_checksum,
+ error_msg);
}
std::unique_ptr<const DexFile> DexFile::Open(const std::string& location,
uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
+ std::unique_ptr<MemMap> map,
bool verify,
bool verify_checksum,
std::string* error_msg) {
ScopedTrace trace(std::string("Open dex file from mapped-memory ") + location);
- std::unique_ptr<const DexFile> dex_file = OpenMemory(location,
- location_checksum,
- std::move(mem_map),
- error_msg);
- if (dex_file == nullptr) {
- return nullptr;
- }
-
- if (verify && !DexFileVerifier::Verify(dex_file.get(),
- dex_file->Begin(),
- dex_file->Size(),
- location.c_str(),
- verify_checksum,
- error_msg)) {
- return nullptr;
+ CHECK(map.get() != nullptr);
+ std::unique_ptr<DexFile> dex_file = OpenCommon(map->Begin(),
+ map->Size(),
+ location,
+ location_checksum,
+ kNoOatDexFile,
+ verify,
+ verify_checksum,
+ error_msg);
+ if (dex_file != nullptr) {
+ dex_file->mem_map_.reset(map.release());
}
return dex_file;
}
-std::unique_ptr<const DexFile> DexFile::OpenFile(int fd,
- const char* location,
- bool verify,
- bool verify_checksum,
- std::string* error_msg) {
- ScopedTrace trace(std::string("Open dex file ") + location);
- CHECK(location != nullptr);
- std::unique_ptr<MemMap> map;
- {
- File delayed_close(fd, /* check_usage */ false);
- struct stat sbuf;
- memset(&sbuf, 0, sizeof(sbuf));
- if (fstat(fd, &sbuf) == -1) {
- *error_msg = StringPrintf("DexFile: fstat '%s' failed: %s", location, strerror(errno));
- return nullptr;
- }
- if (S_ISDIR(sbuf.st_mode)) {
- *error_msg = StringPrintf("Attempt to mmap directory '%s'", location);
- return nullptr;
- }
- size_t length = sbuf.st_size;
- map.reset(MemMap::MapFile(length,
- PROT_READ,
- MAP_PRIVATE,
- fd,
- 0,
- /*low_4gb*/false,
- location,
- error_msg));
- if (map == nullptr) {
- DCHECK(!error_msg->empty());
- return nullptr;
+bool DexFile::Open(const char* filename,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ std::vector<std::unique_ptr<const DexFile>>* dex_files) {
+ ScopedTrace trace(std::string("Open dex file ") + std::string(location));
+ DCHECK(dex_files != nullptr) << "DexFile::Open: out-param is nullptr";
+ uint32_t magic;
+ File fd = OpenAndReadMagic(filename, &magic, error_msg);
+ if (fd.Fd() == -1) {
+ DCHECK(!error_msg->empty());
+ return false;
+ }
+ if (IsZipMagic(magic)) {
+ return DexFile::OpenZip(fd.Release(), location, verify_checksum, error_msg, dex_files);
+ }
+ if (IsDexMagic(magic)) {
+ std::unique_ptr<const DexFile> dex_file(DexFile::OpenFile(fd.Release(),
+ location,
+ /* verify */ true,
+ verify_checksum,
+ error_msg));
+ if (dex_file.get() != nullptr) {
+ dex_files->push_back(std::move(dex_file));
+ return true;
+ } else {
+ return false;
}
}
-
- if (map->Size() < sizeof(DexFile::Header)) {
- *error_msg = StringPrintf(
- "DexFile: failed to open dex file '%s' that is too short to have a header", location);
- return nullptr;
- }
-
- const Header* dex_header = reinterpret_cast<const Header*>(map->Begin());
-
- std::unique_ptr<const DexFile> dex_file(OpenMemory(location,
- dex_header->checksum_,
- std::move(map),
- error_msg));
- if (dex_file.get() == nullptr) {
- *error_msg = StringPrintf("Failed to open dex file '%s' from memory: %s", location,
- error_msg->c_str());
- return nullptr;
- }
-
- if (verify && !DexFileVerifier::Verify(dex_file.get(), dex_file->Begin(), dex_file->Size(),
- location,
- verify_checksum,
- error_msg)) {
- return nullptr;
- }
-
- return dex_file;
+ *error_msg = StringPrintf("Expected valid zip or dex file: '%s'", filename);
+ return false;
}
-const char* DexFile::kClassesDex = "classes.dex";
+std::unique_ptr<const DexFile> DexFile::OpenDex(int fd,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg) {
+ ScopedTrace trace("Open dex file " + std::string(location));
+ return OpenFile(fd, location, true /* verify */, verify_checksum, error_msg);
+}
bool DexFile::OpenZip(int fd,
const std::string& location,
@@ -338,28 +247,79 @@
DCHECK(!error_msg->empty());
return false;
}
- return DexFile::OpenFromZip(*zip_archive, location, verify_checksum, error_msg, dex_files);
+ return DexFile::OpenAllDexFilesFromZip(*zip_archive,
+ location,
+ verify_checksum,
+ error_msg,
+ dex_files);
}
-std::unique_ptr<const DexFile> DexFile::OpenMemory(const std::string& location,
- uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
- std::string* error_msg) {
- return OpenMemory(mem_map->Begin(),
- mem_map->Size(),
- location,
- location_checksum,
- std::move(mem_map),
- nullptr,
- error_msg);
+std::unique_ptr<const DexFile> DexFile::OpenFile(int fd,
+ const std::string& location,
+ bool verify,
+ bool verify_checksum,
+ std::string* error_msg) {
+ ScopedTrace trace(std::string("Open dex file ") + std::string(location));
+ CHECK(!location.empty());
+ std::unique_ptr<MemMap> map;
+ {
+ File delayed_close(fd, /* check_usage */ false);
+ struct stat sbuf;
+ memset(&sbuf, 0, sizeof(sbuf));
+ if (fstat(fd, &sbuf) == -1) {
+ *error_msg = StringPrintf("DexFile: fstat '%s' failed: %s", location.c_str(),
+ strerror(errno));
+ return nullptr;
+ }
+ if (S_ISDIR(sbuf.st_mode)) {
+ *error_msg = StringPrintf("Attempt to mmap directory '%s'", location.c_str());
+ return nullptr;
+ }
+ size_t length = sbuf.st_size;
+ map.reset(MemMap::MapFile(length,
+ PROT_READ,
+ MAP_PRIVATE,
+ fd,
+ 0,
+ /*low_4gb*/false,
+ location.c_str(),
+ error_msg));
+ if (map == nullptr) {
+ DCHECK(!error_msg->empty());
+ return nullptr;
+ }
+ }
+
+ if (map->Size() < sizeof(DexFile::Header)) {
+ *error_msg = StringPrintf(
+ "DexFile: failed to open dex file '%s' that is too short to have a header",
+ location.c_str());
+ return nullptr;
+ }
+
+ const Header* dex_header = reinterpret_cast<const Header*>(map->Begin());
+
+ std::unique_ptr<DexFile> dex_file = OpenCommon(map->Begin(),
+ map->Size(),
+ location,
+ dex_header->checksum_,
+ kNoOatDexFile,
+ verify,
+ verify_checksum,
+ error_msg);
+ if (dex_file != nullptr) {
+ dex_file->mem_map_.reset(map.release());
+ }
+
+ return dex_file;
}
-std::unique_ptr<const DexFile> DexFile::Open(const ZipArchive& zip_archive,
- const char* entry_name,
- const std::string& location,
- bool verify_checksum,
- std::string* error_msg,
- ZipOpenErrorCode* error_code) {
+std::unique_ptr<const DexFile> DexFile::OpenOneDexFileFromZip(const ZipArchive& zip_archive,
+ const char* entry_name,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ ZipOpenErrorCode* error_code) {
ScopedTrace trace("Dex file open from Zip Archive " + std::string(location));
CHECK(!location.empty());
std::unique_ptr<ZipEntry> zip_entry(zip_archive.Find(entry_name, error_msg));
@@ -379,15 +339,18 @@
*error_code = ZipOpenErrorCode::kExtractToMemoryError;
return nullptr;
}
- std::unique_ptr<const DexFile> dex_file(OpenMemory(location,
- zip_entry->GetCrc32(),
- std::move(map),
- error_msg));
- if (dex_file == nullptr) {
- *error_msg = StringPrintf("Failed to open dex file '%s' from memory: %s", location.c_str(),
- error_msg->c_str());
- *error_code = ZipOpenErrorCode::kDexFileError;
- return nullptr;
+ VerifyResult verify_result;
+ std::unique_ptr<DexFile> dex_file = OpenCommon(map->Begin(),
+ map->Size(),
+ location,
+ zip_entry->GetCrc32(),
+ kNoOatDexFile,
+ /* verify */ true,
+ verify_checksum,
+ error_msg,
+ &verify_result);
+ if (dex_file != nullptr) {
+ dex_file->mem_map_.reset(map.release());
}
if (!dex_file->DisableWrite()) {
*error_msg = StringPrintf("Failed to make dex file '%s' read only", location.c_str());
@@ -395,10 +358,7 @@
return nullptr;
}
CHECK(dex_file->IsReadOnly()) << location;
- if (!DexFileVerifier::Verify(dex_file.get(), dex_file->Begin(), dex_file->Size(),
- location.c_str(),
- verify_checksum,
- error_msg)) {
+ if (verify_result != VerifyResult::kVerifySucceeded) {
*error_code = ZipOpenErrorCode::kVerifyError;
return nullptr;
}
@@ -412,16 +372,20 @@
// seems an excessive number.
static constexpr size_t kWarnOnManyDexFilesThreshold = 100;
-bool DexFile::OpenFromZip(const ZipArchive& zip_archive,
- const std::string& location,
- bool verify_checksum,
- std::string* error_msg,
- std::vector<std::unique_ptr<const DexFile>>* dex_files) {
+bool DexFile::OpenAllDexFilesFromZip(const ZipArchive& zip_archive,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ std::vector<std::unique_ptr<const DexFile>>* dex_files) {
ScopedTrace trace("Dex file open from Zip " + std::string(location));
DCHECK(dex_files != nullptr) << "DexFile::OpenFromZip: out-param is nullptr";
ZipOpenErrorCode error_code;
- std::unique_ptr<const DexFile> dex_file(
- Open(zip_archive, kClassesDex, location, verify_checksum, error_msg, &error_code));
+ std::unique_ptr<const DexFile> dex_file(OpenOneDexFileFromZip(zip_archive,
+ kClassesDex,
+ location,
+ verify_checksum,
+ error_msg,
+ &error_code));
if (dex_file.get() == nullptr) {
return false;
} else {
@@ -436,8 +400,12 @@
for (size_t i = 1; ; ++i) {
std::string name = GetMultiDexClassesDexName(i);
std::string fake_location = GetMultiDexLocation(i, location.c_str());
- std::unique_ptr<const DexFile> next_dex_file(
- Open(zip_archive, name.c_str(), fake_location, verify_checksum, error_msg, &error_code));
+ std::unique_ptr<const DexFile> next_dex_file(OpenOneDexFileFromZip(zip_archive,
+ name.c_str(),
+ fake_location,
+ verify_checksum,
+ error_msg,
+ &error_code));
if (next_dex_file.get() == nullptr) {
if (error_code != ZipOpenErrorCode::kEntryNotFound) {
LOG(WARNING) << error_msg;
@@ -463,35 +431,55 @@
}
}
-
-std::unique_ptr<const DexFile> DexFile::OpenMemory(const uint8_t* base,
- size_t size,
- const std::string& location,
- uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
- const OatDexFile* oat_dex_file,
- std::string* error_msg) {
- DCHECK(base != nullptr);
- DCHECK_NE(size, 0U);
- CHECK_ALIGNED(base, 4); // various dex file structures must be word aligned
- std::unique_ptr<DexFile> dex_file(
- new DexFile(base, size, location, location_checksum, std::move(mem_map), oat_dex_file));
+std::unique_ptr<DexFile> DexFile::OpenCommon(const uint8_t* base,
+ size_t size,
+ const std::string& location,
+ uint32_t location_checksum,
+ const OatDexFile* oat_dex_file,
+ bool verify,
+ bool verify_checksum,
+ std::string* error_msg,
+ VerifyResult* verify_result) {
+ std::unique_ptr<DexFile> dex_file(new DexFile(base,
+ size,
+ location,
+ location_checksum,
+ oat_dex_file));
+ if (dex_file == nullptr) {
+ *error_msg = StringPrintf("Failed to open dex file '%s' from memory: %s", location.c_str(),
+ error_msg->c_str());
+ return nullptr;
+ }
if (!dex_file->Init(error_msg)) {
dex_file.reset();
+ return nullptr;
}
- return std::unique_ptr<const DexFile>(dex_file.release());
+ if (verify && !DexFileVerifier::Verify(dex_file.get(),
+ dex_file->Begin(),
+ dex_file->Size(),
+ location.c_str(),
+ verify_checksum,
+ error_msg)) {
+ if (verify_result != nullptr) {
+ *verify_result = VerifyResult::kVerifyFailed;
+ }
+ return nullptr;
+ }
+ if (verify_result != nullptr) {
+ *verify_result = VerifyResult::kVerifySucceeded;
+ }
+ return dex_file;
}
-DexFile::DexFile(const uint8_t* base, size_t size,
+DexFile::DexFile(const uint8_t* base,
+ size_t size,
const std::string& location,
uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
const OatDexFile* oat_dex_file)
: begin_(base),
size_(size),
location_(location),
location_checksum_(location_checksum),
- mem_map_(std::move(mem_map)),
header_(reinterpret_cast<const Header*>(base)),
string_ids_(reinterpret_cast<const StringId*>(base + header_->string_ids_off_)),
type_ids_(reinterpret_cast<const TypeId*>(base + header_->type_ids_off_)),
@@ -502,16 +490,6 @@
oat_dex_file_(oat_dex_file) {
CHECK(begin_ != nullptr) << GetLocation();
CHECK_GT(size_, 0U) << GetLocation();
- const uint8_t* lookup_data = (oat_dex_file != nullptr)
- ? oat_dex_file->GetLookupTableData()
- : nullptr;
- if (lookup_data != nullptr) {
- if (lookup_data + TypeLookupTable::RawDataLength(*this) > oat_dex_file->GetOatFile()->End()) {
- LOG(WARNING) << "found truncated lookup table in " << GetLocation();
- } else {
- lookup_table_.reset(TypeLookupTable::Open(lookup_data, *this));
- }
- }
}
DexFile::~DexFile() {
@@ -571,33 +549,12 @@
return atoi(version);
}
-const DexFile::ClassDef* DexFile::FindClassDef(const char* descriptor, size_t hash) const {
- DCHECK_EQ(ComputeModifiedUtf8Hash(descriptor), hash);
- if (LIKELY(lookup_table_ != nullptr)) {
- const uint32_t class_def_idx = lookup_table_->Lookup(descriptor, hash);
- return (class_def_idx != DexFile::kDexNoIndex) ? &GetClassDef(class_def_idx) : nullptr;
- }
-
+const DexFile::ClassDef* DexFile::FindClassDef(uint16_t type_idx) const {
+ size_t num_class_defs = NumClassDefs();
// Fast path for rare no class defs case.
- const uint32_t num_class_defs = NumClassDefs();
if (num_class_defs == 0) {
return nullptr;
}
- const TypeId* type_id = FindTypeId(descriptor);
- if (type_id != nullptr) {
- uint16_t type_idx = GetIndexForTypeId(*type_id);
- for (size_t i = 0; i < num_class_defs; ++i) {
- const ClassDef& class_def = GetClassDef(i);
- if (class_def.class_idx_ == type_idx) {
- return &class_def;
- }
- }
- }
- return nullptr;
-}
-
-const DexFile::ClassDef* DexFile::FindClassDef(uint16_t type_idx) const {
- size_t num_class_defs = NumClassDefs();
for (size_t i = 0; i < num_class_defs; ++i) {
const ClassDef& class_def = GetClassDef(i);
if (class_def.class_idx_ == type_idx) {
@@ -607,6 +564,34 @@
return nullptr;
}
+uint32_t DexFile::FindCodeItemOffset(const DexFile::ClassDef& class_def,
+ uint32_t method_idx) const {
+ const uint8_t* class_data = GetClassData(class_def);
+ CHECK(class_data != nullptr);
+ ClassDataItemIterator it(*this, class_data);
+ // Skip fields
+ while (it.HasNextStaticField()) {
+ it.Next();
+ }
+ while (it.HasNextInstanceField()) {
+ it.Next();
+ }
+ while (it.HasNextDirectMethod()) {
+ if (it.GetMemberIndex() == method_idx) {
+ return it.GetMethodCodeItemOffset();
+ }
+ it.Next();
+ }
+ while (it.HasNextVirtualMethod()) {
+ if (it.GetMemberIndex() == method_idx) {
+ return it.GetMethodCodeItemOffset();
+ }
+ it.Next();
+ }
+ LOG(FATAL) << "Unable to find method " << method_idx;
+ UNREACHABLE();
+}
+
const DexFile::FieldId* DexFile::FindFieldId(const DexFile::TypeId& declaring_klass,
const DexFile::StringId& name,
const DexFile::TypeId& type) const {
@@ -788,10 +773,6 @@
return nullptr;
}
-void DexFile::CreateTypeLookupTable(uint8_t* storage) const {
- lookup_table_.reset(TypeLookupTable::Create(*this, storage));
-}
-
// Given a signature place the type ids into the given vector
bool DexFile::CreateTypeList(const StringPiece& signature, uint16_t* return_type_idx,
std::vector<uint16_t>* param_type_idxs) const {
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index 0ae36f7..28aeb1e 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -397,15 +397,9 @@
// Return true if the checksum could be found, false otherwise.
static bool GetChecksum(const char* filename, uint32_t* checksum, std::string* error_msg);
- // Opens .dex files found in the container, guessing the container format based on file extension.
- static bool Open(const char* filename,
- const char* location,
- bool verify_checksum,
- std::string* error_msg,
- std::vector<std::unique_ptr<const DexFile>>* dex_files);
-
// Opens .dex file, backed by existing memory
- static std::unique_ptr<const DexFile> Open(const uint8_t* base, size_t size,
+ static std::unique_ptr<const DexFile> Open(const uint8_t* base,
+ size_t size,
const std::string& location,
uint32_t location_checksum,
const OatDexFile* oat_dex_file,
@@ -421,16 +415,25 @@
bool verify_checksum,
std::string* error_msg);
- // Checks whether the given file has the dex magic, or is a zip file with a classes.dex entry.
- // If this function returns false, Open will not succeed. The inverse is not true, however.
- static bool MaybeDex(const char* filename);
+ // Opens all .dex files found in the file, guessing the container format based on file extension.
+ static bool Open(const char* filename,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ std::vector<std::unique_ptr<const DexFile>>* dex_files);
- // Open all classesXXX.dex files from a zip archive.
- static bool OpenFromZip(const ZipArchive& zip_archive,
- const std::string& location,
- bool verify_checksum,
- std::string* error_msg,
- std::vector<std::unique_ptr<const DexFile>>* dex_files);
+ // Open a single dex file from an fd.
+ static std::unique_ptr<const DexFile> OpenDex(int fd,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg);
+
+ // Opens dex files from within a .jar, .zip, or .apk file
+ static bool OpenZip(int fd,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ std::vector<std::unique_ptr<const DexFile>>* dex_files);
// Closes a .dex file.
virtual ~DexFile();
@@ -587,6 +590,9 @@
const DexFile::StringId& name,
const DexFile::TypeId& type) const;
+ uint32_t FindCodeItemOffset(const DexFile::ClassDef& class_def,
+ uint32_t dex_method_idx) const;
+
// Returns the declaring class descriptor string of a field id.
const char* GetFieldDeclaringClassDescriptor(const FieldId& field_id) const {
const DexFile::TypeId& type_id = GetTypeId(field_id.class_idx_);
@@ -664,10 +670,6 @@
// Returns the class descriptor string of a class definition.
const char* GetClassDescriptor(const ClassDef& class_def) const;
- // Looks up a class definition by its class descriptor. Hash must be
- // ComputeModifiedUtf8Hash(descriptor).
- const ClassDef* FindClassDef(const char* descriptor, size_t hash) const;
-
// Looks up a class definition by its type index.
const ClassDef* FindClassDef(uint16_t type_idx) const;
@@ -1008,12 +1010,6 @@
return oat_dex_file_;
}
- TypeLookupTable* GetTypeLookupTable() const {
- return lookup_table_.get();
- }
-
- void CreateTypeLookupTable(uint8_t* storage = nullptr) const;
-
// Utility methods for reading integral values from a buffer.
static int32_t ReadSignedInt(const uint8_t* ptr, int zwidth);
static uint32_t ReadUnsignedInt(const uint8_t* ptr, int zwidth, bool fill_on_right);
@@ -1021,20 +1017,12 @@
static uint64_t ReadUnsignedLong(const uint8_t* ptr, int zwidth, bool fill_on_right);
private:
- // Opens a .dex file
static std::unique_ptr<const DexFile> OpenFile(int fd,
- const char* location,
+ const std::string& location,
bool verify,
bool verify_checksum,
std::string* error_msg);
- // Opens dex files from within a .jar, .zip, or .apk file
- static bool OpenZip(int fd,
- const std::string& location,
- bool verify_checksum,
- std::string* error_msg,
- std::vector<std::unique_ptr<const DexFile>>* dex_files);
-
enum class ZipOpenErrorCode { // private
kNoError,
kEntryNotFound,
@@ -1044,20 +1032,37 @@
kVerifyError
};
+ // Open all classesXXX.dex files from a zip archive.
+ static bool OpenAllDexFilesFromZip(const ZipArchive& zip_archive,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ std::vector<std::unique_ptr<const DexFile>>* dex_files);
+
// Opens .dex file from the entry_name in a zip archive. error_code is undefined when non-null
// return.
- static std::unique_ptr<const DexFile> Open(const ZipArchive& zip_archive,
- const char* entry_name,
+ static std::unique_ptr<const DexFile> OpenOneDexFileFromZip(const ZipArchive& zip_archive,
+ const char* entry_name,
+ const std::string& location,
+ bool verify_checksum,
+ std::string* error_msg,
+ ZipOpenErrorCode* error_code);
+
+ enum class VerifyResult { // private
+ kVerifySucceeded,
+ kVerifyFailed
+ };
+
+ static std::unique_ptr<DexFile> OpenCommon(const uint8_t* base,
+ size_t size,
const std::string& location,
+ uint32_t location_checksum,
+ const OatDexFile* oat_dex_file,
+ bool verify,
bool verify_checksum,
std::string* error_msg,
- ZipOpenErrorCode* error_code);
+ VerifyResult* verify_result = nullptr);
- // Opens a .dex file at the given address backed by a MemMap
- static std::unique_ptr<const DexFile> OpenMemory(const std::string& location,
- uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
- std::string* error_msg);
// Opens a .dex file at the given address, optionally backed by a MemMap
static std::unique_ptr<const DexFile> OpenMemory(const uint8_t* dex_file,
@@ -1068,10 +1073,10 @@
const OatDexFile* oat_dex_file,
std::string* error_msg);
- DexFile(const uint8_t* base, size_t size,
+ DexFile(const uint8_t* base,
+ size_t size,
const std::string& location,
uint32_t location_checksum,
- std::unique_ptr<MemMap> mem_map,
const OatDexFile* oat_dex_file);
// Top-level initializer that calls other Init methods.
@@ -1126,7 +1131,6 @@
// pointer to the OatDexFile it was loaded from. Otherwise oat_dex_file_ is
// null.
const OatDexFile* oat_dex_file_;
- mutable std::unique_ptr<TypeLookupTable> lookup_table_;
friend class DexFileVerifierTest;
ART_FRIEND_TEST(ClassLinkerTest, RegisterDexFileName); // for constructor
diff --git a/runtime/dex_file_test.cc b/runtime/dex_file_test.cc
index 6a06177..3dffc40 100644
--- a/runtime/dex_file_test.cc
+++ b/runtime/dex_file_test.cc
@@ -26,6 +26,7 @@
#include "os.h"
#include "scoped_thread_state_change.h"
#include "thread-inl.h"
+#include "utils.h"
namespace art {
@@ -37,65 +38,13 @@
ASSERT_TRUE(dex.get() != nullptr);
}
-static const uint8_t kBase64Map[256] = {
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 62, 255, 255, 255, 63,
- 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 255, 255,
- 255, 254, 255, 255, 255, 0, 1, 2, 3, 4, 5, 6,
- 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, // NOLINT
- 19, 20, 21, 22, 23, 24, 25, 255, 255, 255, 255, 255, // NOLINT
- 255, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
- 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, // NOLINT
- 49, 50, 51, 255, 255, 255, 255, 255, 255, 255, 255, 255, // NOLINT
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255
-};
-
-static inline std::vector<uint8_t> DecodeBase64(const char* src) {
- std::vector<uint8_t> tmp;
- uint32_t t = 0, y = 0;
- int g = 3;
- for (size_t i = 0; src[i] != '\0'; ++i) {
- uint8_t c = kBase64Map[src[i] & 0xFF];
- if (c == 255) continue;
- // the final = symbols are read and used to trim the remaining bytes
- if (c == 254) {
- c = 0;
- // prevent g < 0 which would potentially allow an overflow later
- if (--g < 0) {
- return std::vector<uint8_t>();
- }
- } else if (g != 3) {
- // we only allow = to be at the end
- return std::vector<uint8_t>();
- }
- t = (t << 6) | c;
- if (++y == 4) {
- tmp.push_back((t >> 16) & 255);
- if (g > 1) {
- tmp.push_back((t >> 8) & 255);
- }
- if (g > 2) {
- tmp.push_back(t & 255);
- }
- y = t = 0;
- }
- }
- if (y != 0) {
- return std::vector<uint8_t>();
- }
- return tmp;
+static inline std::vector<uint8_t> DecodeBase64Vec(const char* src) {
+ std::vector<uint8_t> res;
+ size_t size;
+ std::unique_ptr<uint8_t[]> data(DecodeBase64(src, &size));
+ res.resize(size);
+ memcpy(res.data(), data.get(), size);
+ return res;
}
// Although this is the same content logically as the Nested test dex,
@@ -166,7 +115,7 @@
static void DecodeAndWriteDexFile(const char* base64, const char* location) {
// decode base64
CHECK(base64 != nullptr);
- std::vector<uint8_t> dex_bytes = DecodeBase64(base64);
+ std::vector<uint8_t> dex_bytes = DecodeBase64Vec(base64);
CHECK_NE(dex_bytes.size(), 0u);
// write to provided file
@@ -202,7 +151,7 @@
const char* location,
uint32_t location_checksum) {
CHECK(base64 != nullptr);
- std::vector<uint8_t> dex_bytes = DecodeBase64(base64);
+ std::vector<uint8_t> dex_bytes = DecodeBase64Vec(base64);
CHECK_NE(dex_bytes.size(), 0u);
std::string error_message;
diff --git a/runtime/dex_file_verifier_test.cc b/runtime/dex_file_verifier_test.cc
index 71c0ad9..c5a4d75 100644
--- a/runtime/dex_file_verifier_test.cc
+++ b/runtime/dex_file_verifier_test.cc
@@ -29,34 +29,10 @@
#include "leb128.h"
#include "scoped_thread_state_change.h"
#include "thread-inl.h"
+#include "utils.h"
namespace art {
-static const uint8_t kBase64Map[256] = {
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 62, 255, 255, 255, 63,
- 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 255, 255,
- 255, 254, 255, 255, 255, 0, 1, 2, 3, 4, 5, 6,
- 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, // NOLINT
- 19, 20, 21, 22, 23, 24, 25, 255, 255, 255, 255, 255, // NOLINT
- 255, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
- 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, // NOLINT
- 49, 50, 51, 255, 255, 255, 255, 255, 255, 255, 255, 255, // NOLINT
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
- 255, 255, 255, 255
-};
-
// Make the Dex file version 37.
static void MakeDexVersion37(DexFile* dex_file) {
size_t offset = OFFSETOF_MEMBER(DexFile::Header, magic_) + 6;
@@ -64,52 +40,6 @@
*(const_cast<uint8_t*>(dex_file->Begin()) + offset) = '7';
}
-static inline std::unique_ptr<uint8_t[]> DecodeBase64(const char* src, size_t* dst_size) {
- std::vector<uint8_t> tmp;
- uint32_t t = 0, y = 0;
- int g = 3;
- for (size_t i = 0; src[i] != '\0'; ++i) {
- uint8_t c = kBase64Map[src[i] & 0xFF];
- if (c == 255) continue;
- // the final = symbols are read and used to trim the remaining bytes
- if (c == 254) {
- c = 0;
- // prevent g < 0 which would potentially allow an overflow later
- if (--g < 0) {
- *dst_size = 0;
- return nullptr;
- }
- } else if (g != 3) {
- // we only allow = to be at the end
- *dst_size = 0;
- return nullptr;
- }
- t = (t << 6) | c;
- if (++y == 4) {
- tmp.push_back((t >> 16) & 255);
- if (g > 1) {
- tmp.push_back((t >> 8) & 255);
- }
- if (g > 2) {
- tmp.push_back(t & 255);
- }
- y = t = 0;
- }
- }
- if (y != 0) {
- *dst_size = 0;
- return nullptr;
- }
- std::unique_ptr<uint8_t[]> dst(new uint8_t[tmp.size()]);
- if (dst_size != nullptr) {
- *dst_size = tmp.size();
- } else {
- *dst_size = 0;
- }
- std::copy(tmp.begin(), tmp.end(), dst.get());
- return dst;
-}
-
static void FixUpChecksum(uint8_t* dex_file) {
DexFile::Header* header = reinterpret_cast<DexFile::Header*>(dex_file);
uint32_t expected_size = header->file_size_;
@@ -123,7 +53,7 @@
class DexFileVerifierTest : public CommonRuntimeTest {
protected:
DexFile* GetDexFile(const uint8_t* dex_bytes, size_t length) {
- return new DexFile(dex_bytes, length, "tmp", 0, nullptr, nullptr);
+ return new DexFile(dex_bytes, length, "tmp", 0, nullptr);
}
void VerifyModification(const char* dex_file_base64_content,
@@ -131,7 +61,7 @@
std::function<void(DexFile*)> f,
const char* expected_error) {
size_t length;
- std::unique_ptr<uint8_t[]> dex_bytes = DecodeBase64(dex_file_base64_content, &length);
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(dex_file_base64_content, &length));
CHECK(dex_bytes != nullptr);
// Note: `dex_file` will be destroyed before `dex_bytes`.
std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
@@ -1704,7 +1634,7 @@
TEST_F(DexFileVerifierTest, Checksum) {
size_t length;
- std::unique_ptr<uint8_t[]> dex_bytes = DecodeBase64(kGoodTestDex, &length);
+ std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kGoodTestDex, &length));
CHECK(dex_bytes != nullptr);
// Note: `dex_file` will be destroyed before `dex_bytes`.
std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
diff --git a/runtime/entrypoints/quick/quick_entrypoints_enum.cc b/runtime/entrypoints/quick/quick_entrypoints_enum.cc
index 7b80af6..81f152b 100644
--- a/runtime/entrypoints/quick/quick_entrypoints_enum.cc
+++ b/runtime/entrypoints/quick/quick_entrypoints_enum.cc
@@ -71,4 +71,55 @@
}
}
+bool EntrypointCanTriggerGC(QuickEntrypointEnum entrypoint) {
+ switch (entrypoint) {
+ // Listed in the same order as in quick_entrypoints_list.h.
+ case kQuickCmpgDouble:
+ case kQuickCmpgFloat:
+ case kQuickCmplDouble:
+ case kQuickCmplFloat:
+ case kQuickCos:
+ case kQuickSin:
+ case kQuickAcos:
+ case kQuickAsin:
+ case kQuickAtan:
+ case kQuickAtan2:
+ case kQuickCbrt:
+ case kQuickCosh:
+ case kQuickExp:
+ case kQuickExpm1:
+ case kQuickHypot:
+ case kQuickLog:
+ case kQuickLog10:
+ case kQuickNextAfter:
+ case kQuickSinh:
+ case kQuickTan:
+ case kQuickTanh:
+ case kQuickFmod:
+ case kQuickL2d:
+ case kQuickFmodf:
+ case kQuickL2f:
+ case kQuickD2iz:
+ case kQuickF2iz:
+ case kQuickIdivmod:
+ case kQuickD2l:
+ case kQuickF2l:
+ case kQuickLdiv:
+ case kQuickLmod:
+ case kQuickLmul:
+ case kQuickShlLong:
+ case kQuickShrLong:
+ case kQuickUshrLong:
+ return false;
+
+ /* Used by mips for 64bit volatile load/stores. */
+ case kQuickA64Load:
+ case kQuickA64Store:
+ return false;
+
+ default:
+ return true;
+ }
+}
+
} // namespace art
diff --git a/runtime/entrypoints/quick/quick_entrypoints_enum.h b/runtime/entrypoints/quick/quick_entrypoints_enum.h
index 7674873..abf2c34 100644
--- a/runtime/entrypoints/quick/quick_entrypoints_enum.h
+++ b/runtime/entrypoints/quick/quick_entrypoints_enum.h
@@ -63,6 +63,7 @@
#undef ENTRYPOINT_ENUM
bool EntrypointRequiresStackMap(QuickEntrypointEnum trampoline);
+bool EntrypointCanTriggerGC(QuickEntrypointEnum entrypoint);
} // namespace art
diff --git a/runtime/entrypoints/quick/quick_jni_entrypoints.cc b/runtime/entrypoints/quick/quick_jni_entrypoints.cc
index 76b5456..446e343 100644
--- a/runtime/entrypoints/quick/quick_jni_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_jni_entrypoints.cc
@@ -169,22 +169,33 @@
HandleScope* handle_scope)
// TODO: NO_THREAD_SAFETY_ANALYSIS as GoToRunnable() is NO_THREAD_SAFETY_ANALYSIS
NO_THREAD_SAFETY_ANALYSIS {
- GoToRunnable(self);
+ bool critical_native = called->IsAnnotatedWithCriticalNative();
+ bool fast_native = called->IsAnnotatedWithFastNative();
+ bool normal_native = !critical_native && !fast_native;
+
+ // @Fast and @CriticalNative do not do a state transition.
+ if (LIKELY(normal_native)) {
+ GoToRunnable(self);
+ }
// We need the mutator lock (i.e., calling GoToRunnable()) before accessing the shorty or the
// locked object.
jobject locked = called->IsSynchronized() ? handle_scope->GetHandle(0).ToJObject() : nullptr;
char return_shorty_char = called->GetShorty()[0];
if (return_shorty_char == 'L') {
if (locked != nullptr) {
+ DCHECK(normal_native) << " @FastNative and synchronize is not supported";
UnlockJniSynchronizedMethod(locked, self);
}
return reinterpret_cast<uint64_t>(JniMethodEndWithReferenceHandleResult(
result.l, saved_local_ref_cookie, self));
} else {
if (locked != nullptr) {
+ DCHECK(normal_native) << " @FastNative and synchronize is not supported";
UnlockJniSynchronizedMethod(locked, self); // Must decode before pop.
}
- PopLocalReferences(saved_local_ref_cookie, self);
+ if (LIKELY(!critical_native)) {
+ PopLocalReferences(saved_local_ref_cookie, self);
+ }
switch (return_shorty_char) {
case 'F': {
if (kRuntimeISA == kX86) {
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index 3c6f807..fcbd834 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -1625,7 +1625,8 @@
class ComputeGenericJniFrameSize FINAL : public ComputeNativeCallFrameSize {
public:
- ComputeGenericJniFrameSize() : num_handle_scope_references_(0) {}
+ explicit ComputeGenericJniFrameSize(bool critical_native)
+ : num_handle_scope_references_(0), critical_native_(critical_native) {}
// Lays out the callee-save frame. Assumes that the incorrect frame corresponding to RefsAndArgs
// is at *m = sp. Will update to point to the bottom of the save frame.
@@ -1711,6 +1712,7 @@
private:
uint32_t num_handle_scope_references_;
+ const bool critical_native_;
};
uintptr_t ComputeGenericJniFrameSize::PushHandle(mirror::Object* /* ptr */) {
@@ -1720,6 +1722,11 @@
void ComputeGenericJniFrameSize::WalkHeader(
BuildNativeCallFrameStateMachine<ComputeNativeCallFrameSize>* sm) {
+ // First 2 parameters are always excluded for @CriticalNative.
+ if (UNLIKELY(critical_native_)) {
+ return;
+ }
+
// JNIEnv
sm->AdvancePointer(nullptr);
@@ -1778,11 +1785,16 @@
// of transitioning into native code.
class BuildGenericJniFrameVisitor FINAL : public QuickArgumentVisitor {
public:
- BuildGenericJniFrameVisitor(Thread* self, bool is_static, const char* shorty, uint32_t shorty_len,
+ BuildGenericJniFrameVisitor(Thread* self,
+ bool is_static,
+ bool critical_native,
+ const char* shorty,
+ uint32_t shorty_len,
ArtMethod*** sp)
: QuickArgumentVisitor(*sp, is_static, shorty, shorty_len),
- jni_call_(nullptr, nullptr, nullptr, nullptr), sm_(&jni_call_) {
- ComputeGenericJniFrameSize fsc;
+ jni_call_(nullptr, nullptr, nullptr, nullptr, critical_native),
+ sm_(&jni_call_) {
+ ComputeGenericJniFrameSize fsc(critical_native);
uintptr_t* start_gpr_reg;
uint32_t* start_fpr_reg;
uintptr_t* start_stack_arg;
@@ -1793,11 +1805,14 @@
jni_call_.Reset(start_gpr_reg, start_fpr_reg, start_stack_arg, handle_scope_);
- // jni environment is always first argument
- sm_.AdvancePointer(self->GetJniEnv());
+ // First 2 parameters are always excluded for CriticalNative methods.
+ if (LIKELY(!critical_native)) {
+ // jni environment is always first argument
+ sm_.AdvancePointer(self->GetJniEnv());
- if (is_static) {
- sm_.AdvanceHandleScope((**sp)->GetDeclaringClass());
+ if (is_static) {
+ sm_.AdvanceHandleScope((**sp)->GetDeclaringClass());
+ } // else "this" reference is already handled by QuickArgumentVisitor.
}
}
@@ -1822,8 +1837,11 @@
class FillJniCall FINAL : public FillNativeCall {
public:
FillJniCall(uintptr_t* gpr_regs, uint32_t* fpr_regs, uintptr_t* stack_args,
- HandleScope* handle_scope) : FillNativeCall(gpr_regs, fpr_regs, stack_args),
- handle_scope_(handle_scope), cur_entry_(0) {}
+ HandleScope* handle_scope, bool critical_native)
+ : FillNativeCall(gpr_regs, fpr_regs, stack_args),
+ handle_scope_(handle_scope),
+ cur_entry_(0),
+ critical_native_(critical_native) {}
uintptr_t PushHandle(mirror::Object* ref) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1839,12 +1857,17 @@
while (cur_entry_ < expected_slots) {
handle_scope_->GetMutableHandle(cur_entry_++).Assign(nullptr);
}
- DCHECK_NE(cur_entry_, 0U);
+
+ if (!critical_native_) {
+ // Non-critical natives have at least the self class (jclass) or this (jobject).
+ DCHECK_NE(cur_entry_, 0U);
+ }
}
private:
HandleScope* handle_scope_;
size_t cur_entry_;
+ const bool critical_native_;
};
HandleScope* handle_scope_;
@@ -1924,7 +1947,12 @@
extern "C" void* artFindNativeMethod(Thread* self);
#endif
-uint64_t artQuickGenericJniEndJNIRef(Thread* self, uint32_t cookie, jobject l, jobject lock) {
+static uint64_t artQuickGenericJniEndJNIRef(Thread* self,
+ uint32_t cookie,
+ bool fast_native ATTRIBUTE_UNUSED,
+ jobject l,
+ jobject lock) {
+ // TODO: add entrypoints for @FastNative returning objects.
if (lock != nullptr) {
return reinterpret_cast<uint64_t>(JniMethodEndWithReferenceSynchronized(l, cookie, lock, self));
} else {
@@ -1932,11 +1960,19 @@
}
}
-void artQuickGenericJniEndJNINonRef(Thread* self, uint32_t cookie, jobject lock) {
+static void artQuickGenericJniEndJNINonRef(Thread* self,
+ uint32_t cookie,
+ bool fast_native,
+ jobject lock) {
if (lock != nullptr) {
JniMethodEndSynchronized(cookie, lock, self);
+ // Ignore "fast_native" here because synchronized functions aren't very fast.
} else {
- JniMethodEnd(cookie, self);
+ if (UNLIKELY(fast_native)) {
+ JniMethodFastEnd(cookie, self);
+ } else {
+ JniMethodEnd(cookie, self);
+ }
}
}
@@ -1958,9 +1994,17 @@
DCHECK(called->IsNative()) << PrettyMethod(called, true);
uint32_t shorty_len = 0;
const char* shorty = called->GetShorty(&shorty_len);
+ bool critical_native = called->IsAnnotatedWithCriticalNative();
+ bool fast_native = called->IsAnnotatedWithFastNative();
+ bool normal_native = !critical_native && !fast_native;
// Run the visitor and update sp.
- BuildGenericJniFrameVisitor visitor(self, called->IsStatic(), shorty, shorty_len, &sp);
+ BuildGenericJniFrameVisitor visitor(self,
+ called->IsStatic(),
+ critical_native,
+ shorty,
+ shorty_len,
+ &sp);
{
ScopedAssertNoThreadSuspension sants(__FUNCTION__);
visitor.VisitArguments();
@@ -1973,20 +2017,30 @@
self->VerifyStack();
- // Start JNI, save the cookie.
uint32_t cookie;
- if (called->IsSynchronized()) {
- cookie = JniMethodStartSynchronized(visitor.GetFirstHandleScopeJObject(), self);
- if (self->IsExceptionPending()) {
- self->PopHandleScope();
- // A negative value denotes an error.
- return GetTwoWordFailureValue();
+ uint32_t* sp32;
+ // Skip calling JniMethodStart for @CriticalNative.
+ if (LIKELY(!critical_native)) {
+ // Start JNI, save the cookie.
+ if (called->IsSynchronized()) {
+ DCHECK(normal_native) << " @FastNative and synchronize is not supported";
+ cookie = JniMethodStartSynchronized(visitor.GetFirstHandleScopeJObject(), self);
+ if (self->IsExceptionPending()) {
+ self->PopHandleScope();
+ // A negative value denotes an error.
+ return GetTwoWordFailureValue();
+ }
+ } else {
+ if (fast_native) {
+ cookie = JniMethodFastStart(self);
+ } else {
+ DCHECK(normal_native);
+ cookie = JniMethodStart(self);
+ }
}
- } else {
- cookie = JniMethodStart(self);
+ sp32 = reinterpret_cast<uint32_t*>(sp);
+ *(sp32 - 1) = cookie;
}
- uint32_t* sp32 = reinterpret_cast<uint32_t*>(sp);
- *(sp32 - 1) = cookie;
// Retrieve the stored native code.
void* nativeCode = called->GetEntryPointFromJni();
@@ -2007,12 +2061,15 @@
if (nativeCode == nullptr) {
DCHECK(self->IsExceptionPending()); // There should be an exception pending now.
- // End JNI, as the assembly will move to deliver the exception.
- jobject lock = called->IsSynchronized() ? visitor.GetFirstHandleScopeJObject() : nullptr;
- if (shorty[0] == 'L') {
- artQuickGenericJniEndJNIRef(self, cookie, nullptr, lock);
- } else {
- artQuickGenericJniEndJNINonRef(self, cookie, lock);
+ // @CriticalNative calls do not need to call back into JniMethodEnd.
+ if (LIKELY(!critical_native)) {
+ // End JNI, as the assembly will move to deliver the exception.
+ jobject lock = called->IsSynchronized() ? visitor.GetFirstHandleScopeJObject() : nullptr;
+ if (shorty[0] == 'L') {
+ artQuickGenericJniEndJNIRef(self, cookie, fast_native, nullptr, lock);
+ } else {
+ artQuickGenericJniEndJNINonRef(self, cookie, fast_native, lock);
+ }
}
return GetTwoWordFailureValue();
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 247cb96..2750fea 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -568,7 +568,11 @@
if (kVerboseMode) {
LOG(INFO) << "GC MarkingPhase";
}
- CHECK(weak_ref_access_enabled_);
+ Thread* self = Thread::Current();
+ if (kIsDebugBuild) {
+ MutexLock mu(self, *Locks::thread_list_lock_);
+ CHECK(weak_ref_access_enabled_);
+ }
// Scan immune spaces.
// Update all the fields in the immune spaces first without graying the objects so that we
@@ -627,7 +631,6 @@
Runtime::Current()->VisitNonThreadRoots(this);
}
- Thread* self = Thread::Current();
{
TimingLogger::ScopedTiming split7("ProcessMarkStack", GetTimings());
// We transition through three mark stack modes (thread-local, shared, GC-exclusive). The
@@ -695,7 +698,10 @@
CheckEmptyMarkStack();
}
- CHECK(weak_ref_access_enabled_);
+ if (kIsDebugBuild) {
+ MutexLock mu(self, *Locks::thread_list_lock_);
+ CHECK(weak_ref_access_enabled_);
+ }
if (kVerboseMode) {
LOG(INFO) << "GC end of MarkingPhase";
}
@@ -705,11 +711,10 @@
if (kVerboseMode) {
LOG(INFO) << "ReenableWeakRefAccess";
}
- weak_ref_access_enabled_.StoreRelaxed(true); // This is for new threads.
- QuasiAtomic::ThreadFenceForConstructor();
// Iterate all threads (don't need to or can't use a checkpoint) and re-enable weak ref access.
{
MutexLock mu(self, *Locks::thread_list_lock_);
+ weak_ref_access_enabled_ = true; // This is for new threads.
std::list<Thread*> thread_list = Runtime::Current()->GetThreadList()->GetList();
for (Thread* thread : thread_list) {
thread->SetWeakRefAccessEnabled(true);
@@ -744,12 +749,30 @@
ConcurrentCopying* const concurrent_copying_;
};
+class ConcurrentCopying::DisableMarkingCallback : public Closure {
+ public:
+ explicit DisableMarkingCallback(ConcurrentCopying* concurrent_copying)
+ : concurrent_copying_(concurrent_copying) {
+ }
+
+ void Run(Thread* self ATTRIBUTE_UNUSED) OVERRIDE REQUIRES(Locks::thread_list_lock_) {
+ // This needs to run under the thread_list_lock_ critical section in ThreadList::RunCheckpoint()
+ // to avoid a race with ThreadList::Register().
+ CHECK(concurrent_copying_->is_marking_);
+ concurrent_copying_->is_marking_ = false;
+ }
+
+ private:
+ ConcurrentCopying* const concurrent_copying_;
+};
+
void ConcurrentCopying::IssueDisableMarkingCheckpoint() {
Thread* self = Thread::Current();
DisableMarkingCheckpoint check_point(this);
ThreadList* thread_list = Runtime::Current()->GetThreadList();
gc_barrier_->Init(self, 0);
- size_t barrier_count = thread_list->RunCheckpoint(&check_point);
+ DisableMarkingCallback dmc(this);
+ size_t barrier_count = thread_list->RunCheckpoint(&check_point, &dmc);
// If there are no threads to wait which implies that all the checkpoint functions are finished,
// then no need to release the mutator lock.
if (barrier_count == 0) {
@@ -765,13 +788,9 @@
}
void ConcurrentCopying::DisableMarking() {
- // Change the global is_marking flag to false. Do a fence before doing a checkpoint to update the
- // thread-local flags so that a new thread starting up will get the correct is_marking flag.
- is_marking_ = false;
- QuasiAtomic::ThreadFenceForConstructor();
- // Use a checkpoint to turn off the thread-local is_gc_marking flags and to ensure no threads are
- // still in the middle of a read barrier which may have a from-space ref cached in a local
- // variable.
+ // Use a checkpoint to turn off the global is_marking and the thread-local is_gc_marking flags and
+ // to ensure no threads are still in the middle of a read barrier which may have a from-space ref
+ // cached in a local variable.
IssueDisableMarkingCheckpoint();
if (kUseTableLookupReadBarrier) {
heap_->rb_table_->ClearAll();
@@ -1158,12 +1177,13 @@
const bool disable_weak_ref_access_;
};
-void ConcurrentCopying::RevokeThreadLocalMarkStacks(bool disable_weak_ref_access) {
+void ConcurrentCopying::RevokeThreadLocalMarkStacks(bool disable_weak_ref_access,
+ Closure* checkpoint_callback) {
Thread* self = Thread::Current();
RevokeThreadLocalMarkStackCheckpoint check_point(this, disable_weak_ref_access);
ThreadList* thread_list = Runtime::Current()->GetThreadList();
gc_barrier_->Init(self, 0);
- size_t barrier_count = thread_list->RunCheckpoint(&check_point);
+ size_t barrier_count = thread_list->RunCheckpoint(&check_point, checkpoint_callback);
// If there are no threads to wait which implys that all the checkpoint functions are finished,
// then no need to release the mutator lock.
if (barrier_count == 0) {
@@ -1213,7 +1233,7 @@
MarkStackMode mark_stack_mode = mark_stack_mode_.LoadRelaxed();
if (mark_stack_mode == kMarkStackModeThreadLocal) {
// Process the thread-local mark stacks and the GC mark stack.
- count += ProcessThreadLocalMarkStacks(false);
+ count += ProcessThreadLocalMarkStacks(false, nullptr);
while (!gc_mark_stack_->IsEmpty()) {
mirror::Object* to_ref = gc_mark_stack_->PopBack();
ProcessMarkStackRef(to_ref);
@@ -1265,9 +1285,10 @@
return count == 0;
}
-size_t ConcurrentCopying::ProcessThreadLocalMarkStacks(bool disable_weak_ref_access) {
+size_t ConcurrentCopying::ProcessThreadLocalMarkStacks(bool disable_weak_ref_access,
+ Closure* checkpoint_callback) {
// Run a checkpoint to collect all thread local mark stacks and iterate over them all.
- RevokeThreadLocalMarkStacks(disable_weak_ref_access);
+ RevokeThreadLocalMarkStacks(disable_weak_ref_access, checkpoint_callback);
size_t count = 0;
std::vector<accounting::AtomicStack<mirror::Object>*> mark_stacks;
{
@@ -1360,6 +1381,23 @@
}
}
+class ConcurrentCopying::DisableWeakRefAccessCallback : public Closure {
+ public:
+ explicit DisableWeakRefAccessCallback(ConcurrentCopying* concurrent_copying)
+ : concurrent_copying_(concurrent_copying) {
+ }
+
+ void Run(Thread* self ATTRIBUTE_UNUSED) OVERRIDE REQUIRES(Locks::thread_list_lock_) {
+ // This needs to run under the thread_list_lock_ critical section in ThreadList::RunCheckpoint()
+ // to avoid a deadlock b/31500969.
+ CHECK(concurrent_copying_->weak_ref_access_enabled_);
+ concurrent_copying_->weak_ref_access_enabled_ = false;
+ }
+
+ private:
+ ConcurrentCopying* const concurrent_copying_;
+};
+
void ConcurrentCopying::SwitchToSharedMarkStackMode() {
Thread* self = Thread::Current();
CHECK(thread_running_gc_ != nullptr);
@@ -1369,12 +1407,10 @@
CHECK_EQ(static_cast<uint32_t>(before_mark_stack_mode),
static_cast<uint32_t>(kMarkStackModeThreadLocal));
mark_stack_mode_.StoreRelaxed(kMarkStackModeShared);
- CHECK(weak_ref_access_enabled_.LoadRelaxed());
- weak_ref_access_enabled_.StoreRelaxed(false);
- QuasiAtomic::ThreadFenceForConstructor();
+ DisableWeakRefAccessCallback dwrac(this);
// Process the thread local mark stacks one last time after switching to the shared mark stack
// mode and disable weak ref accesses.
- ProcessThreadLocalMarkStacks(true);
+ ProcessThreadLocalMarkStacks(true, &dwrac);
if (kVerboseMode) {
LOG(INFO) << "Switched to shared mark stack mode and disabled weak ref access";
}
@@ -1403,7 +1439,7 @@
MarkStackMode mark_stack_mode = mark_stack_mode_.LoadRelaxed();
if (mark_stack_mode == kMarkStackModeThreadLocal) {
// Thread-local mark stack mode.
- RevokeThreadLocalMarkStacks(false);
+ RevokeThreadLocalMarkStacks(false, nullptr);
MutexLock mu(Thread::Current(), mark_stack_lock_);
if (!revoked_mark_stacks_.empty()) {
for (accounting::AtomicStack<mirror::Object>* mark_stack : revoked_mark_stacks_) {
diff --git a/runtime/gc/collector/concurrent_copying.h b/runtime/gc/collector/concurrent_copying.h
index 53473f0..81ffbc5 100644
--- a/runtime/gc/collector/concurrent_copying.h
+++ b/runtime/gc/collector/concurrent_copying.h
@@ -34,6 +34,7 @@
#include <vector>
namespace art {
+class Closure;
class RootInfo;
namespace gc {
@@ -120,8 +121,8 @@
Barrier& GetBarrier() {
return *gc_barrier_;
}
- bool IsWeakRefAccessEnabled() {
- return weak_ref_access_enabled_.LoadRelaxed();
+ bool IsWeakRefAccessEnabled() REQUIRES(Locks::thread_list_lock_) {
+ return weak_ref_access_enabled_;
}
void RevokeThreadLocalMarkStack(Thread* thread) REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!mark_stack_lock_);
@@ -161,9 +162,9 @@
void VerifyGrayImmuneObjects()
REQUIRES(Locks::mutator_lock_)
REQUIRES(!mark_stack_lock_);
- size_t ProcessThreadLocalMarkStacks(bool disable_weak_ref_access)
+ size_t ProcessThreadLocalMarkStacks(bool disable_weak_ref_access, Closure* checkpoint_callback)
REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!mark_stack_lock_);
- void RevokeThreadLocalMarkStacks(bool disable_weak_ref_access)
+ void RevokeThreadLocalMarkStacks(bool disable_weak_ref_access, Closure* checkpoint_callback)
REQUIRES_SHARED(Locks::mutator_lock_);
void SwitchToSharedMarkStackMode() REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!mark_stack_lock_);
@@ -269,7 +270,7 @@
// without a lock. Other threads won't access the mark stack.
};
Atomic<MarkStackMode> mark_stack_mode_;
- Atomic<bool> weak_ref_access_enabled_;
+ bool weak_ref_access_enabled_ GUARDED_BY(Locks::thread_list_lock_);
// How many objects and bytes we moved. Used for accounting.
Atomic<size_t> bytes_moved_;
@@ -311,7 +312,9 @@
class AssertToSpaceInvariantRefsVisitor;
class ClearBlackPtrsVisitor;
class ComputeUnevacFromSpaceLiveRatioVisitor;
+ class DisableMarkingCallback;
class DisableMarkingCheckpoint;
+ class DisableWeakRefAccessCallback;
class FlipCallback;
class GrayImmuneObjectVisitor;
class ImmuneSpaceScanObjVisitor;
diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc
index cb5226b..11d4af8 100644
--- a/runtime/gc/heap.cc
+++ b/runtime/gc/heap.cc
@@ -327,9 +327,9 @@
continue;
}
- space::ImageSpace::CreateMultiImageLocations(image_file_name,
- boot_classpath,
- &image_file_names);
+ space::ImageSpace::ExtractMultiImageLocations(image_file_name,
+ boot_classpath,
+ &image_file_names);
}
} else {
LOG(ERROR) << "Could not create image space with image file '" << image_file_name << "'. "
diff --git a/runtime/gc/space/image_space.cc b/runtime/gc/space/image_space.cc
index e41c532..d17ef81 100644
--- a/runtime/gc/space/image_space.cc
+++ b/runtime/gc/space/image_space.cc
@@ -1619,9 +1619,54 @@
<< ",name=\"" << GetName() << "\"]";
}
-void ImageSpace::CreateMultiImageLocations(const std::string& input_image_file_name,
- const std::string& boot_classpath,
- std::vector<std::string>* image_file_names) {
+std::string ImageSpace::GetMultiImageBootClassPath(
+ const std::vector<const char*>& dex_locations,
+ const std::vector<const char*>& oat_filenames,
+ const std::vector<const char*>& image_filenames) {
+ DCHECK_GT(oat_filenames.size(), 1u);
+ // If the image filename was adapted (e.g., for our tests), we need to change this here,
+ // too, but need to strip all path components (they will be re-established when loading).
+ std::ostringstream bootcp_oss;
+ bool first_bootcp = true;
+ for (size_t i = 0; i < dex_locations.size(); ++i) {
+ if (!first_bootcp) {
+ bootcp_oss << ":";
+ }
+
+ std::string dex_loc = dex_locations[i];
+ std::string image_filename = image_filenames[i];
+
+ // Use the dex_loc path, but the image_filename name (without path elements).
+ size_t dex_last_slash = dex_loc.rfind('/');
+
+ // npos is max(size_t). That makes this a bit ugly.
+ size_t image_last_slash = image_filename.rfind('/');
+ size_t image_last_at = image_filename.rfind('@');
+ size_t image_last_sep = (image_last_slash == std::string::npos)
+ ? image_last_at
+ : (image_last_at == std::string::npos)
+ ? std::string::npos
+ : std::max(image_last_slash, image_last_at);
+ // Note: whenever image_last_sep == npos, +1 overflow means using the full string.
+
+ if (dex_last_slash == std::string::npos) {
+ dex_loc = image_filename.substr(image_last_sep + 1);
+ } else {
+ dex_loc = dex_loc.substr(0, dex_last_slash + 1) +
+ image_filename.substr(image_last_sep + 1);
+ }
+
+ // Image filenames already end with .art, no need to replace.
+
+ bootcp_oss << dex_loc;
+ first_bootcp = false;
+ }
+ return bootcp_oss.str();
+}
+
+void ImageSpace::ExtractMultiImageLocations(const std::string& input_image_file_name,
+ const std::string& boot_classpath,
+ std::vector<std::string>* image_file_names) {
DCHECK(image_file_names != nullptr);
std::vector<std::string> images;
diff --git a/runtime/gc/space/image_space.h b/runtime/gc/space/image_space.h
index c407259..0ba131b 100644
--- a/runtime/gc/space/image_space.h
+++ b/runtime/gc/space/image_space.h
@@ -125,10 +125,14 @@
// Use the input image filename to adapt the names in the given boot classpath to establish
// complete locations for secondary images.
- static void CreateMultiImageLocations(const std::string& input_image_file_name,
+ static void ExtractMultiImageLocations(const std::string& input_image_file_name,
const std::string& boot_classpath,
std::vector<std::string>* image_filenames);
+ static std::string GetMultiImageBootClassPath(const std::vector<const char*>& dex_locations,
+ const std::vector<const char*>& oat_filenames,
+ const std::vector<const char*>& image_filenames);
+
// Return the end of the image which includes non-heap objects such as ArtMethods and ArtFields.
uint8_t* GetImageEnd() const {
return Begin() + GetImageHeader().GetImageSize();
diff --git a/runtime/globals.h b/runtime/globals.h
index 691bf55..28534e4 100644
--- a/runtime/globals.h
+++ b/runtime/globals.h
@@ -85,9 +85,9 @@
# endif
#endif
-// Are additional statically-linked ART host binaries (dex2oats,
-// oatdumps, etc.) built and available?
-#if !defined(ART_TARGET) && defined(ART_BUILD_HOST_STATIC)
+// Additional statically-linked ART binaries (dex2oats, oatdumps, etc.) are
+// always available on the host
+#if !defined(ART_TARGET)
static constexpr bool kHostStaticBuildEnabled = true;
#else
static constexpr bool kHostStaticBuildEnabled = false;
diff --git a/runtime/jni_internal.cc b/runtime/jni_internal.cc
index a434442..d9cb1c6 100644
--- a/runtime/jni_internal.cc
+++ b/runtime/jni_internal.cc
@@ -375,7 +375,7 @@
CHECK_NON_NULL_ARGUMENT(mid);
ScopedObjectAccess soa(env);
ArtMethod* m = soa.DecodeMethod(mid);
- mirror::AbstractMethod* method;
+ mirror::Executable* method;
DCHECK_EQ(Runtime::Current()->GetClassLinker()->GetImagePointerSize(), kRuntimePointerSize);
DCHECK(!Runtime::Current()->IsActiveTransaction());
if (m->IsConstructor()) {
diff --git a/runtime/mirror/abstract_method.h b/runtime/mirror/abstract_method.h
deleted file mode 100644
index 9c20613..0000000
--- a/runtime/mirror/abstract_method.h
+++ /dev/null
@@ -1,77 +0,0 @@
-/*
- * Copyright (C) 2015 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#ifndef ART_RUNTIME_MIRROR_ABSTRACT_METHOD_H_
-#define ART_RUNTIME_MIRROR_ABSTRACT_METHOD_H_
-
-#include "executable.h"
-#include "gc_root.h"
-#include "object.h"
-#include "object_callbacks.h"
-#include "read_barrier_option.h"
-
-namespace art {
-
-struct AbstractMethodOffsets;
-class ArtMethod;
-
-namespace mirror {
-
-// C++ mirror of java.lang.reflect.AbstractMethod.
-class MANAGED AbstractMethod : public Executable {
- public:
- // Called from Constructor::CreateFromArtMethod, Method::CreateFromArtMethod.
- template <PointerSize kPointerSize, bool kTransactionActive>
- bool CreateFromArtMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!Roles::uninterruptible_);
-
- ArtMethod* GetArtMethod() REQUIRES_SHARED(Locks::mutator_lock_);
- // Only used by the image writer.
- template <bool kTransactionActive = false>
- void SetArtMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_);
- mirror::Class* GetDeclaringClass() REQUIRES_SHARED(Locks::mutator_lock_);
-
- private:
- static MemberOffset ArtMethodOffset() {
- return MemberOffset(OFFSETOF_MEMBER(AbstractMethod, art_method_));
- }
- static MemberOffset DeclaringClassOffset() {
- return MemberOffset(OFFSETOF_MEMBER(AbstractMethod, declaring_class_));
- }
- static MemberOffset DeclaringClassOfOverriddenMethodOffset() {
- return MemberOffset(OFFSETOF_MEMBER(AbstractMethod, declaring_class_of_overridden_method_));
- }
- static MemberOffset AccessFlagsOffset() {
- return MemberOffset(OFFSETOF_MEMBER(AbstractMethod, access_flags_));
- }
- static MemberOffset DexMethodIndexOffset() {
- return MemberOffset(OFFSETOF_MEMBER(AbstractMethod, dex_method_index_));
- }
-
- HeapReference<mirror::Class> declaring_class_;
- HeapReference<mirror::Class> declaring_class_of_overridden_method_;
- uint64_t art_method_;
- uint32_t access_flags_;
- uint32_t dex_method_index_;
-
- friend struct art::AbstractMethodOffsets; // for verifying offset information
- DISALLOW_IMPLICIT_CONSTRUCTORS(AbstractMethod);
-};
-
-} // namespace mirror
-} // namespace art
-
-#endif // ART_RUNTIME_MIRROR_ABSTRACT_METHOD_H_
diff --git a/runtime/mirror/abstract_method.cc b/runtime/mirror/executable.cc
similarity index 70%
rename from runtime/mirror/abstract_method.cc
rename to runtime/mirror/executable.cc
index b4dce58..33ebd81 100644
--- a/runtime/mirror/abstract_method.cc
+++ b/runtime/mirror/executable.cc
@@ -14,15 +14,14 @@
* limitations under the License.
*/
-#include "abstract_method.h"
-
#include "art_method-inl.h"
+#include "executable.h"
namespace art {
namespace mirror {
template <PointerSize kPointerSize, bool kTransactionActive>
-bool AbstractMethod::CreateFromArtMethod(ArtMethod* method) {
+bool Executable::CreateFromArtMethod(ArtMethod* method) {
auto* interface_method = method->GetInterfaceMethodIfProxy(kPointerSize);
SetArtMethod<kTransactionActive>(method);
SetFieldObject<kTransactionActive>(DeclaringClassOffset(), method->GetDeclaringClass());
@@ -33,28 +32,28 @@
return true;
}
-template bool AbstractMethod::CreateFromArtMethod<PointerSize::k32, false>(
+template bool Executable::CreateFromArtMethod<PointerSize::k32, false>(
ArtMethod* method);
-template bool AbstractMethod::CreateFromArtMethod<PointerSize::k32, true>(
+template bool Executable::CreateFromArtMethod<PointerSize::k32, true>(
ArtMethod* method);
-template bool AbstractMethod::CreateFromArtMethod<PointerSize::k64, false>(
+template bool Executable::CreateFromArtMethod<PointerSize::k64, false>(
ArtMethod* method);
-template bool AbstractMethod::CreateFromArtMethod<PointerSize::k64, true>(
+template bool Executable::CreateFromArtMethod<PointerSize::k64, true>(
ArtMethod* method);
-ArtMethod* AbstractMethod::GetArtMethod() {
+ArtMethod* Executable::GetArtMethod() {
return reinterpret_cast<ArtMethod*>(GetField64(ArtMethodOffset()));
}
template <bool kTransactionActive>
-void AbstractMethod::SetArtMethod(ArtMethod* method) {
+void Executable::SetArtMethod(ArtMethod* method) {
SetField64<kTransactionActive>(ArtMethodOffset(), reinterpret_cast<uint64_t>(method));
}
-template void AbstractMethod::SetArtMethod<false>(ArtMethod* method);
-template void AbstractMethod::SetArtMethod<true>(ArtMethod* method);
+template void Executable::SetArtMethod<false>(ArtMethod* method);
+template void Executable::SetArtMethod<true>(ArtMethod* method);
-mirror::Class* AbstractMethod::GetDeclaringClass() {
+mirror::Class* Executable::GetDeclaringClass() {
return GetFieldObject<mirror::Class>(DeclaringClassOffset());
}
diff --git a/runtime/mirror/executable.h b/runtime/mirror/executable.h
index 232fce8..6c465f6 100644
--- a/runtime/mirror/executable.h
+++ b/runtime/mirror/executable.h
@@ -32,9 +32,42 @@
// C++ mirror of java.lang.reflect.Executable.
class MANAGED Executable : public AccessibleObject {
+ public:
+ // Called from Constructor::CreateFromArtMethod, Method::CreateFromArtMethod.
+ template <PointerSize kPointerSize, bool kTransactionActive>
+ bool CreateFromArtMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!Roles::uninterruptible_);
+
+ ArtMethod* GetArtMethod() REQUIRES_SHARED(Locks::mutator_lock_);
+ // Only used by the image writer.
+ template <bool kTransactionActive = false>
+ void SetArtMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::Class* GetDeclaringClass() REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
uint16_t has_real_parameter_data_;
+ HeapReference<mirror::Class> declaring_class_;
+ HeapReference<mirror::Class> declaring_class_of_overridden_method_;
HeapReference<mirror::Array> parameters_;
+ uint64_t art_method_;
+ uint32_t access_flags_;
+ uint32_t dex_method_index_;
+
+ static MemberOffset ArtMethodOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(Executable, art_method_));
+ }
+ static MemberOffset DeclaringClassOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(Executable, declaring_class_));
+ }
+ static MemberOffset DeclaringClassOfOverriddenMethodOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(Executable, declaring_class_of_overridden_method_));
+ }
+ static MemberOffset AccessFlagsOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(Executable, access_flags_));
+ }
+ static MemberOffset DexMethodIndexOffset() {
+ return MemberOffset(OFFSETOF_MEMBER(Executable, dex_method_index_));
+ }
friend struct art::ExecutableOffsets; // for verifying offset information
DISALLOW_IMPLICIT_CONSTRUCTORS(Executable);
diff --git a/runtime/mirror/method.cc b/runtime/mirror/method.cc
index ef16719..71bac7e 100644
--- a/runtime/mirror/method.cc
+++ b/runtime/mirror/method.cc
@@ -56,7 +56,7 @@
DCHECK(!method->IsConstructor()) << PrettyMethod(method);
auto* ret = down_cast<Method*>(StaticClass()->AllocObject(self));
if (LIKELY(ret != nullptr)) {
- static_cast<AbstractMethod*>(ret)->
+ static_cast<Executable*>(ret)->
CreateFromArtMethod<kPointerSize, kTransactionActive>(method);
}
return ret;
@@ -108,7 +108,7 @@
DCHECK(method->IsConstructor()) << PrettyMethod(method);
auto* ret = down_cast<Constructor*>(StaticClass()->AllocObject(self));
if (LIKELY(ret != nullptr)) {
- static_cast<AbstractMethod*>(ret)->
+ static_cast<Executable*>(ret)->
CreateFromArtMethod<kPointerSize, kTransactionActive>(method);
}
return ret;
diff --git a/runtime/mirror/method.h b/runtime/mirror/method.h
index 6881991..205ea7a 100644
--- a/runtime/mirror/method.h
+++ b/runtime/mirror/method.h
@@ -17,8 +17,8 @@
#ifndef ART_RUNTIME_MIRROR_METHOD_H_
#define ART_RUNTIME_MIRROR_METHOD_H_
-#include "abstract_method.h"
#include "gc_root.h"
+#include "executable.h"
namespace art {
namespace mirror {
@@ -26,7 +26,7 @@
class Class;
// C++ mirror of java.lang.reflect.Method.
-class MANAGED Method : public AbstractMethod {
+class MANAGED Method : public Executable {
public:
template <PointerSize kPointerSize, bool kTransactionActive>
static Method* CreateFromArtMethod(Thread* self, ArtMethod* method)
@@ -58,7 +58,7 @@
};
// C++ mirror of java.lang.reflect.Constructor.
-class MANAGED Constructor: public AbstractMethod {
+class MANAGED Constructor: public Executable {
public:
template <PointerSize kPointerSize, bool kTransactionActive>
static Constructor* CreateFromArtMethod(Thread* self, ArtMethod* method)
diff --git a/runtime/native/dalvik_system_DexFile.cc b/runtime/native/dalvik_system_DexFile.cc
index b2349fc..384de34 100644
--- a/runtime/native/dalvik_system_DexFile.cc
+++ b/runtime/native/dalvik_system_DexFile.cc
@@ -270,7 +270,8 @@
const std::string descriptor(DotToDescriptor(class_name.c_str()));
const size_t hash(ComputeModifiedUtf8Hash(descriptor.c_str()));
for (auto& dex_file : dex_files) {
- const DexFile::ClassDef* dex_class_def = dex_file->FindClassDef(descriptor.c_str(), hash);
+ const DexFile::ClassDef* dex_class_def =
+ OatDexFile::FindClassDef(*dex_file, descriptor.c_str(), hash);
if (dex_class_def != nullptr) {
ScopedObjectAccess soa(env);
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
diff --git a/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc b/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
index 1761799..94933bc 100644
--- a/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
+++ b/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
@@ -23,6 +23,7 @@
#include "mem_map.h"
#include "mirror/class_loader.h"
#include "mirror/object-inl.h"
+#include "oat_file.h"
#include "scoped_thread_state_change.h"
#include "ScopedUtfChars.h"
@@ -140,7 +141,8 @@
const char* class_descriptor = descriptor.c_str();
const size_t hash = ComputeModifiedUtf8Hash(class_descriptor);
const DexFile* dex_file = CookieToDexFile(cookie);
- const DexFile::ClassDef* dex_class_def = dex_file->FindClassDef(class_descriptor, hash);
+ const DexFile::ClassDef* dex_class_def =
+ OatDexFile::FindClassDef(*dex_file, class_descriptor, hash);
if (dex_class_def != nullptr) {
ScopedObjectAccess soa(env);
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
diff --git a/runtime/native/java_lang_reflect_AbstractMethod.cc b/runtime/native/java_lang_reflect_Executable.cc
similarity index 77%
rename from runtime/native/java_lang_reflect_AbstractMethod.cc
rename to runtime/native/java_lang_reflect_Executable.cc
index 254f8db..8fcf6ac 100644
--- a/runtime/native/java_lang_reflect_AbstractMethod.cc
+++ b/runtime/native/java_lang_reflect_Executable.cc
@@ -14,7 +14,7 @@
* limitations under the License.
*/
-#include "java_lang_reflect_AbstractMethod.h"
+#include "java_lang_reflect_Executable.h"
#include "art_method-inl.h"
#include "dex_file_annotations.h"
@@ -28,7 +28,7 @@
namespace art {
-static jobjectArray AbstractMethod_getDeclaredAnnotations(JNIEnv* env, jobject javaMethod) {
+static jobjectArray Executable_getDeclaredAnnotationsNative(JNIEnv* env, jobject javaMethod) {
ScopedFastNativeObjectAccess soa(env);
ArtMethod* method = ArtMethod::FromReflectedMethod(soa, javaMethod);
if (method->GetDeclaringClass()->IsProxyClass()) {
@@ -42,7 +42,7 @@
return soa.AddLocalReference<jobjectArray>(annotations::GetAnnotationsForMethod(method));
}
-static jobject AbstractMethod_getAnnotationNative(JNIEnv* env,
+static jobject Executable_getAnnotationNative(JNIEnv* env,
jobject javaMethod,
jclass annotationType) {
ScopedFastNativeObjectAccess soa(env);
@@ -56,7 +56,7 @@
}
}
-static jobjectArray AbstractMethod_getSignatureAnnotation(JNIEnv* env, jobject javaMethod) {
+static jobjectArray Executable_getSignatureAnnotation(JNIEnv* env, jobject javaMethod) {
ScopedFastNativeObjectAccess soa(env);
ArtMethod* method = ArtMethod::FromReflectedMethod(soa, javaMethod);
if (method->GetDeclaringClass()->IsProxyClass()) {
@@ -67,7 +67,7 @@
}
-static jobjectArray AbstractMethod_getParameterAnnotationsNative(JNIEnv* env, jobject javaMethod) {
+static jobjectArray Executable_getParameterAnnotationsNative(JNIEnv* env, jobject javaMethod) {
ScopedFastNativeObjectAccess soa(env);
ArtMethod* method = ArtMethod::FromReflectedMethod(soa, javaMethod);
if (method->IsProxyMethod()) {
@@ -77,7 +77,7 @@
}
}
-static jboolean AbstractMethod_isAnnotationPresentNative(JNIEnv* env,
+static jboolean Executable_isAnnotationPresentNative(JNIEnv* env,
jobject javaMethod,
jclass annotationType) {
ScopedFastNativeObjectAccess soa(env);
@@ -91,17 +91,17 @@
}
static JNINativeMethod gMethods[] = {
- NATIVE_METHOD(AbstractMethod, getAnnotationNative,
+ NATIVE_METHOD(Executable, getAnnotationNative,
"!(Ljava/lang/Class;)Ljava/lang/annotation/Annotation;"),
- NATIVE_METHOD(AbstractMethod, getDeclaredAnnotations, "!()[Ljava/lang/annotation/Annotation;"),
- NATIVE_METHOD(AbstractMethod, getParameterAnnotationsNative,
+ NATIVE_METHOD(Executable, getDeclaredAnnotationsNative, "!()[Ljava/lang/annotation/Annotation;"),
+ NATIVE_METHOD(Executable, getParameterAnnotationsNative,
"!()[[Ljava/lang/annotation/Annotation;"),
- NATIVE_METHOD(AbstractMethod, getSignatureAnnotation, "!()[Ljava/lang/String;"),
- NATIVE_METHOD(AbstractMethod, isAnnotationPresentNative, "!(Ljava/lang/Class;)Z"),
+ NATIVE_METHOD(Executable, getSignatureAnnotation, "!()[Ljava/lang/String;"),
+ NATIVE_METHOD(Executable, isAnnotationPresentNative, "!(Ljava/lang/Class;)Z"),
};
-void register_java_lang_reflect_AbstractMethod(JNIEnv* env) {
- REGISTER_NATIVE_METHODS("java/lang/reflect/AbstractMethod");
+void register_java_lang_reflect_Executable(JNIEnv* env) {
+ REGISTER_NATIVE_METHODS("java/lang/reflect/Executable");
}
} // namespace art
diff --git a/runtime/native/java_lang_reflect_AbstractMethod.h b/runtime/native/java_lang_reflect_Executable.h
similarity index 72%
rename from runtime/native/java_lang_reflect_AbstractMethod.h
rename to runtime/native/java_lang_reflect_Executable.h
index 222e5a0..0cfed62 100644
--- a/runtime/native/java_lang_reflect_AbstractMethod.h
+++ b/runtime/native/java_lang_reflect_Executable.h
@@ -14,15 +14,15 @@
* limitations under the License.
*/
-#ifndef ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
-#define ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+#ifndef ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_EXECUTABLE_H_
+#define ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_EXECUTABLE_H_
#include <jni.h>
namespace art {
-void register_java_lang_reflect_AbstractMethod(JNIEnv* env);
+void register_java_lang_reflect_Executable(JNIEnv* env);
} // namespace art
-#endif // ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+#endif // ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_EXECUTABLE_H_
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index 76b71a3..ea692cd 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -49,6 +49,7 @@
#include "os.h"
#include "runtime.h"
#include "type_lookup_table.h"
+#include "utf-inl.h"
#include "utils.h"
#include "utils/dex_cache_arrays_layout-inl.h"
@@ -1204,7 +1205,21 @@
dex_file_pointer_(dex_file_pointer),
lookup_table_data_(lookup_table_data),
oat_class_offsets_pointer_(oat_class_offsets_pointer),
- dex_cache_arrays_(dex_cache_arrays) {}
+ dex_cache_arrays_(dex_cache_arrays) {
+ // Initialize TypeLookupTable.
+ if (lookup_table_data_ != nullptr) {
+ // Peek the number of classes from the DexFile.
+ const DexFile::Header* dex_header = reinterpret_cast<const DexFile::Header*>(dex_file_pointer_);
+ const uint32_t num_class_defs = dex_header->class_defs_size_;
+ if (lookup_table_data_ + TypeLookupTable::RawDataLength(num_class_defs) > GetOatFile()->End()) {
+ LOG(WARNING) << "found truncated lookup table in " << dex_file_location_;
+ } else {
+ lookup_table_.reset(TypeLookupTable::Open(dex_file_pointer_,
+ lookup_table_data_,
+ num_class_defs));
+ }
+ }
+}
OatFile::OatDexFile::~OatDexFile() {}
@@ -1273,6 +1288,28 @@
reinterpret_cast<const OatMethodOffsets*>(methods_pointer));
}
+const DexFile::ClassDef* OatFile::OatDexFile::FindClassDef(const DexFile& dex_file,
+ const char* descriptor,
+ size_t hash) {
+ const OatFile::OatDexFile* oat_dex_file = dex_file.GetOatDexFile();
+ DCHECK_EQ(ComputeModifiedUtf8Hash(descriptor), hash);
+ if (LIKELY((oat_dex_file != nullptr) && (oat_dex_file->GetTypeLookupTable() != nullptr))) {
+ const uint32_t class_def_idx = oat_dex_file->GetTypeLookupTable()->Lookup(descriptor, hash);
+ return (class_def_idx != DexFile::kDexNoIndex) ? &dex_file.GetClassDef(class_def_idx) : nullptr;
+ }
+ // Fast path for rare no class defs case.
+ const uint32_t num_class_defs = dex_file.NumClassDefs();
+ if (num_class_defs == 0) {
+ return nullptr;
+ }
+ const DexFile::TypeId* type_id = dex_file.FindTypeId(descriptor);
+ if (type_id != nullptr) {
+ uint16_t type_idx = dex_file.GetIndexForTypeId(*type_id);
+ return dex_file.FindClassDef(type_idx);
+ }
+ return nullptr;
+}
+
OatFile::OatClass::OatClass(const OatFile* oat_file,
mirror::Class::Status status,
OatClassType type,
diff --git a/runtime/oat_file.h b/runtime/oat_file.h
index a48791e..a61b941 100644
--- a/runtime/oat_file.h
+++ b/runtime/oat_file.h
@@ -29,6 +29,8 @@
#include "mirror/class.h"
#include "oat.h"
#include "os.h"
+#include "type_lookup_table.h"
+#include "utf.h"
#include "utils.h"
#include "vdex_file.h"
@@ -404,6 +406,16 @@
return dex_file_pointer_;
}
+ // Looks up a class definition by its class descriptor. Hash must be
+ // ComputeModifiedUtf8Hash(descriptor).
+ static const DexFile::ClassDef* FindClassDef(const DexFile& dex_file,
+ const char* descriptor,
+ size_t hash);
+
+ TypeLookupTable* GetTypeLookupTable() const {
+ return lookup_table_.get();
+ }
+
~OatDexFile();
private:
@@ -424,6 +436,7 @@
const uint8_t* lookup_table_data_;
const uint32_t* const oat_class_offsets_pointer_;
uint8_t* const dex_cache_arrays_;
+ mutable std::unique_ptr<TypeLookupTable> lookup_table_;
friend class OatFile;
friend class OatFileBase;
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index 977ef44..08272fa 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -17,7 +17,8 @@
name: "libopenjdkjvmti_defaults",
defaults: ["art_defaults"],
host_supported: true,
- srcs: ["OpenjdkJvmTi.cc"],
+ srcs: ["OpenjdkJvmTi.cc",
+ "transform.cc"],
include_dirs: ["art/runtime"],
shared_libs: ["libnativehelper"],
}
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index d3561c1..a1a2361 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -29,15 +29,17 @@
* questions.
*/
+#include <string>
+#include <vector>
+
#include <jni.h>
+
#include "openjdkjvmti/jvmti.h"
#include "art_jvmti.h"
-#include "gc_root-inl.h"
-#include "globals.h"
#include "jni_env_ext-inl.h"
-#include "scoped_thread_state_change.h"
-#include "thread_list.h"
+#include "runtime.h"
+#include "transform.h"
// TODO Remove this at some point by annotating all the methods. It was put in to make the skeleton
// easier to create.
@@ -904,6 +906,66 @@
static jvmtiError GetJLocationFormat(jvmtiEnv* env, jvmtiJlocationFormat* format_ptr) {
return ERR(NOT_IMPLEMENTED);
}
+
+ // TODO Remove this once events are working.
+ static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
+ jclass klass,
+ jvmtiEventClassFileLoadHook hook) {
+ std::vector<jclass> classes;
+ classes.push_back(klass);
+ return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
+ }
+
+ // TODO This will be called by the event handler for the art::ti Event Load Event
+ static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
+ const std::vector<jclass>& classes,
+ jvmtiEventClassFileLoadHook hook) {
+ if (!IsValidEnv(env)) {
+ return ERR(INVALID_ENVIRONMENT);
+ }
+ for (jclass klass : classes) {
+ JNIEnv* jni_env = nullptr;
+ jobject loader = nullptr;
+ std::string name;
+ jobject protection_domain = nullptr;
+ jint data_len = 0;
+ unsigned char* dex_data = nullptr;
+ jvmtiError ret = OK;
+ std::string location;
+ if ((ret = GetTransformationData(env,
+ klass,
+ /*out*/&location,
+ /*out*/&jni_env,
+ /*out*/&loader,
+ /*out*/&name,
+ /*out*/&protection_domain,
+ /*out*/&data_len,
+ /*out*/&dex_data)) != OK) {
+ // TODO Do something more here? Maybe give log statements?
+ return ret;
+ }
+ jint new_data_len = 0;
+ unsigned char* new_dex_data = nullptr;
+ hook(env,
+ jni_env,
+ klass,
+ loader,
+ name.c_str(),
+ protection_domain,
+ data_len,
+ dex_data,
+ /*out*/&new_data_len,
+ /*out*/&new_dex_data);
+ // Check if anything actually changed.
+ if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
+ MoveTransformedFileIntoRuntime(klass, std::move(location), new_data_len, new_dex_data);
+ env->Deallocate(new_dex_data);
+ }
+ // Deallocate the old dex data.
+ env->Deallocate(dex_data);
+ }
+ return OK;
+ }
};
static bool IsJvmtiVersion(jint version) {
@@ -942,7 +1004,10 @@
// The actual struct holding all of the entrypoints into the jvmti interface.
const jvmtiInterface_1 gJvmtiInterface = {
- nullptr, // reserved1
+ // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
+ // TODO Remove once we have events working.
+ reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
+ // nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
new file mode 100644
index 0000000..a0d79f3
--- /dev/null
+++ b/runtime/openjdkjvmti/transform.cc
@@ -0,0 +1,362 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "transform.h"
+
+#include "class_linker.h"
+#include "dex_file.h"
+#include "gc_root-inl.h"
+#include "globals.h"
+#include "jni_env_ext-inl.h"
+#include "jvmti.h"
+#include "linear_alloc.h"
+#include "mem_map.h"
+#include "mirror/array.h"
+#include "mirror/class-inl.h"
+#include "mirror/class_loader-inl.h"
+#include "mirror/string-inl.h"
+#include "scoped_thread_state_change.h"
+#include "thread_list.h"
+#include "transform.h"
+#include "utf.h"
+#include "utils/dex_cache_arrays_layout-inl.h"
+
+namespace openjdkjvmti {
+
+static bool ReadChecksum(jint data_len, const unsigned char* dex, /*out*/uint32_t* res) {
+ if (data_len < static_cast<jint>(sizeof(art::DexFile::Header))) {
+ return false;
+ }
+ *res = reinterpret_cast<const art::DexFile::Header*>(dex)->checksum_;
+ return true;
+}
+
+static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
+ jint data_len,
+ unsigned char* dex_data) {
+ std::string error_msg;
+ std::unique_ptr<art::MemMap> map(art::MemMap::MapAnonymous(
+ art::StringPrintf("%s-transformed", original_location.c_str()).c_str(),
+ nullptr,
+ data_len,
+ PROT_READ|PROT_WRITE,
+ /*low_4gb*/false,
+ /*reuse*/false,
+ &error_msg));
+ if (map == nullptr) {
+ return map;
+ }
+ memcpy(map->Begin(), dex_data, data_len);
+ map->Protect(PROT_READ);
+ return map;
+}
+
+static void InvalidateExistingMethods(art::Thread* self,
+ art::Handle<art::mirror::Class> klass,
+ art::Handle<art::mirror::DexCache> cache,
+ const art::DexFile* dex_file)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ // Create new DexCache with new DexFile.
+ // reset dex_class_def_idx_
+ // for each method reset entry_point_from_quick_compiled_code_ to bridge
+ // for each method reset dex_code_item_offset_
+ // for each method reset dex_method_index_
+ // for each method set dex_cache_resolved_methods_ to new DexCache
+ // for each method set dex_cache_resolved_types_ to new DexCache
+ auto* runtime = art::Runtime::Current();
+ art::ClassLinker* linker = runtime->GetClassLinker();
+ art::PointerSize image_pointer_size = linker->GetImagePointerSize();
+ std::string descriptor_storage;
+ const char* descriptor = klass->GetDescriptor(&descriptor_storage);
+ // Get the new class def
+ const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
+ *dex_file, descriptor, art::ComputeModifiedUtf8Hash(descriptor));
+ CHECK(class_def != nullptr);
+ const art::DexFile::TypeId& declaring_class_id = dex_file->GetTypeId(class_def->class_idx_);
+ art::StackHandleScope<6> hs(self);
+ const art::DexFile& old_dex_file = klass->GetDexFile();
+ for (art::ArtMethod& method : klass->GetMethods(image_pointer_size)) {
+ // Find the code_item for the method then find the dex_method_index and dex_code_item_offset to
+ // set.
+ const art::DexFile::StringId* new_name_id = dex_file->FindStringId(method.GetName());
+ uint16_t method_return_idx =
+ dex_file->GetIndexForTypeId(*dex_file->FindTypeId(method.GetReturnTypeDescriptor()));
+ const auto* old_type_list = method.GetParameterTypeList();
+ std::vector<uint16_t> new_type_list;
+ for (uint32_t i = 0; old_type_list != nullptr && i < old_type_list->Size(); i++) {
+ new_type_list.push_back(
+ dex_file->GetIndexForTypeId(
+ *dex_file->FindTypeId(
+ old_dex_file.GetTypeDescriptor(
+ old_dex_file.GetTypeId(
+ old_type_list->GetTypeItem(i).type_idx_)))));
+ }
+ const art::DexFile::ProtoId* proto_id = dex_file->FindProtoId(method_return_idx,
+ new_type_list);
+ CHECK(proto_id != nullptr || old_type_list == nullptr);
+ const art::DexFile::MethodId* method_id = dex_file->FindMethodId(declaring_class_id,
+ *new_name_id,
+ *proto_id);
+ CHECK(method_id != nullptr);
+ uint32_t dex_method_idx = dex_file->GetIndexForMethodId(*method_id);
+ method.SetDexMethodIndex(dex_method_idx);
+ linker->SetEntryPointsToInterpreter(&method);
+ method.SetCodeItemOffset(dex_file->FindCodeItemOffset(*class_def, dex_method_idx));
+ method.SetDexCacheResolvedMethods(cache->GetResolvedMethods(), image_pointer_size);
+ method.SetDexCacheResolvedTypes(cache->GetResolvedTypes(), image_pointer_size);
+ }
+
+ // Update the class fields.
+ // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
+ // to call GetReturnTypeDescriptor and GetParameterTypeList above).
+ klass->SetDexCache(cache.Get());
+ klass->SetDexCacheStrings(cache->GetStrings());
+ klass->SetDexClassDefIndex(dex_file->GetIndexForClassDef(*class_def));
+ klass->SetDexTypeIndex(dex_file->GetIndexForTypeId(*dex_file->FindTypeId(descriptor)));
+}
+
+// Adds the dex file.
+static art::mirror::LongArray* InsertDexFileIntoArray(art::Thread* self,
+ const art::DexFile* dex,
+ art::Handle<art::mirror::LongArray>& orig)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ art::StackHandleScope<1> hs(self);
+ CHECK_GE(orig->GetLength(), 1);
+ art::Handle<art::mirror::LongArray> ret(
+ hs.NewHandle(art::mirror::LongArray::Alloc(self, orig->GetLength() + 1)));
+ CHECK(ret.Get() != nullptr);
+ // Copy the oat-dex.
+ // TODO Should I clear the oatdex element?
+ ret->SetWithoutChecks<false>(0, orig->GetWithoutChecks(0));
+ ret->SetWithoutChecks<false>(1, static_cast<int64_t>(reinterpret_cast<intptr_t>(dex)));
+ ret->Memcpy(2, orig.Get(), 1, orig->GetLength() - 1);
+ return ret.Get();
+}
+
+// TODO Handle all types of class loaders.
+static bool FindDalvikSystemDexFileAndLoaderForClass(
+ art::Handle<art::mirror::Class> klass,
+ /*out*/art::mirror::Object** dex_file,
+ /*out*/art::mirror::ClassLoader** loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_) {
+ const char* dex_path_list_element_array_name = "[Ldalvik/system/DexPathList$Element;";
+ const char* dex_path_list_element_name = "Ldalvik/system/DexPathList$Element;";
+ const char* dex_file_name = "Ldalvik/system/DexFile;";
+ const char* dex_path_list_name = "Ldalvik/system/DexPathList;";
+ const char* dex_class_loader_name = "Ldalvik/system/BaseDexClassLoader;";
+
+ art::Thread* self = art::Thread::Current();
+ CHECK(!self->IsExceptionPending());
+ art::StackHandleScope<11> hs(self);
+ art::ClassLinker* class_linker = art::Runtime::Current()->GetClassLinker();
+
+ art::Handle<art::mirror::ClassLoader> null_loader(hs.NewHandle<art::mirror::ClassLoader>(
+ nullptr));
+ art::Handle<art::mirror::Class> base_dex_loader_class(hs.NewHandle(class_linker->FindClass(
+ self, dex_class_loader_name, null_loader)));
+
+ art::ArtField* path_list_field = base_dex_loader_class->FindDeclaredInstanceField(
+ "pathList", dex_path_list_name);
+ CHECK(path_list_field != nullptr);
+
+ art::ArtField* dex_path_list_element_field =
+ class_linker->FindClass(self, dex_path_list_name, null_loader)
+ ->FindDeclaredInstanceField("dexElements", dex_path_list_element_array_name);
+ CHECK(dex_path_list_element_field != nullptr);
+
+ art::ArtField* element_dex_file_field =
+ class_linker->FindClass(self, dex_path_list_element_name, null_loader)
+ ->FindDeclaredInstanceField("dexFile", dex_file_name);
+ CHECK(element_dex_file_field != nullptr);
+
+ art::Handle<art::mirror::ClassLoader> h_class_loader(hs.NewHandle(klass->GetClassLoader()));
+ art::Handle<art::mirror::Class> loader_class(hs.NewHandle(h_class_loader->GetClass()));
+ // Check if loader is a BaseDexClassLoader
+ if (!loader_class->IsSubClass(base_dex_loader_class.Get())) {
+ LOG(art::ERROR) << "The classloader is not a BaseDexClassLoader which is currently the only "
+ << "supported class loader type!";
+ return false;
+ }
+ art::Handle<art::mirror::Object> path_list(
+ hs.NewHandle(path_list_field->GetObject(h_class_loader.Get())));
+ CHECK(path_list.Get() != nullptr);
+ CHECK(!self->IsExceptionPending());
+ art::Handle<art::mirror::ObjectArray<art::mirror::Object>> dex_elements_list(
+ hs.NewHandle(art::down_cast<art::mirror::ObjectArray<art::mirror::Object>*>(
+ dex_path_list_element_field->GetObject(path_list.Get()))));
+ CHECK(!self->IsExceptionPending());
+ CHECK(dex_elements_list.Get() != nullptr);
+ size_t num_elements = dex_elements_list->GetLength();
+ art::MutableHandle<art::mirror::Object> current_element(
+ hs.NewHandle<art::mirror::Object>(nullptr));
+ art::MutableHandle<art::mirror::Object> first_dex_file(
+ hs.NewHandle<art::mirror::Object>(nullptr));
+ for (size_t i = 0; i < num_elements; i++) {
+ current_element.Assign(dex_elements_list->Get(i));
+ CHECK(current_element.Get() != nullptr);
+ CHECK(!self->IsExceptionPending());
+ CHECK(dex_elements_list.Get() != nullptr);
+ CHECK_EQ(current_element->GetClass(), class_linker->FindClass(self,
+ dex_path_list_element_name,
+ null_loader));
+ // TODO It would be cleaner to put the art::DexFile into the dalvik.system.DexFile the class
+ // comes from but it is more annoying because we would need to find this class. It is not
+ // necessary for proper function since we just need to be in front of the classes old dex file
+ // in the path.
+ first_dex_file.Assign(element_dex_file_field->GetObject(current_element.Get()));
+ if (first_dex_file.Get() != nullptr) {
+ *dex_file = first_dex_file.Get();
+ *loader = h_class_loader.Get();
+ return true;
+ }
+ }
+ return false;
+}
+
+// Gets the data surrounding the given class.
+jvmtiError GetTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ /*out*/std::string* location,
+ /*out*/JNIEnv** jni_env_ptr,
+ /*out*/jobject* loader,
+ /*out*/std::string* name,
+ /*out*/jobject* protection_domain,
+ /*out*/jint* data_len,
+ /*out*/unsigned char** dex_data) {
+ jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
+ if (ret != JNI_OK) {
+ // TODO Different error might be better?
+ return ERR(INTERNAL);
+ }
+ JNIEnv* jni_env = *jni_env_ptr;
+ art::ScopedObjectAccess soa(jni_env);
+ art::StackHandleScope<3> hs(art::Thread::Current());
+ art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class*>(klass)));
+ *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+ *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+ // TODO is this always null?
+ *protection_domain = nullptr;
+ const art::DexFile& dex = hs_klass->GetDexFile();
+ *location = dex.GetLocation();
+ *data_len = static_cast<jint>(dex.Size());
+ // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
+ jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
+ if (alloc_error != OK) {
+ return alloc_error;
+ }
+ // Copy the data into a temporary buffer.
+ memcpy(reinterpret_cast<void*>(*dex_data),
+ reinterpret_cast<const void*>(dex.Begin()),
+ *data_len);
+ return OK;
+}
+
+// Install the new dex file.
+// TODO do error checks for bad state (method in a stack, changes to number of methods/fields/etc).
+jvmtiError MoveTransformedFileIntoRuntime(jclass jklass,
+ std::string original_location,
+ jint data_len,
+ unsigned char* dex_data) {
+ const char* dex_file_name = "Ldalvik/system/DexFile;";
+ art::Thread* self = art::Thread::Current();
+ art::Runtime* runtime = art::Runtime::Current();
+ art::ThreadList* threads = runtime->GetThreadList();
+ art::ClassLinker* class_linker = runtime->GetClassLinker();
+ uint32_t checksum = 0;
+ if (!ReadChecksum(data_len, dex_data, &checksum)) {
+ return ERR(INVALID_CLASS_FORMAT);
+ }
+
+ std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_location, data_len, dex_data));
+ if (map.get() == nullptr) {
+ return ERR(INTERNAL);
+ }
+ std::string error_msg;
+ // Load the new dex_data in memory (mmap it, etc)
+ std::unique_ptr<const art::DexFile> new_dex_file = art::DexFile::Open(map->GetName(),
+ checksum,
+ std::move(map),
+ /*verify*/ true,
+ /*verify_checksum*/ true,
+ &error_msg);
+ CHECK(new_dex_file.get() != nullptr) << "Unable to load dex file! " << error_msg;
+
+ // Get mutator lock. We need the lifetimes of these variables (hs, the classes, etc.) to be longer
+ // then current lock (since there isn't upgrading of the lock) so we don't use soa.
+ art::ThreadState old_state = self->TransitionFromSuspendedToRunnable();
+ // This scope is needed to make sure that the HandleScope dies with mutator_lock_ since we need to
+ // upgrade the mutator_lock during the execution.
+ {
+ art::StackHandleScope<11> hs(self);
+ art::Handle<art::mirror::ClassLoader> null_loader(
+ hs.NewHandle<art::mirror::ClassLoader>(nullptr));
+ CHECK(null_loader.Get() == nullptr);
+ art::ArtField* dex_file_cookie_field = class_linker->
+ FindClass(self, dex_file_name, null_loader)->
+ FindDeclaredInstanceField("mCookie", "Ljava/lang/Object;");
+ art::ArtField* dex_file_internal_cookie_field =
+ class_linker->FindClass(self, dex_file_name, null_loader)
+ ->FindDeclaredInstanceField("mInternalCookie", "Ljava/lang/Object;");
+ CHECK(dex_file_cookie_field != nullptr);
+ art::Handle<art::mirror::Class> klass(
+ hs.NewHandle(art::down_cast<art::mirror::Class*>(self->DecodeJObject(jklass))));
+ art::mirror::Object* dex_file_ptr = nullptr;
+ art::mirror::ClassLoader* class_loader_ptr = nullptr;
+ // Find dalvik.system.DexFile that represents the dex file we are changing.
+ if (!FindDalvikSystemDexFileAndLoaderForClass(klass, &dex_file_ptr, &class_loader_ptr)) {
+ self->TransitionFromRunnableToSuspended(old_state);
+ LOG(art::ERROR) << "Could not find DexFile.";
+ return ERR(INTERNAL);
+ }
+ art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(dex_file_ptr));
+ art::Handle<art::mirror::ClassLoader> class_loader(hs.NewHandle(class_loader_ptr));
+ art::Handle<art::mirror::LongArray> art_dex_array(
+ hs.NewHandle<art::mirror::LongArray>(
+ dex_file_cookie_field->GetObject(dex_file_obj.Get())->AsLongArray()));
+ art::Handle<art::mirror::LongArray> new_art_dex_array(
+ hs.NewHandle<art::mirror::LongArray>(
+ InsertDexFileIntoArray(self, new_dex_file.get(), art_dex_array)));
+ art::Handle<art::mirror::DexCache> cache(
+ hs.NewHandle(class_linker->RegisterDexFile(*new_dex_file.get(), class_loader.Get())));
+ self->TransitionFromRunnableToSuspended(old_state);
+
+ threads->SuspendAll("moving dex file into runtime", /*long_suspend*/true);
+ // Change the mCookie field. Old value will be GC'd as normal.
+ dex_file_cookie_field->SetObject<false>(dex_file_obj.Get(), new_art_dex_array.Get());
+ dex_file_internal_cookie_field->SetObject<false>(dex_file_obj.Get(), new_art_dex_array.Get());
+ // Invalidate existing methods.
+ InvalidateExistingMethods(self, klass, cache, new_dex_file.release());
+ }
+ threads->ResumeAll();
+ return OK;
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
new file mode 100644
index 0000000..85bcb00
--- /dev/null
+++ b/runtime/openjdkjvmti/transform.h
@@ -0,0 +1,64 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TRANSFORM_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TRANSFORM_H_
+
+#include <string>
+
+#include <jni.h>
+
+#include "art_jvmti.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+// Gets the data surrounding the given class.
+jvmtiError GetTransformationData(ArtJvmTiEnv* env,
+ jclass klass,
+ /*out*/std::string* location,
+ /*out*/JNIEnv** jni_env_ptr,
+ /*out*/jobject* loader,
+ /*out*/std::string* name,
+ /*out*/jobject* protection_domain,
+ /*out*/jint* data_len,
+ /*out*/unsigned char** dex_data);
+
+// Install the new dex file.
+jvmtiError MoveTransformedFileIntoRuntime(jclass jklass,
+ std::string original_location,
+ jint data_len,
+ unsigned char* dex_data);
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TRANSFORM_H_
+
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index 67e3fe8..c69e98c 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -24,8 +24,8 @@
#include "dex_file-inl.h"
#include "indirect_reference_table-inl.h"
#include "jni_internal.h"
-#include "mirror/abstract_method.h"
#include "mirror/class-inl.h"
+#include "mirror/executable.h"
#include "mirror/object_array-inl.h"
#include "nth_caller_visitor.h"
#include "scoped_thread_state_change.h"
@@ -578,9 +578,9 @@
return nullptr;
}
- auto* abstract_method = soa.Decode<mirror::AbstractMethod*>(javaMethod);
- const bool accessible = abstract_method->IsAccessible();
- ArtMethod* m = abstract_method->GetArtMethod();
+ auto* executable = soa.Decode<mirror::Executable*>(javaMethod);
+ const bool accessible = executable->IsAccessible();
+ ArtMethod* m = executable->GetArtMethod();
mirror::Class* declaring_class = m->GetDeclaringClass();
if (UNLIKELY(!declaring_class->IsInitialized())) {
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index 97911d4..2be3b52 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -108,9 +108,9 @@
#include "native/java_lang_VMClassLoader.h"
#include "native/java_lang_ref_FinalizerReference.h"
#include "native/java_lang_ref_Reference.h"
-#include "native/java_lang_reflect_AbstractMethod.h"
#include "native/java_lang_reflect_Array.h"
#include "native/java_lang_reflect_Constructor.h"
+#include "native/java_lang_reflect_Executable.h"
#include "native/java_lang_reflect_Field.h"
#include "native/java_lang_reflect_Method.h"
#include "native/java_lang_reflect_Parameter.h"
@@ -639,11 +639,7 @@
system_class_loader_ = CreateSystemClassLoader(this);
- if (is_zygote_) {
- if (!InitZygote()) {
- return false;
- }
- } else {
+ if (!is_zygote_) {
if (is_native_bridge_loaded_) {
PreInitializeNativeBridge(".");
}
@@ -688,45 +684,6 @@
}
}
-// Do zygote-mode-only initialization.
-bool Runtime::InitZygote() {
-#ifdef __linux__
- // zygote goes into its own process group
- setpgid(0, 0);
-
- // See storage config details at http://source.android.com/tech/storage/
- // Create private mount namespace shared by all children
- if (unshare(CLONE_NEWNS) == -1) {
- PLOG(ERROR) << "Failed to unshare()";
- return false;
- }
-
- // Mark rootfs as being a slave so that changes from default
- // namespace only flow into our children.
- if (mount("rootfs", "/", nullptr, (MS_SLAVE | MS_REC), nullptr) == -1) {
- PLOG(ERROR) << "Failed to mount() rootfs as MS_SLAVE";
- return false;
- }
-
- // Create a staging tmpfs that is shared by our children; they will
- // bind mount storage into their respective private namespaces, which
- // are isolated from each other.
- const char* target_base = getenv("EMULATED_STORAGE_TARGET");
- if (target_base != nullptr) {
- if (mount("tmpfs", target_base, "tmpfs", MS_NOSUID | MS_NODEV,
- "uid=0,gid=1028,mode=0751") == -1) {
- PLOG(ERROR) << "Failed to mount tmpfs to " << target_base;
- return false;
- }
- }
-
- return true;
-#else
- UNIMPLEMENTED(FATAL);
- return false;
-#endif
-}
-
void Runtime::InitNonZygoteOrPostFork(
JNIEnv* env, bool is_system_server, NativeBridgeAction action, const char* isa) {
is_zygote_ = false;
@@ -899,9 +856,9 @@
const OatHeader& boot_oat_header = oat_file->GetOatHeader();
const char* boot_cp = boot_oat_header.GetStoreValueByKey(OatHeader::kBootClassPathKey);
if (boot_cp != nullptr) {
- gc::space::ImageSpace::CreateMultiImageLocations(image_locations[0],
- boot_cp,
- &image_locations);
+ gc::space::ImageSpace::ExtractMultiImageLocations(image_locations[0],
+ boot_cp,
+ &image_locations);
}
}
@@ -1421,9 +1378,9 @@
register_java_lang_DexCache(env);
register_java_lang_Object(env);
register_java_lang_ref_FinalizerReference(env);
- register_java_lang_reflect_AbstractMethod(env);
register_java_lang_reflect_Array(env);
register_java_lang_reflect_Constructor(env);
+ register_java_lang_reflect_Executable(env);
register_java_lang_reflect_Field(env);
register_java_lang_reflect_Method(env);
register_java_lang_reflect_Parameter(env);
diff --git a/runtime/runtime.h b/runtime/runtime.h
index 58068eb..9e63564 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -455,7 +455,6 @@
bool UseJitCompilation() const;
void PreZygoteFork();
- bool InitZygote();
void InitNonZygoteOrPostFork(
JNIEnv* env, bool is_system_server, NativeBridgeAction action, const char* isa);
diff --git a/runtime/thread_list.cc b/runtime/thread_list.cc
index ab1f198..5e6c8a4 100644
--- a/runtime/thread_list.cc
+++ b/runtime/thread_list.cc
@@ -284,7 +284,7 @@
}
}
-size_t ThreadList::RunCheckpoint(Closure* checkpoint_function) {
+size_t ThreadList::RunCheckpoint(Closure* checkpoint_function, Closure* callback) {
Thread* self = Thread::Current();
Locks::mutator_lock_->AssertNotExclusiveHeld(self);
Locks::thread_list_lock_->AssertNotHeld(self);
@@ -318,6 +318,10 @@
}
}
}
+ // Run the callback to be called inside this critical section.
+ if (callback != nullptr) {
+ callback->Run(self);
+ }
}
// Run the checkpoint on ourself while we wait for threads to suspend.
diff --git a/runtime/thread_list.h b/runtime/thread_list.h
index cef4ed1..b455e31 100644
--- a/runtime/thread_list.h
+++ b/runtime/thread_list.h
@@ -94,8 +94,10 @@
// Run a checkpoint on threads, running threads are not suspended but run the checkpoint inside
// of the suspend check. Returns how many checkpoints that are expected to run, including for
- // already suspended threads for b/24191051.
- size_t RunCheckpoint(Closure* checkpoint_function)
+ // already suspended threads for b/24191051. Run the callback, if non-null, inside the
+ // thread_list_lock critical section after determining the runnable/suspended states of the
+ // threads.
+ size_t RunCheckpoint(Closure* checkpoint_function, Closure* callback = nullptr)
REQUIRES(!Locks::thread_list_lock_, !Locks::thread_suspend_count_lock_);
size_t RunCheckpointOnRunnableThreads(Closure* checkpoint_function)
diff --git a/runtime/type_lookup_table.cc b/runtime/type_lookup_table.cc
index fc9faec..56e9262 100644
--- a/runtime/type_lookup_table.cc
+++ b/runtime/type_lookup_table.cc
@@ -38,14 +38,6 @@
}
}
-uint32_t TypeLookupTable::RawDataLength() const {
- return RawDataLength(dex_file_);
-}
-
-uint32_t TypeLookupTable::RawDataLength(const DexFile& dex_file) {
- return RawDataLength(dex_file.NumClassDefs());
-}
-
uint32_t TypeLookupTable::RawDataLength(uint32_t num_class_defs) {
return SupportedSize(num_class_defs) ? RoundUpToPowerOfTwo(num_class_defs) * sizeof(Entry) : 0u;
}
@@ -65,12 +57,15 @@
: nullptr;
}
-TypeLookupTable* TypeLookupTable::Open(const uint8_t* raw_data, const DexFile& dex_file) {
- return new TypeLookupTable(raw_data, dex_file);
+TypeLookupTable* TypeLookupTable::Open(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs) {
+ return new TypeLookupTable(dex_file_pointer, raw_data, num_class_defs);
}
TypeLookupTable::TypeLookupTable(const DexFile& dex_file, uint8_t* storage)
- : dex_file_(dex_file),
+ : dex_file_begin_(dex_file.Begin()),
+ raw_data_length_(RawDataLength(dex_file.NumClassDefs())),
mask_(CalculateMask(dex_file.NumClassDefs())),
entries_(storage != nullptr ? reinterpret_cast<Entry*>(storage) : new Entry[mask_ + 1]),
owns_entries_(storage == nullptr) {
@@ -106,9 +101,12 @@
}
}
-TypeLookupTable::TypeLookupTable(const uint8_t* raw_data, const DexFile& dex_file)
- : dex_file_(dex_file),
- mask_(CalculateMask(dex_file.NumClassDefs())),
+TypeLookupTable::TypeLookupTable(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs)
+ : dex_file_begin_(dex_file_pointer),
+ raw_data_length_(RawDataLength(num_class_defs)),
+ mask_(CalculateMask(num_class_defs)),
entries_(reinterpret_cast<Entry*>(const_cast<uint8_t*>(raw_data))),
owns_entries_(false) {}
diff --git a/runtime/type_lookup_table.h b/runtime/type_lookup_table.h
index d74d01d..9595743 100644
--- a/runtime/type_lookup_table.h
+++ b/runtime/type_lookup_table.h
@@ -62,8 +62,11 @@
// Method creates lookup table for dex file
static TypeLookupTable* Create(const DexFile& dex_file, uint8_t* storage = nullptr);
- // Method opens lookup table from binary data. Lookup table does not owns binary data.
- static TypeLookupTable* Open(const uint8_t* raw_data, const DexFile& dex_file);
+ // Method opens lookup table from binary data. Lookups will traverse strings and other
+ // data contained in dex_file as well. Lookup table does not own raw_data or dex_file.
+ static TypeLookupTable* Open(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs);
// Method returns pointer to binary data of lookup table. Used by the oat writer.
const uint8_t* RawData() const {
@@ -71,10 +74,7 @@
}
// Method returns length of binary data. Used by the oat writer.
- uint32_t RawDataLength() const;
-
- // Method returns length of binary data for the specified dex file.
- static uint32_t RawDataLength(const DexFile& dex_file);
+ uint32_t RawDataLength() const { return raw_data_length_; }
// Method returns length of binary data for the specified number of class definitions.
static uint32_t RawDataLength(uint32_t num_class_defs);
@@ -119,10 +119,13 @@
explicit TypeLookupTable(const DexFile& dex_file, uint8_t* storage);
// Construct from a dex file with existing data.
- TypeLookupTable(const uint8_t* raw_data, const DexFile& dex_file);
+ TypeLookupTable(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs);
bool IsStringsEquals(const char* str, uint32_t str_offset) const {
- const uint8_t* ptr = dex_file_.Begin() + str_offset;
+ const uint8_t* ptr = dex_file_begin_ + str_offset;
+ CHECK(dex_file_begin_ != nullptr);
// Skip string length.
DecodeUnsignedLeb128(&ptr);
return CompareModifiedUtf8ToModifiedUtf8AsUtf16CodePointValues(
@@ -154,7 +157,8 @@
// Find the last entry in a chain.
uint32_t FindLastEntryInBucket(uint32_t cur_pos) const;
- const DexFile& dex_file_;
+ const uint8_t* dex_file_begin_;
+ const uint32_t raw_data_length_;
const uint32_t mask_;
std::unique_ptr<Entry[]> entries_;
// owns_entries_ specifies if the lookup table owns the entries_ array.
diff --git a/runtime/utils.cc b/runtime/utils.cc
index 6f10aaa..b52e2f2 100644
--- a/runtime/utils.cc
+++ b/runtime/utils.cc
@@ -52,6 +52,77 @@
namespace art {
+static const uint8_t kBase64Map[256] = {
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 62, 255, 255, 255, 63,
+ 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 255, 255,
+ 255, 254, 255, 255, 255, 0, 1, 2, 3, 4, 5, 6,
+ 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, // NOLINT
+ 19, 20, 21, 22, 23, 24, 25, 255, 255, 255, 255, 255, // NOLINT
+ 255, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
+ 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, // NOLINT
+ 49, 50, 51, 255, 255, 255, 255, 255, 255, 255, 255, 255, // NOLINT
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
+ 255, 255, 255, 255
+};
+
+uint8_t* DecodeBase64(const char* src, size_t* dst_size) {
+ std::vector<uint8_t> tmp;
+ uint32_t t = 0, y = 0;
+ int g = 3;
+ for (size_t i = 0; src[i] != '\0'; ++i) {
+ uint8_t c = kBase64Map[src[i] & 0xFF];
+ if (c == 255) continue;
+ // the final = symbols are read and used to trim the remaining bytes
+ if (c == 254) {
+ c = 0;
+ // prevent g < 0 which would potentially allow an overflow later
+ if (--g < 0) {
+ *dst_size = 0;
+ return nullptr;
+ }
+ } else if (g != 3) {
+ // we only allow = to be at the end
+ *dst_size = 0;
+ return nullptr;
+ }
+ t = (t << 6) | c;
+ if (++y == 4) {
+ tmp.push_back((t >> 16) & 255);
+ if (g > 1) {
+ tmp.push_back((t >> 8) & 255);
+ }
+ if (g > 2) {
+ tmp.push_back(t & 255);
+ }
+ y = t = 0;
+ }
+ }
+ if (y != 0) {
+ *dst_size = 0;
+ return nullptr;
+ }
+ std::unique_ptr<uint8_t[]> dst(new uint8_t[tmp.size()]);
+ if (dst_size != nullptr) {
+ *dst_size = tmp.size();
+ } else {
+ *dst_size = 0;
+ }
+ std::copy(tmp.begin(), tmp.end(), dst.get());
+ return dst.release();
+}
+
pid_t GetTid() {
#if defined(__APPLE__)
uint64_t owner;
diff --git a/runtime/utils.h b/runtime/utils.h
index f3284e8..e65b947 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -116,6 +116,8 @@
return static_cast<typename std::make_unsigned<T>::type>(x);
}
+uint8_t* DecodeBase64(const char* src, size_t* dst_size);
+
std::string PrintableChar(uint16_t ch);
// Returns an ASCII string corresponding to the given UTF-8 string.
diff --git a/runtime/vdex_file.cc b/runtime/vdex_file.cc
index a71578b..9fbf875 100644
--- a/runtime/vdex_file.cc
+++ b/runtime/vdex_file.cc
@@ -34,7 +34,9 @@
return (memcmp(version_, kVdexVersion, sizeof(kVdexVersion)) == 0);
}
-VdexFile::Header::Header() {
+VdexFile::Header::Header(uint32_t dex_size, uint32_t verifier_deps_size)
+ : dex_size_(dex_size),
+ verifier_deps_size_(verifier_deps_size) {
memcpy(magic_, kVdexMagic, sizeof(kVdexMagic));
memcpy(version_, kVdexVersion, sizeof(kVdexVersion));
DCHECK(IsMagicValid());
diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h
index 9215e52..6bea153 100644
--- a/runtime/vdex_file.h
+++ b/runtime/vdex_file.h
@@ -42,17 +42,22 @@
public:
struct Header {
public:
- Header();
+ Header(uint32_t dex_size, uint32_t verifier_deps_size);
bool IsMagicValid() const;
bool IsVersionValid() const;
+ uint32_t GetDexSize() const { return dex_size_; }
+ uint32_t GetVerifierDepsSize() const { return verifier_deps_size_; }
+
private:
static constexpr uint8_t kVdexMagic[] = { 'v', 'd', 'e', 'x' };
static constexpr uint8_t kVdexVersion[] = { '0', '0', '0', '\0' };
uint8_t magic_[4];
uint8_t version_[4];
+ uint32_t dex_size_;
+ uint32_t verifier_deps_size_;
};
static VdexFile* Open(const std::string& vdex_filename,
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index f1d3189..abd741c 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -3284,7 +3284,7 @@
}
break;
// Note: the following instructions encode offsets derived from class linking.
- // As such they use Class*/Field*/AbstractMethod* as these offsets only have
+ // As such they use Class*/Field*/Executable* as these offsets only have
// meaning if the class linking and resolution were successful.
case Instruction::IGET_QUICK:
VerifyQuickFieldAccess<FieldAccessType::kAccGet>(inst, reg_types_.Integer(), true);
diff --git a/runtime/well_known_classes.cc b/runtime/well_known_classes.cc
index 5f5fbc8..16c7f77 100644
--- a/runtime/well_known_classes.cc
+++ b/runtime/well_known_classes.cc
@@ -48,8 +48,8 @@
jclass WellKnownClasses::java_lang_NoClassDefFoundError;
jclass WellKnownClasses::java_lang_Object;
jclass WellKnownClasses::java_lang_OutOfMemoryError;
-jclass WellKnownClasses::java_lang_reflect_AbstractMethod;
jclass WellKnownClasses::java_lang_reflect_Constructor;
+jclass WellKnownClasses::java_lang_reflect_Executable;
jclass WellKnownClasses::java_lang_reflect_Field;
jclass WellKnownClasses::java_lang_reflect_Method;
jclass WellKnownClasses::java_lang_reflect_Proxy;
@@ -154,7 +154,7 @@
jfieldID WellKnownClasses::java_lang_Throwable_stackTrace;
jfieldID WellKnownClasses::java_lang_Throwable_stackState;
jfieldID WellKnownClasses::java_lang_Throwable_suppressedExceptions;
-jfieldID WellKnownClasses::java_lang_reflect_AbstractMethod_artMethod;
+jfieldID WellKnownClasses::java_lang_reflect_Executable_artMethod;
jfieldID WellKnownClasses::java_lang_reflect_Proxy_h;
jfieldID WellKnownClasses::java_nio_DirectByteBuffer_capacity;
jfieldID WellKnownClasses::java_nio_DirectByteBuffer_effectiveDirectAddress;
@@ -237,8 +237,8 @@
java_lang_ExceptionInInitializerError = CacheClass(env, "java/lang/ExceptionInInitializerError");
java_lang_IllegalAccessError = CacheClass(env, "java/lang/IllegalAccessError");
java_lang_NoClassDefFoundError = CacheClass(env, "java/lang/NoClassDefFoundError");
- java_lang_reflect_AbstractMethod = CacheClass(env, "java/lang/reflect/AbstractMethod");
java_lang_reflect_Constructor = CacheClass(env, "java/lang/reflect/Constructor");
+ java_lang_reflect_Executable = CacheClass(env, "java/lang/reflect/Executable");
java_lang_reflect_Field = CacheClass(env, "java/lang/reflect/Field");
java_lang_reflect_Method = CacheClass(env, "java/lang/reflect/Method");
java_lang_reflect_Proxy = CacheClass(env, "java/lang/reflect/Proxy");
@@ -362,7 +362,7 @@
java_lang_Throwable_stackTrace = CacheField(env, java_lang_Throwable, false, "stackTrace", "[Ljava/lang/StackTraceElement;");
java_lang_Throwable_stackState = CacheField(env, java_lang_Throwable, false, "backtrace", "Ljava/lang/Object;");
java_lang_Throwable_suppressedExceptions = CacheField(env, java_lang_Throwable, false, "suppressedExceptions", "Ljava/util/List;");
- java_lang_reflect_AbstractMethod_artMethod = CacheField(env, java_lang_reflect_AbstractMethod, false, "artMethod", "J");
+ java_lang_reflect_Executable_artMethod = CacheField(env, java_lang_reflect_Executable, false, "artMethod", "J");
java_lang_reflect_Proxy_h = CacheField(env, java_lang_reflect_Proxy, false, "h", "Ljava/lang/reflect/InvocationHandler;");
java_nio_DirectByteBuffer_capacity = CacheField(env, java_nio_DirectByteBuffer, false, "capacity", "I");
java_nio_DirectByteBuffer_effectiveDirectAddress = CacheField(env, java_nio_DirectByteBuffer, false, "address", "J");
diff --git a/runtime/well_known_classes.h b/runtime/well_known_classes.h
index ce710ff..b4d179c 100644
--- a/runtime/well_known_classes.h
+++ b/runtime/well_known_classes.h
@@ -59,8 +59,8 @@
static jclass java_lang_NoClassDefFoundError;
static jclass java_lang_Object;
static jclass java_lang_OutOfMemoryError;
- static jclass java_lang_reflect_AbstractMethod;
static jclass java_lang_reflect_Constructor;
+ static jclass java_lang_reflect_Executable;
static jclass java_lang_reflect_Field;
static jclass java_lang_reflect_Method;
static jclass java_lang_reflect_Proxy;
@@ -148,7 +148,7 @@
static jfieldID dalvik_system_DexPathList_dexElements;
static jfieldID dalvik_system_DexPathList__Element_dexFile;
static jfieldID dalvik_system_PathClassLoader_pathList;
- static jfieldID java_lang_reflect_AbstractMethod_artMethod;
+ static jfieldID java_lang_reflect_Executable_artMethod;
static jfieldID java_lang_reflect_Proxy_h;
static jfieldID java_lang_Thread_daemon;
static jfieldID java_lang_Thread_group;
diff --git a/test/003-omnibus-opcodes/build b/test/003-omnibus-opcodes/build
index 56e8784..dba3549 100644
--- a/test/003-omnibus-opcodes/build
+++ b/test/003-omnibus-opcodes/build
@@ -26,6 +26,11 @@
jar cf classes.jill.jar -C classes .
${JACK} --import classes.jill.jar --output-dex .
else
- ${DX} -JXmx256m --debug --dex --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} -JXmx256m --debug --dex --output=classes.dex classes
fi
-zip $TEST_NAME.jar classes.dex
+fi
+
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex
+fi
diff --git a/test/005-annotations/build b/test/005-annotations/build
index a552a6d..8b9f550 100644
--- a/test/005-annotations/build
+++ b/test/005-annotations/build
@@ -33,7 +33,11 @@
# Jack needs to emit annotations with CLASS retention.
${JACK} -D jack.dex.annotation.class-retention=true --import classes.jill.jar --output-dex .
else
- ${DX} -JXmx256m --debug --dex --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} -JXmx256m --debug --dex --output=classes.dex classes
+ fi
fi
-zip $TEST_NAME.jar classes.dex
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex
+fi
diff --git a/test/023-many-interfaces/build b/test/023-many-interfaces/build
index 3bb6747..b4b5bd4 100644
--- a/test/023-many-interfaces/build
+++ b/test/023-many-interfaces/build
@@ -29,6 +29,8 @@
${JAVAC} -d classes src/*.java
# dx needs more memory for that test so do not pass Xmx option here.
- ${DX} --debug --dex --dump-to=classes.lst --output=classes.dex classes
- zip $TEST_NAME.jar classes.dex
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} --debug --dex --dump-to=classes.lst --output=classes.dex classes
+ zip $TEST_NAME.jar classes.dex
+ fi
fi
diff --git a/test/031-class-attributes/src/ClassAttrs.java b/test/031-class-attributes/src/ClassAttrs.java
index 346e13d..39e69a3 100644
--- a/test/031-class-attributes/src/ClassAttrs.java
+++ b/test/031-class-attributes/src/ClassAttrs.java
@@ -1,9 +1,9 @@
import otherpackage.OtherPackageClass;
import java.io.Serializable;
-import java.lang.reflect.AbstractMethod;
import java.lang.reflect.AccessibleObject;
import java.lang.reflect.Constructor;
+import java.lang.reflect.Executable;
import java.lang.reflect.Field;
import java.lang.reflect.InvocationTargetException;
import java.lang.reflect.Method;
@@ -223,7 +223,7 @@
try {
Class<?> c = obj.getClass();
if (c == Method.class || c == Constructor.class) {
- c = AbstractMethod.class;
+ c = Executable.class;
}
method = c.getDeclaredMethod("getSignatureAttribute");
method.setAccessible(true);
diff --git a/test/056-const-string-jumbo/build b/test/056-const-string-jumbo/build
index ae42519..5344ac3 100644
--- a/test/056-const-string-jumbo/build
+++ b/test/056-const-string-jumbo/build
@@ -45,7 +45,11 @@
mkdir classes
${JAVAC} -d classes src/*.java
- ${DX} -JXmx500m --debug --dex --no-optimize --positions=none --no-locals --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} -JXmx500m --debug --dex --no-optimize --positions=none --no-locals --output=classes.dex classes
+ fi
fi
-zip $TEST_NAME.jar classes.dex
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex
+fi
diff --git a/test/111-unresolvable-exception/build b/test/111-unresolvable-exception/build
index 58ac26d..cf19f60 100644
--- a/test/111-unresolvable-exception/build
+++ b/test/111-unresolvable-exception/build
@@ -25,6 +25,11 @@
jar cf classes.jill.jar -C classes .
${JACK} --import classes.jill.jar --output-dex .
else
- ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
+ fi
fi
-zip $TEST_NAME.jar classes.dex
+
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex
+fi
diff --git a/test/113-multidex/build b/test/113-multidex/build
index 4557ccd..b980e50 100644
--- a/test/113-multidex/build
+++ b/test/113-multidex/build
@@ -37,10 +37,15 @@
mv classes.dex classes2.dex
mv classes-1.dex classes.dex
else
- # All except Main
- ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ # All except Main
+ ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
- # Only Main
- ${DX} -JXmx256m --debug --dex --dump-to=classes2.lst --output=classes2.dex classes2
+ # Only Main
+ ${DX} -JXmx256m --debug --dex --dump-to=classes2.lst --output=classes2.dex classes2
+ fi
fi
-zip $TEST_NAME.jar classes.dex classes2.dex
+
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex classes2.dex
+fi
diff --git a/test/115-native-bridge/run b/test/115-native-bridge/run
index fb0b967..9290dd3 100644
--- a/test/115-native-bridge/run
+++ b/test/115-native-bridge/run
@@ -18,6 +18,8 @@
# Use libnativebridgetest as a native bridge, start NativeBridgeMain (Main is JniTest main file).
LIBPATH=$(echo ${ARGS} | sed -r 's/.*Djava.library.path=([^ ]*) .*/\1/')
+# Trim all but the last entry in LIBPATH, which will be nativetest[64]
+LIBPATH=${LIBPATH##*:}
ln -sf ${LIBPATH}/libnativebridgetest.so .
touch libarttest.so
touch libarttestd.so
diff --git a/test/124-missing-classes/build b/test/124-missing-classes/build
index 0a340a2..ea45cd2 100644
--- a/test/124-missing-classes/build
+++ b/test/124-missing-classes/build
@@ -30,6 +30,11 @@
jar cf classes.jill.jar -C classes .
${JACK} --import classes.jill.jar --output-dex .
else
- ${DX} -JXmx256m --debug --dex --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} -JXmx256m --debug --dex --output=classes.dex classes
+ fi
fi
-zip $TEST_NAME.jar classes.dex
+
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex
+fi
diff --git a/test/126-miranda-multidex/build b/test/126-miranda-multidex/build
index 00b9ba0..2a5e7da 100644
--- a/test/126-miranda-multidex/build
+++ b/test/126-miranda-multidex/build
@@ -37,10 +37,15 @@
mv classes.dex classes2.dex
mv classes-1.dex classes.dex
else
- # All except Main
- ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
+ if [ ${NEED_DEX} = "true" ]; then
+ # All except Main
+ ${DX} -JXmx256m --debug --dex --dump-to=classes.lst --output=classes.dex classes
- # Only Main
- ${DX} -JXmx256m --debug --dex --dump-to=classes2.lst --output=classes2.dex classes2
+ # Only Main
+ ${DX} -JXmx256m --debug --dex --dump-to=classes2.lst --output=classes2.dex classes2
+ fi
fi
-zip $TEST_NAME.jar classes.dex classes2.dex
+
+if [ ${NEED_DEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex classes2.dex
+fi
diff --git a/test/128-reg-spilling-on-implicit-nullcheck/expected.txt b/test/128-reg-spill-on-implicit-nullcheck/expected.txt
similarity index 100%
rename from test/128-reg-spilling-on-implicit-nullcheck/expected.txt
rename to test/128-reg-spill-on-implicit-nullcheck/expected.txt
diff --git a/test/128-reg-spilling-on-implicit-nullcheck/info.txt b/test/128-reg-spill-on-implicit-nullcheck/info.txt
similarity index 100%
rename from test/128-reg-spilling-on-implicit-nullcheck/info.txt
rename to test/128-reg-spill-on-implicit-nullcheck/info.txt
diff --git a/test/128-reg-spilling-on-implicit-nullcheck/src/Main.java b/test/128-reg-spill-on-implicit-nullcheck/src/Main.java
similarity index 100%
rename from test/128-reg-spilling-on-implicit-nullcheck/src/Main.java
rename to test/128-reg-spill-on-implicit-nullcheck/src/Main.java
diff --git a/test/130-hprof/src/Main.java b/test/130-hprof/src/Main.java
index c145f27..57be3a7 100644
--- a/test/130-hprof/src/Main.java
+++ b/test/130-hprof/src/Main.java
@@ -125,7 +125,7 @@
private static File getHprofConf() {
// Use the java.library.path. It points to the lib directory.
- File libDir = new File(System.getProperty("java.library.path"));
+ File libDir = new File(System.getProperty("java.library.path").split(":")[0]);
return new File(new File(libDir.getParentFile(), "bin"), "hprof-conv");
}
diff --git a/test/201-built-in-exception-detail-messages/expected.txt b/test/201-built-in-except-detail-messages/expected.txt
similarity index 100%
rename from test/201-built-in-exception-detail-messages/expected.txt
rename to test/201-built-in-except-detail-messages/expected.txt
diff --git a/test/201-built-in-exception-detail-messages/info.txt b/test/201-built-in-except-detail-messages/info.txt
similarity index 100%
rename from test/201-built-in-exception-detail-messages/info.txt
rename to test/201-built-in-except-detail-messages/info.txt
diff --git a/test/201-built-in-exception-detail-messages/src/Main.java b/test/201-built-in-except-detail-messages/src/Main.java
similarity index 100%
rename from test/201-built-in-exception-detail-messages/src/Main.java
rename to test/201-built-in-except-detail-messages/src/Main.java
diff --git a/test/303-verification-stress/build b/test/303-verification-stress/build
index 5ff73ec..b67eaf2 100644
--- a/test/303-verification-stress/build
+++ b/test/303-verification-stress/build
@@ -29,6 +29,8 @@
${JAVAC} -d classes src/*.java
# dx needs more memory for that test so do not pass Xmx option here.
- ${DX} --debug --dex --output=classes.dex classes
- zip $TEST_NAME.jar classes.dex
+ if [ ${NEED_DEX} = "true" ]; then
+ ${DX} --debug --dex --output=classes.dex classes
+ zip $TEST_NAME.jar classes.dex
+ fi
fi
diff --git a/test/458-checker-instruction-simplification/expected.txt b/test/458-checker-instruct-simplification/expected.txt
similarity index 100%
rename from test/458-checker-instruction-simplification/expected.txt
rename to test/458-checker-instruct-simplification/expected.txt
diff --git a/test/458-checker-instruction-simplification/info.txt b/test/458-checker-instruct-simplification/info.txt
similarity index 100%
rename from test/458-checker-instruction-simplification/info.txt
rename to test/458-checker-instruct-simplification/info.txt
diff --git a/test/458-checker-instruction-simplification/smali/SmaliTests.smali b/test/458-checker-instruct-simplification/smali/SmaliTests.smali
similarity index 100%
rename from test/458-checker-instruction-simplification/smali/SmaliTests.smali
rename to test/458-checker-instruct-simplification/smali/SmaliTests.smali
diff --git a/test/458-checker-instruction-simplification/src/Main.java b/test/458-checker-instruct-simplification/src/Main.java
similarity index 98%
rename from test/458-checker-instruction-simplification/src/Main.java
rename to test/458-checker-instruct-simplification/src/Main.java
index 5b14735..e71a0e1 100644
--- a/test/458-checker-instruction-simplification/src/Main.java
+++ b/test/458-checker-instruct-simplification/src/Main.java
@@ -1178,16 +1178,28 @@
* remove the second.
*/
+ /// CHECK-START: boolean Main.$noinline$NotNotBool(boolean) instruction_simplifier (before)
+ /// CHECK-DAG: <<Arg:z\d+>> ParameterValue
+ /// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
+ /// CHECK-DAG: <<Result:z\d+>> InvokeStaticOrDirect
+ /// CHECK-DAG: <<NotResult:i\d+>> Xor [<<Result>>,<<Const1>>]
+ /// CHECK-DAG: Return [<<NotResult>>]
+
+ /// CHECK-START: boolean Main.$noinline$NotNotBool(boolean) instruction_simplifier (after)
+ /// CHECK-DAG: <<Arg:z\d+>> ParameterValue
+ /// CHECK-DAG: <<Result:z\d+>> InvokeStaticOrDirect
+ /// CHECK-DAG: <<NotResult:z\d+>> BooleanNot [<<Result>>]
+ /// CHECK-DAG: Return [<<NotResult>>]
+
/// CHECK-START: boolean Main.$noinline$NotNotBool(boolean) instruction_simplifier$after_bce (before)
/// CHECK-DAG: <<Arg:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
- /// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK-DAG: <<NotArg:i\d+>> Select [<<Const1>>,<<Const0>>,<<Arg>>]
- /// CHECK-DAG: <<NotNotArg:i\d+>> Select [<<Const1>>,<<Const0>>,<<NotArg>>]
+ /// CHECK-DAG: <<NotArg:z\d+>> BooleanNot [<<Arg>>]
+ /// CHECK-DAG: <<NotNotArg:z\d+>> BooleanNot [<<NotArg>>]
/// CHECK-DAG: Return [<<NotNotArg>>]
/// CHECK-START: boolean Main.$noinline$NotNotBool(boolean) instruction_simplifier$after_bce (after)
/// CHECK-DAG: <<Arg:z\d+>> ParameterValue
+ /// CHECK-DAG: <<NotArg:z\d+>> BooleanNot [<<Arg>>]
/// CHECK-DAG: Return [<<Arg>>]
public static boolean NegateValue(boolean arg) {
diff --git a/test/462-checker-inlining-across-dex-files/expected.txt b/test/462-checker-inlining-dex-files/expected.txt
similarity index 100%
rename from test/462-checker-inlining-across-dex-files/expected.txt
rename to test/462-checker-inlining-dex-files/expected.txt
diff --git a/test/462-checker-inlining-across-dex-files/info.txt b/test/462-checker-inlining-dex-files/info.txt
similarity index 100%
rename from test/462-checker-inlining-across-dex-files/info.txt
rename to test/462-checker-inlining-dex-files/info.txt
diff --git a/test/462-checker-inlining-across-dex-files/multidex.jpp b/test/462-checker-inlining-dex-files/multidex.jpp
similarity index 100%
rename from test/462-checker-inlining-across-dex-files/multidex.jpp
rename to test/462-checker-inlining-dex-files/multidex.jpp
diff --git a/test/462-checker-inlining-across-dex-files/src-multidex/OtherDex.java b/test/462-checker-inlining-dex-files/src-multidex/OtherDex.java
similarity index 100%
rename from test/462-checker-inlining-across-dex-files/src-multidex/OtherDex.java
rename to test/462-checker-inlining-dex-files/src-multidex/OtherDex.java
diff --git a/test/462-checker-inlining-across-dex-files/src/Main.java b/test/462-checker-inlining-dex-files/src/Main.java
similarity index 100%
rename from test/462-checker-inlining-across-dex-files/src/Main.java
rename to test/462-checker-inlining-dex-files/src/Main.java
diff --git a/test/463-checker-boolean-simplifier/smali/BooleanNotDx.smali b/test/463-checker-boolean-simplifier/smali/BooleanNotDx.smali
new file mode 100644
index 0000000..765d0eb
--- /dev/null
+++ b/test/463-checker-boolean-simplifier/smali/BooleanNotDx.smali
@@ -0,0 +1,65 @@
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.class public LBooleanNotSmali;
+.super Ljava/lang/Object;
+
+#
+# Elementary test negating a boolean. Verifies that blocks are merged and
+# empty branches removed.
+#
+
+## CHECK-START: boolean BooleanNotSmali.BooleanNot(boolean) select_generator (before)
+## CHECK-DAG: <<Param:z\d+>> ParameterValue
+## CHECK-DAG: <<Const0:i\d+>> IntConstant 0
+## CHECK-DAG: <<Const1:i\d+>> IntConstant 1
+## CHECK-DAG: If [<<Param>>]
+## CHECK-DAG: <<Phi:i\d+>> Phi [<<Const0>>,<<Const1>>]
+## CHECK-DAG: Return [<<Phi>>]
+
+## CHECK-START: boolean BooleanNotSmali.BooleanNot(boolean) select_generator (before)
+## CHECK: Goto
+## CHECK: Goto
+## CHECK: Goto
+## CHECK-NOT: Goto
+
+## CHECK-START: boolean BooleanNotSmali.BooleanNot(boolean) select_generator (after)
+## CHECK-DAG: <<Param:z\d+>> ParameterValue
+## CHECK-DAG: <<Const0:i\d+>> IntConstant 0
+## CHECK-DAG: <<Const1:i\d+>> IntConstant 1
+## CHECK-DAG: <<NotParam:i\d+>> Select [<<Const1>>,<<Const0>>,<<Param>>]
+## CHECK-DAG: Return [<<NotParam>>]
+
+## CHECK-START: boolean BooleanNotSmali.BooleanNot(boolean) select_generator (after)
+## CHECK-NOT: If
+## CHECK-NOT: Phi
+
+## CHECK-START: boolean BooleanNotSmali.BooleanNot(boolean) select_generator (after)
+## CHECK: Goto
+## CHECK-NOT: Goto
+
+.method public static BooleanNot(Z)Z
+ .registers 2
+
+ if-eqz v1, :true_start
+ const/4 v0, 0x0
+
+:return_start
+ return v0
+
+:true_start
+ const/4 v0, 0x1
+ goto :return_start
+
+.end method
diff --git a/test/463-checker-boolean-simplifier/src/Main.java b/test/463-checker-boolean-simplifier/src/Main.java
index f0fe1b1..9368488 100644
--- a/test/463-checker-boolean-simplifier/src/Main.java
+++ b/test/463-checker-boolean-simplifier/src/Main.java
@@ -32,42 +32,14 @@
}
}
- /*
- * Elementary test negating a boolean. Verifies that blocks are merged and
- * empty branches removed.
- */
-
- /// CHECK-START: boolean Main.BooleanNot(boolean) select_generator (before)
- /// CHECK-DAG: <<Param:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
- /// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK-DAG: If [<<Param>>]
- /// CHECK-DAG: <<Phi:i\d+>> Phi [<<Const0>>,<<Const1>>]
- /// CHECK-DAG: Return [<<Phi>>]
-
- /// CHECK-START: boolean Main.BooleanNot(boolean) select_generator (before)
- /// CHECK: Goto
- /// CHECK: Goto
- /// CHECK: Goto
- /// CHECK-NOT: Goto
-
- /// CHECK-START: boolean Main.BooleanNot(boolean) select_generator (after)
- /// CHECK-DAG: <<Param:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
- /// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK-DAG: <<NotParam:i\d+>> Select [<<Const1>>,<<Const0>>,<<Param>>]
- /// CHECK-DAG: Return [<<NotParam>>]
-
- /// CHECK-START: boolean Main.BooleanNot(boolean) select_generator (after)
- /// CHECK-NOT: If
- /// CHECK-NOT: Phi
-
- /// CHECK-START: boolean Main.BooleanNot(boolean) select_generator (after)
- /// CHECK: Goto
- /// CHECK-NOT: Goto
-
- public static boolean BooleanNot(boolean x) {
- return !x;
+ // Invoke a method written in smali that implements the boolean ! operator. This method
+ // uses the if/else pattern generated by dx (while Jack generates a different pattern).
+ // Since this method is in a smali-generated class, we invoke it through reflection.
+ public static boolean SmaliBooleanNot(boolean x) throws Exception {
+ Class<?> c = Class.forName("BooleanNotSmali");
+ java.lang.reflect.Method method = c.getMethod("BooleanNot", boolean.class);
+ Object retValue = method.invoke(null, new Object[] { Boolean.valueOf(x) });
+ return ((Boolean) retValue).booleanValue();
}
/*
@@ -357,9 +329,9 @@
return x ? 42 : (write_field = 43);
}
- public static void main(String[] args) {
- assertBoolEquals(false, BooleanNot(true));
- assertBoolEquals(true, BooleanNot(false));
+ public static void main(String[] args) throws Exception {
+ assertBoolEquals(false, SmaliBooleanNot(true));
+ assertBoolEquals(true, SmaliBooleanNot(false));
assertBoolEquals(true, GreaterThan(10, 5));
assertBoolEquals(false, GreaterThan(10, 10));
assertBoolEquals(false, GreaterThan(5, 10));
diff --git a/test/468-checker-bool-simplifier-regression/expected.txt b/test/468-checker-bool-simplif-regression/expected.txt
similarity index 100%
rename from test/468-checker-bool-simplifier-regression/expected.txt
rename to test/468-checker-bool-simplif-regression/expected.txt
diff --git a/test/468-checker-bool-simplifier-regression/info.txt b/test/468-checker-bool-simplif-regression/info.txt
similarity index 100%
rename from test/468-checker-bool-simplifier-regression/info.txt
rename to test/468-checker-bool-simplif-regression/info.txt
diff --git a/test/468-checker-bool-simplifier-regression/smali/TestCase.smali b/test/468-checker-bool-simplif-regression/smali/TestCase.smali
similarity index 100%
rename from test/468-checker-bool-simplifier-regression/smali/TestCase.smali
rename to test/468-checker-bool-simplif-regression/smali/TestCase.smali
diff --git a/test/468-checker-bool-simplifier-regression/src/Main.java b/test/468-checker-bool-simplif-regression/src/Main.java
similarity index 100%
rename from test/468-checker-bool-simplifier-regression/src/Main.java
rename to test/468-checker-bool-simplif-regression/src/Main.java
diff --git a/test/477-long-to-float-conversion-precision/expected.txt b/test/477-long-2-float-convers-precision/expected.txt
similarity index 100%
rename from test/477-long-to-float-conversion-precision/expected.txt
rename to test/477-long-2-float-convers-precision/expected.txt
diff --git a/test/477-long-to-float-conversion-precision/info.txt b/test/477-long-2-float-convers-precision/info.txt
similarity index 100%
rename from test/477-long-to-float-conversion-precision/info.txt
rename to test/477-long-2-float-convers-precision/info.txt
diff --git a/test/477-long-to-float-conversion-precision/src/Main.java b/test/477-long-2-float-convers-precision/src/Main.java
similarity index 100%
rename from test/477-long-to-float-conversion-precision/src/Main.java
rename to test/477-long-2-float-convers-precision/src/Main.java
diff --git a/test/496-checker-inlining-and-class-loader/expected.txt b/test/496-checker-inlining-class-loader/expected.txt
similarity index 100%
rename from test/496-checker-inlining-and-class-loader/expected.txt
rename to test/496-checker-inlining-class-loader/expected.txt
diff --git a/test/496-checker-inlining-and-class-loader/info.txt b/test/496-checker-inlining-class-loader/info.txt
similarity index 100%
rename from test/496-checker-inlining-and-class-loader/info.txt
rename to test/496-checker-inlining-class-loader/info.txt
diff --git a/test/496-checker-inlining-and-class-loader/src/FirstSeenByMyClassLoader.java b/test/496-checker-inlining-class-loader/src/FirstSeenByMyClassLoader.java
similarity index 100%
rename from test/496-checker-inlining-and-class-loader/src/FirstSeenByMyClassLoader.java
rename to test/496-checker-inlining-class-loader/src/FirstSeenByMyClassLoader.java
diff --git a/test/496-checker-inlining-and-class-loader/src/Main.java b/test/496-checker-inlining-class-loader/src/Main.java
similarity index 100%
rename from test/496-checker-inlining-and-class-loader/src/Main.java
rename to test/496-checker-inlining-class-loader/src/Main.java
diff --git a/test/527-checker-array-access-split/src/Main.java b/test/527-checker-array-access-split/src/Main.java
index 9435ef1..3de900a 100644
--- a/test/527-checker-array-access-split/src/Main.java
+++ b/test/527-checker-array-access-split/src/Main.java
@@ -101,7 +101,7 @@
/// CHECK: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArrayGet [<<Address>>,<<Index>>]
@@ -114,7 +114,7 @@
/// CHECK: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArrayGet [<<Address>>,<<Index>>]
public static int get(int array[], int index) {
@@ -140,7 +140,7 @@
/// CHECK: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address>>,<<Index>>,<<Arg>>]
@@ -159,7 +159,7 @@
/// CHECK: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address>>,<<Index>>,<<Arg>>]
public static void set(int array[], int index, int value) {
@@ -183,10 +183,10 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM64: void Main.getSet(int[], int) GVN$after_arch (after)
@@ -194,7 +194,7 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK-NOT: IntermediateAddress
@@ -214,10 +214,10 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM: void Main.getSet(int[], int) GVN$after_arch (after)
@@ -225,7 +225,7 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK-NOT: IntermediateAddress
@@ -253,11 +253,11 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK: NewArray
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM64: int[] Main.accrossGC(int[], int) GVN$after_arch (after)
@@ -265,11 +265,11 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK: NewArray
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
@@ -287,11 +287,11 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK: NewArray
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM: int[] Main.accrossGC(int[], int) GVN$after_arch (after)
@@ -299,11 +299,11 @@
/// CHECK-DAG: <<DataOffset:i\d+>> IntConstant
/// CHECK: <<Array:l\d+>> NullCheck
/// CHECK: <<Index:i\d+>> BoundsCheck
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK: NewArray
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
public static int[] accrossGC(int array[], int index) {
@@ -343,10 +343,10 @@
/// CHECK: <<Index:i\d+>> Phi
/// CHECK: If
// -------------- Loop
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM64: int Main.canMergeAfterBCE1() GVN$after_arch (after)
@@ -356,7 +356,7 @@
/// CHECK: <<Index:i\d+>> Phi
/// CHECK: If
// -------------- Loop
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK-NOT: IntermediateAddress
@@ -380,10 +380,10 @@
/// CHECK: <<Index:i\d+>> Phi
/// CHECK: If
// -------------- Loop
- /// CHECK: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: <<ArrayGet:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
- /// CHECK: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-NEXT: ArraySet [<<Address2>>,<<Index>>,<<Add>>]
/// CHECK-START-ARM: int Main.canMergeAfterBCE1() GVN$after_arch (after)
@@ -393,7 +393,7 @@
/// CHECK: <<Index:i\d+>> Phi
/// CHECK: If
// -------------- Loop
- /// CHECK: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: <<ArrayGet:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGet>>,<<Const1>>]
/// CHECK-NOT: IntermediateAddress
@@ -437,12 +437,12 @@
/// CHECK: If
// -------------- Loop
/// CHECK-DAG: <<Index1:i\d+>> Add [<<Index>>,<<Const1>>]
- /// CHECK-DAG: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
- /// CHECK-DAG: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI1:i\d+>> ArrayGet [<<Address2>>,<<Index1>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGetI>>,<<ArrayGetI1>>]
- /// CHECK: <<Address3:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address3:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: ArraySet [<<Address3>>,<<Index1>>,<<Add>>]
/// CHECK-START-ARM64: int Main.canMergeAfterBCE2() GVN$after_arch (after)
@@ -453,7 +453,7 @@
/// CHECK: If
// -------------- Loop
/// CHECK-DAG: <<Index1:i\d+>> Add [<<Index>>,<<Const1>>]
- /// CHECK-DAG: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK-DAG: <<ArrayGetI1:i\d+>> ArrayGet [<<Address>>,<<Index1>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGetI>>,<<ArrayGetI1>>]
@@ -486,12 +486,12 @@
/// CHECK: If
// -------------- Loop
/// CHECK-DAG: <<Index1:i\d+>> Add [<<Index>>,<<Const1>>]
- /// CHECK-DAG: <<Address1:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address1:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI:i\d+>> ArrayGet [<<Address1>>,<<Index>>]
- /// CHECK-DAG: <<Address2:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address2:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI1:i\d+>> ArrayGet [<<Address2>>,<<Index1>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGetI>>,<<ArrayGetI1>>]
- /// CHECK: <<Address3:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK: <<Address3:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK: ArraySet [<<Address3>>,<<Index1>>,<<Add>>]
/// CHECK-START-ARM: int Main.canMergeAfterBCE2() GVN$after_arch (after)
@@ -502,7 +502,7 @@
/// CHECK: If
// -------------- Loop
/// CHECK-DAG: <<Index1:i\d+>> Add [<<Index>>,<<Const1>>]
- /// CHECK-DAG: <<Address:l\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
+ /// CHECK-DAG: <<Address:i\d+>> IntermediateAddress [<<Array>>,<<DataOffset>>]
/// CHECK-DAG: <<ArrayGetI:i\d+>> ArrayGet [<<Address>>,<<Index>>]
/// CHECK-DAG: <<ArrayGetI1:i\d+>> ArrayGet [<<Address>>,<<Index1>>]
/// CHECK: <<Add:i\d+>> Add [<<ArrayGetI>>,<<ArrayGetI1>>]
diff --git a/test/530-checker-regression-reftype-final/expected.txt b/test/530-checker-regression-reftyp-final/expected.txt
similarity index 100%
rename from test/530-checker-regression-reftype-final/expected.txt
rename to test/530-checker-regression-reftyp-final/expected.txt
diff --git a/test/530-checker-regression-reftype-final/info.txt b/test/530-checker-regression-reftyp-final/info.txt
similarity index 100%
rename from test/530-checker-regression-reftype-final/info.txt
rename to test/530-checker-regression-reftyp-final/info.txt
diff --git a/test/530-checker-regression-reftype-final/smali/TestCase.smali b/test/530-checker-regression-reftyp-final/smali/TestCase.smali
similarity index 100%
rename from test/530-checker-regression-reftype-final/smali/TestCase.smali
rename to test/530-checker-regression-reftyp-final/smali/TestCase.smali
diff --git a/test/530-checker-regression-reftype-final/src/Main.java b/test/530-checker-regression-reftyp-final/src/Main.java
similarity index 100%
rename from test/530-checker-regression-reftype-final/src/Main.java
rename to test/530-checker-regression-reftyp-final/src/Main.java
diff --git a/test/538-checker-embed-constants/src/Main.java b/test/538-checker-embed-constants/src/Main.java
index 04a12fa..02c609e 100644
--- a/test/538-checker-embed-constants/src/Main.java
+++ b/test/538-checker-embed-constants/src/Main.java
@@ -37,7 +37,7 @@
}
/// CHECK-START-ARM: int Main.and511(int) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK: and{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
public static int and511(int arg) {
@@ -61,7 +61,7 @@
}
/// CHECK-START-ARM: int Main.or511(int) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK: orr{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
public static int or511(int arg) {
@@ -85,7 +85,7 @@
}
/// CHECK-START-ARM: int Main.xor511(int) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
public static int xor511(int arg) {
@@ -114,7 +114,7 @@
}
/// CHECK-START-ARM: long Main.and511(long) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK-NEXT: movs {{r\d+}}, #0
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
@@ -166,7 +166,7 @@
}
/// CHECK-START-ARM: long Main.or511(long) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK-NEXT: movs {{r\d+}}, #0
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
@@ -217,7 +217,7 @@
}
/// CHECK-START-ARM: long Main.xor511(long) disassembly (after)
- /// CHECK: movw {{r\d+}}, #511
+ /// CHECK: mov {{r\d+}}, #511
/// CHECK-NEXT: movs {{r\d+}}, #0
/// CHECK-NOT: eor{{(\.w)?}}
/// CHECK: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -230,7 +230,7 @@
/// CHECK-START-ARM: long Main.xorNot15(long) disassembly (after)
/// CHECK-DAG: mvn {{r\d+}}, #15
- /// CHECK-DAG: mov.w {{r\d+}}, #-1
+ /// CHECK-DAG: mov {{r\d+}}, #4294967295
/// CHECK-NOT: eor{{(\.w)?}}
/// CHECK-DAG: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
/// CHECK-DAG: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -258,7 +258,7 @@
/// CHECK-NOT: mov.w {{r\d+}}, #-268435456
/// CHECK-NOT: eor{{(\.w)?}}
/// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #15
- /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #-268435456
+ /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #4026531840
/// CHECK-NOT: eor{{(\.w)?}}
public static long xor0xf00000000000000f(long arg) {
@@ -285,7 +285,7 @@
/// CHECK-START-ARM: long Main.shl2(long) disassembly (after)
/// CHECK: lsl{{s?|\.w}} <<oh:r\d+>>, {{r\d+}}, #2
- /// CHECK: orr.w <<oh>>, <<oh>>, <<low:r\d+>>, lsr #30
+ /// CHECK: orr <<oh>>, <<low:r\d+>>, lsr #30
/// CHECK: lsl{{s?|\.w}} {{r\d+}}, <<low>>, #2
/// CHECK-START-ARM: long Main.shl2(long) disassembly (after)
@@ -297,7 +297,7 @@
/// CHECK-START-ARM: long Main.shl31(long) disassembly (after)
/// CHECK: lsl{{s?|\.w}} <<oh:r\d+>>, {{r\d+}}, #31
- /// CHECK: orr.w <<oh>>, <<oh>>, <<low:r\d+>>, lsr #1
+ /// CHECK: orr <<oh>>, <<low:r\d+>>, lsr #1
/// CHECK: lsl{{s?|\.w}} {{r\d+}}, <<low>>, #31
/// CHECK-START-ARM: long Main.shl31(long) disassembly (after)
@@ -342,7 +342,7 @@
/// CHECK-START-ARM: long Main.shr1(long) disassembly (after)
/// CHECK: asrs{{(\.w)?}} {{r\d+}}, {{r\d+}}, #1
- /// CHECK: mov.w {{r\d+}}, {{r\d+}}, rrx
+ /// CHECK: rrx {{r\d+}}, {{r\d+}}
/// CHECK-START-ARM: long Main.shr1(long) disassembly (after)
/// CHECK-NOT: asr{{s?|\.w}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -353,7 +353,7 @@
/// CHECK-START-ARM: long Main.shr2(long) disassembly (after)
/// CHECK: lsr{{s?|\.w}} <<ol:r\d+>>, {{r\d+}}, #2
- /// CHECK: orr.w <<ol>>, <<ol>>, <<high:r\d+>>, lsl #30
+ /// CHECK: orr <<ol>>, <<high:r\d+>>, lsl #30
/// CHECK-DAG: asr{{s?|\.w}} {{r\d+}}, <<high>>, #2
/// CHECK-START-ARM: long Main.shr2(long) disassembly (after)
@@ -365,7 +365,7 @@
/// CHECK-START-ARM: long Main.shr31(long) disassembly (after)
/// CHECK: lsr{{s?|\.w}} <<ol:r\d+>>, {{r\d+}}, #31
- /// CHECK: orr.w <<ol>>, <<ol>>, <<high:r\d+>>, lsl #1
+ /// CHECK: orr <<ol>>, <<high:r\d+>>, lsl #1
/// CHECK: asr{{s?|\.w}} {{r\d+}}, <<high>>, #31
/// CHECK-START-ARM: long Main.shr31(long) disassembly (after)
@@ -411,7 +411,7 @@
/// CHECK-START-ARM: long Main.ushr1(long) disassembly (after)
/// CHECK: lsrs{{|.w}} {{r\d+}}, {{r\d+}}, #1
- /// CHECK: mov.w {{r\d+}}, {{r\d+}}, rrx
+ /// CHECK: rrx {{r\d+}}, {{r\d+}}
/// CHECK-START-ARM: long Main.ushr1(long) disassembly (after)
/// CHECK-NOT: lsr{{s?|\.w}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -422,7 +422,7 @@
/// CHECK-START-ARM: long Main.ushr2(long) disassembly (after)
/// CHECK: lsr{{s?|\.w}} <<ol:r\d+>>, {{r\d+}}, #2
- /// CHECK: orr.w <<ol>>, <<ol>>, <<high:r\d+>>, lsl #30
+ /// CHECK: orr <<ol>>, <<high:r\d+>>, lsl #30
/// CHECK-DAG: lsr{{s?|\.w}} {{r\d+}}, <<high>>, #2
/// CHECK-START-ARM: long Main.ushr2(long) disassembly (after)
@@ -434,7 +434,7 @@
/// CHECK-START-ARM: long Main.ushr31(long) disassembly (after)
/// CHECK: lsr{{s?|\.w}} <<ol:r\d+>>, {{r\d+}}, #31
- /// CHECK: orr.w <<ol>>, <<ol>>, <<high:r\d+>>, lsl #1
+ /// CHECK: orr <<ol>>, <<high:r\d+>>, lsl #1
/// CHECK: lsr{{s?|\.w}} {{r\d+}}, <<high>>, #31
/// CHECK-START-ARM: long Main.ushr31(long) disassembly (after)
@@ -508,10 +508,10 @@
/// CHECK: <<ConstM1:j\d+>> LongConstant -1
/// CHECK: Add [<<Arg>>,<<ConstM1>>]
/// CHECK-NEXT: subs r{{\d+}}, #1
- /// CHECK-NEXT: adc r{{\d+}}, r{{\d+}}, #-1
+ /// CHECK-NEXT: adc r{{\d+}}, r{{\d+}}, #4294967295
/// CHECK: Sub [<<Arg>>,<<ConstM1>>]
/// CHECK-NEXT: adds r{{\d+}}, #1
- /// CHECK-NEXT: adc r{{\d+}}, r{{\d+}}, #0
+ /// CHECK-NEXT: adc r{{\d+}}, #0
public static long addM1(long arg) {
return (arg + (-1)) | (arg - (-1));
@@ -542,10 +542,10 @@
/// CHECK-NEXT: sbc r{{\d+}}, r{{\d+}}, #249561088
/// CHECK: Add [<<Arg>>,<<ConstD>>]
// There may or may not be a MOV here.
- /// CHECK: addw r{{\d+}}, r{{\d+}}, #4095
+ /// CHECK: add r{{\d+}}, r{{\d+}}, #4095
/// CHECK: Add [<<Arg>>,<<ConstE>>]
// There may or may not be a MOV here.
- /// CHECK: subw r{{\d+}}, r{{\d+}}, #2051
+ /// CHECK: sub r{{\d+}}, r{{\d+}}, #2051
/// CHECK: Add [<<Arg>>,<<ConstF>>]
/// CHECK-NEXT: adds{{(\.w)?}} r{{\d+}}, r{{\d+}}, r{{\d+}}
/// CHECK-NEXT: adc{{(\.w)?}} r{{\d+}}, r{{\d+}}, r{{\d+}}
@@ -597,10 +597,10 @@
/// CHECK-NEXT: adc r{{\d+}}, r{{\d+}}, #249561088
/// CHECK: Sub [<<Arg>>,<<ConstD>>]
// There may or may not be a MOV here.
- /// CHECK: subw r{{\d+}}, r{{\d+}}, #4095
+ /// CHECK: sub r{{\d+}}, r{{\d+}}, #4095
/// CHECK: Sub [<<Arg>>,<<ConstE>>]
// There may or may not be a MOV here.
- /// CHECK: addw r{{\d+}}, r{{\d+}}, #2051
+ /// CHECK: add r{{\d+}}, r{{\d+}}, #2051
/// CHECK: Sub [<<Arg>>,<<ConstF>>]
/// CHECK-NEXT: subs{{(\.w)?}} r{{\d+}}, r{{\d+}}, r{{\d+}}
/// CHECK-NEXT: sbc{{(\.w)?}} r{{\d+}}, r{{\d+}}, r{{\d+}}
diff --git a/test/547-regression-trycatch-critical-edge/expected.txt b/test/547-regression-trycatch-critic-edge/expected.txt
similarity index 100%
rename from test/547-regression-trycatch-critical-edge/expected.txt
rename to test/547-regression-trycatch-critic-edge/expected.txt
diff --git a/test/547-regression-trycatch-critical-edge/info.txt b/test/547-regression-trycatch-critic-edge/info.txt
similarity index 100%
rename from test/547-regression-trycatch-critical-edge/info.txt
rename to test/547-regression-trycatch-critic-edge/info.txt
diff --git a/test/547-regression-trycatch-critical-edge/smali/TestCase.smali b/test/547-regression-trycatch-critic-edge/smali/TestCase.smali
similarity index 100%
rename from test/547-regression-trycatch-critical-edge/smali/TestCase.smali
rename to test/547-regression-trycatch-critic-edge/smali/TestCase.smali
diff --git a/test/547-regression-trycatch-critical-edge/src/Main.java b/test/547-regression-trycatch-critic-edge/src/Main.java
similarity index 100%
rename from test/547-regression-trycatch-critical-edge/src/Main.java
rename to test/547-regression-trycatch-critic-edge/src/Main.java
diff --git a/test/557-checker-instruction-simplifier-ror/expected.txt b/test/557-checker-instruct-simplifier-ror/expected.txt
similarity index 100%
rename from test/557-checker-instruction-simplifier-ror/expected.txt
rename to test/557-checker-instruct-simplifier-ror/expected.txt
diff --git a/test/557-checker-instruction-simplifier-ror/info.txt b/test/557-checker-instruct-simplifier-ror/info.txt
similarity index 100%
rename from test/557-checker-instruction-simplifier-ror/info.txt
rename to test/557-checker-instruct-simplifier-ror/info.txt
diff --git a/test/557-checker-instruction-simplifier-ror/src/Main.java b/test/557-checker-instruct-simplifier-ror/src/Main.java
similarity index 100%
rename from test/557-checker-instruction-simplifier-ror/src/Main.java
rename to test/557-checker-instruct-simplifier-ror/src/Main.java
diff --git a/test/564-checker-negbitwise/src/Main.java b/test/564-checker-negbitwise/src/Main.java
index ccb8ff4..a047d21 100644
--- a/test/564-checker-negbitwise/src/Main.java
+++ b/test/564-checker-negbitwise/src/Main.java
@@ -74,7 +74,7 @@
/// CHECK-NOT: And
/// CHECK-START-ARM: int Main.$opt$noinline$notAnd(int, int) disassembly (after)
- /// CHECK: bic.w r{{\d+}}, r{{\d+}}, r{{\d+}}
+ /// CHECK: bic r{{\d+}}, r{{\d+}}, r{{\d+}}
public static int $opt$noinline$notAnd(int base, int mask) {
if (doThrow) throw new Error();
@@ -124,7 +124,7 @@
/// CHECK-NOT: Or
/// CHECK-START-ARM: long Main.$opt$noinline$notOr(long, long) disassembly (after)
- /// CHECK: orn.w r{{\d+}}, r{{\d+}}, r{{\d+}}
+ /// CHECK: orn r{{\d+}}, r{{\d+}}, r{{\d+}}
public static long $opt$noinline$notOr(long base, long mask) {
if (doThrow) throw new Error();
diff --git a/test/565-checker-doublenegbitwise/src/Main.java b/test/565-checker-doublenegbitwise/src/Main.java
index 811c280..5ccc648 100644
--- a/test/565-checker-doublenegbitwise/src/Main.java
+++ b/test/565-checker-doublenegbitwise/src/Main.java
@@ -70,20 +70,19 @@
* same pass.
*/
- /// CHECK-START: boolean Main.$opt$noinline$booleanAndToOr(boolean, boolean) instruction_simplifier$after_bce (before)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanAndToOr(boolean, boolean) instruction_simplifier (before)
/// CHECK: <<P1:z\d+>> ParameterValue
/// CHECK: <<P2:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
/// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK: <<Select1:i\d+>> Select [<<Const1>>,<<Const0>>,<<P1>>]
- /// CHECK: <<Select2:i\d+>> Select [<<Const1>>,<<Const0>>,<<P2>>]
- /// CHECK: <<And:i\d+>> And [<<Select2>>,<<Select1>>]
+ /// CHECK-DAG: <<NotP1:i\d+>> Xor [<<P1>>,<<Const1>>]
+ /// CHECK-DAG: <<NotP2:i\d+>> Xor [<<P2>>,<<Const1>>]
+ /// CHECK: <<And:i\d+>> And [<<NotP1>>,<<NotP2>>]
/// CHECK: Return [<<And>>]
- /// CHECK-START: boolean Main.$opt$noinline$booleanAndToOr(boolean, boolean) instruction_simplifier$after_bce (after)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanAndToOr(boolean, boolean) instruction_simplifier (after)
/// CHECK: <<Cond1:z\d+>> ParameterValue
/// CHECK: <<Cond2:z\d+>> ParameterValue
- /// CHECK: <<Or:i\d+>> Or [<<Cond2>>,<<Cond1>>]
+ /// CHECK: <<Or:i\d+>> Or [<<Cond1>>,<<Cond2>>]
/// CHECK: <<BooleanNot:z\d+>> BooleanNot [<<Or>>]
/// CHECK: Return [<<BooleanNot>>]
@@ -138,20 +137,19 @@
* same pass.
*/
- /// CHECK-START: boolean Main.$opt$noinline$booleanOrToAnd(boolean, boolean) instruction_simplifier$after_bce (before)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanOrToAnd(boolean, boolean) instruction_simplifier (before)
/// CHECK: <<P1:z\d+>> ParameterValue
/// CHECK: <<P2:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
/// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK: <<Select1:i\d+>> Select [<<Const1>>,<<Const0>>,<<P1>>]
- /// CHECK: <<Select2:i\d+>> Select [<<Const1>>,<<Const0>>,<<P2>>]
- /// CHECK: <<Or:i\d+>> Or [<<Select2>>,<<Select1>>]
+ /// CHECK: <<NotP1:i\d+>> Xor [<<P1>>,<<Const1>>]
+ /// CHECK: <<NotP2:i\d+>> Xor [<<P2>>,<<Const1>>]
+ /// CHECK: <<Or:i\d+>> Or [<<NotP1>>,<<NotP2>>]
/// CHECK: Return [<<Or>>]
- /// CHECK-START: boolean Main.$opt$noinline$booleanOrToAnd(boolean, boolean) instruction_simplifier$after_bce (after)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanOrToAnd(boolean, boolean) instruction_simplifier (after)
/// CHECK: <<Cond1:z\d+>> ParameterValue
/// CHECK: <<Cond2:z\d+>> ParameterValue
- /// CHECK: <<And:i\d+>> And [<<Cond2>>,<<Cond1>>]
+ /// CHECK: <<And:i\d+>> And [<<Cond1>>,<<Cond2>>]
/// CHECK: <<BooleanNot:z\d+>> BooleanNot [<<And>>]
/// CHECK: Return [<<BooleanNot>>]
@@ -246,20 +244,19 @@
* same pass.
*/
- /// CHECK-START: boolean Main.$opt$noinline$booleanNotXorToXor(boolean, boolean) instruction_simplifier$after_bce (before)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanNotXorToXor(boolean, boolean) instruction_simplifier (before)
/// CHECK: <<P1:z\d+>> ParameterValue
/// CHECK: <<P2:z\d+>> ParameterValue
- /// CHECK-DAG: <<Const0:i\d+>> IntConstant 0
/// CHECK-DAG: <<Const1:i\d+>> IntConstant 1
- /// CHECK: <<Select1:i\d+>> Select [<<Const1>>,<<Const0>>,<<P1>>]
- /// CHECK: <<Select2:i\d+>> Select [<<Const1>>,<<Const0>>,<<P2>>]
- /// CHECK: <<Xor:i\d+>> Xor [<<Select2>>,<<Select1>>]
+ /// CHECK: <<NotP1:i\d+>> Xor [<<P1>>,<<Const1>>]
+ /// CHECK: <<NotP2:i\d+>> Xor [<<P2>>,<<Const1>>]
+ /// CHECK: <<Xor:i\d+>> Xor [<<NotP1>>,<<NotP2>>]
/// CHECK: Return [<<Xor>>]
- /// CHECK-START: boolean Main.$opt$noinline$booleanNotXorToXor(boolean, boolean) instruction_simplifier$after_bce (after)
+ /// CHECK-START: boolean Main.$opt$noinline$booleanNotXorToXor(boolean, boolean) instruction_simplifier (after)
/// CHECK: <<Cond1:z\d+>> ParameterValue
/// CHECK: <<Cond2:z\d+>> ParameterValue
- /// CHECK: <<Xor:i\d+>> Xor [<<Cond2>>,<<Cond1>>]
+ /// CHECK: <<Xor:i\d+>> Xor [<<Cond1>>,<<Cond2>>]
/// CHECK: Return [<<Xor>>]
/// CHECK-START: boolean Main.$opt$noinline$booleanNotXorToXor(boolean, boolean) instruction_simplifier$after_bce (after)
diff --git a/test/580-checker-string-factory-intrinsics/expected.txt b/test/580-checker-string-fact-intrinsics/expected.txt
similarity index 100%
rename from test/580-checker-string-factory-intrinsics/expected.txt
rename to test/580-checker-string-fact-intrinsics/expected.txt
diff --git a/test/580-checker-string-factory-intrinsics/info.txt b/test/580-checker-string-fact-intrinsics/info.txt
similarity index 100%
rename from test/580-checker-string-factory-intrinsics/info.txt
rename to test/580-checker-string-fact-intrinsics/info.txt
diff --git a/test/580-checker-string-factory-intrinsics/src/Main.java b/test/580-checker-string-fact-intrinsics/src/Main.java
similarity index 100%
rename from test/580-checker-string-factory-intrinsics/src/Main.java
rename to test/580-checker-string-fact-intrinsics/src/Main.java
diff --git a/test/588-checker-irreducible-lifetime-hole/expected.txt b/test/588-checker-irreducib-lifetime-hole/expected.txt
similarity index 100%
rename from test/588-checker-irreducible-lifetime-hole/expected.txt
rename to test/588-checker-irreducib-lifetime-hole/expected.txt
diff --git a/test/588-checker-irreducible-lifetime-hole/info.txt b/test/588-checker-irreducib-lifetime-hole/info.txt
similarity index 100%
rename from test/588-checker-irreducible-lifetime-hole/info.txt
rename to test/588-checker-irreducib-lifetime-hole/info.txt
diff --git a/test/588-checker-irreducible-lifetime-hole/smali/IrreducibleLoop.smali b/test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali
similarity index 100%
rename from test/588-checker-irreducible-lifetime-hole/smali/IrreducibleLoop.smali
rename to test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali
diff --git a/test/588-checker-irreducible-lifetime-hole/src/Main.java b/test/588-checker-irreducib-lifetime-hole/src/Main.java
similarity index 100%
rename from test/588-checker-irreducible-lifetime-hole/src/Main.java
rename to test/588-checker-irreducib-lifetime-hole/src/Main.java
diff --git a/test/590-checker-array-set-null-regression/expected.txt b/test/590-checker-arr-set-null-regression/expected.txt
similarity index 100%
rename from test/590-checker-array-set-null-regression/expected.txt
rename to test/590-checker-arr-set-null-regression/expected.txt
diff --git a/test/590-checker-array-set-null-regression/info.txt b/test/590-checker-arr-set-null-regression/info.txt
similarity index 100%
rename from test/590-checker-array-set-null-regression/info.txt
rename to test/590-checker-arr-set-null-regression/info.txt
diff --git a/test/590-checker-array-set-null-regression/src/Main.java b/test/590-checker-arr-set-null-regression/src/Main.java
similarity index 100%
rename from test/590-checker-array-set-null-regression/src/Main.java
rename to test/590-checker-arr-set-null-regression/src/Main.java
diff --git a/test/593-checker-boolean-to-integral-conv/expected.txt b/test/593-checker-boolean-2-integral-conv/expected.txt
similarity index 100%
rename from test/593-checker-boolean-to-integral-conv/expected.txt
rename to test/593-checker-boolean-2-integral-conv/expected.txt
diff --git a/test/593-checker-boolean-to-integral-conv/info.txt b/test/593-checker-boolean-2-integral-conv/info.txt
similarity index 100%
rename from test/593-checker-boolean-to-integral-conv/info.txt
rename to test/593-checker-boolean-2-integral-conv/info.txt
diff --git a/test/593-checker-boolean-to-integral-conv/src/Main.java b/test/593-checker-boolean-2-integral-conv/src/Main.java
similarity index 100%
rename from test/593-checker-boolean-to-integral-conv/src/Main.java
rename to test/593-checker-boolean-2-integral-conv/src/Main.java
diff --git a/test/593-checker-long-to-float-regression/expected.txt b/test/593-checker-long-2-float-regression/expected.txt
similarity index 100%
rename from test/593-checker-long-to-float-regression/expected.txt
rename to test/593-checker-long-2-float-regression/expected.txt
diff --git a/test/593-checker-long-to-float-regression/info.txt b/test/593-checker-long-2-float-regression/info.txt
similarity index 100%
rename from test/593-checker-long-to-float-regression/info.txt
rename to test/593-checker-long-2-float-regression/info.txt
diff --git a/test/593-checker-long-to-float-regression/src/Main.java b/test/593-checker-long-2-float-regression/src/Main.java
similarity index 100%
rename from test/593-checker-long-to-float-regression/src/Main.java
rename to test/593-checker-long-2-float-regression/src/Main.java
diff --git a/tools/javafuzz/Android.mk b/test/902-hello-transformation/build
old mode 100644
new mode 100755
similarity index 62%
copy from tools/javafuzz/Android.mk
copy to test/902-hello-transformation/build
index 63db57a..898e2e5
--- a/tools/javafuzz/Android.mk
+++ b/test/902-hello-transformation/build
@@ -1,4 +1,6 @@
-# Copyright (C) 2016 The Android Open Source Project
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
@@ -12,14 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# Java fuzzer tool.
-
-LOCAL_PATH:= $(call my-dir)
-
-include $(CLEAR_VARS)
-LOCAL_CPP_EXTENSION := cc
-LOCAL_SRC_FILES := javafuzz.cc
-LOCAL_CFLAGS += -O0 -g -Wall
-LOCAL_MODULE_HOST_OS := darwin linux windows
-LOCAL_MODULE := javafuzz
-include $(BUILD_HOST_EXECUTABLE)
+./default-build "$@" --experimental agents
diff --git a/test/902-hello-transformation/expected.txt b/test/902-hello-transformation/expected.txt
new file mode 100644
index 0000000..e86e814
--- /dev/null
+++ b/test/902-hello-transformation/expected.txt
@@ -0,0 +1,3 @@
+Hello
+modifying class 'Transform'
+Goodbye
diff --git a/test/902-hello-transformation/info.txt b/test/902-hello-transformation/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/902-hello-transformation/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/902-hello-transformation/run b/test/902-hello-transformation/run
new file mode 100755
index 0000000..204e4cc
--- /dev/null
+++ b/test/902-hello-transformation/run
@@ -0,0 +1,43 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+plugin=libopenjdkjvmtid.so
+agent=libtiagentd.so
+lib=tiagentd
+if [[ "$@" == *"-O"* ]]; then
+ agent=libtiagent.so
+ plugin=libopenjdkjvmti.so
+ lib=tiagent
+fi
+
+if [[ "$@" == *"--jvm"* ]]; then
+ arg="jvm"
+else
+ arg="art"
+fi
+
+if [[ "$@" != *"--debuggable"* ]]; then
+ other_args=" -Xcompiler-option --debuggable "
+else
+ other_args=""
+fi
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --runtime-option -agentpath:${agent}=902-hello-transformation,${arg} \
+ --android-runtime-option -Xplugin:${plugin} \
+ ${other_args} \
+ --args ${lib}
diff --git a/runtime/native/java_lang_reflect_AbstractMethod.h b/test/902-hello-transformation/src/Main.java
similarity index 63%
copy from runtime/native/java_lang_reflect_AbstractMethod.h
copy to test/902-hello-transformation/src/Main.java
index 222e5a0..204b6e7 100644
--- a/runtime/native/java_lang_reflect_AbstractMethod.h
+++ b/test/902-hello-transformation/src/Main.java
@@ -14,15 +14,18 @@
* limitations under the License.
*/
-#ifndef ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
-#define ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+public class Main {
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform());
+ }
-#include <jni.h>
+ public static void doTest(Transform t) {
+ t.sayHi();
+ doClassTransformation(Transform.class);
+ t.sayHi();
+ }
-namespace art {
-
-void register_java_lang_reflect_AbstractMethod(JNIEnv* env);
-
-} // namespace art
-
-#endif // ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+ // Transforms the class
+ private static native void doClassTransformation(Class target);
+}
diff --git a/runtime/native/java_lang_reflect_AbstractMethod.h b/test/902-hello-transformation/src/Transform.java
similarity index 65%
copy from runtime/native/java_lang_reflect_AbstractMethod.h
copy to test/902-hello-transformation/src/Transform.java
index 222e5a0..dc0a0c4 100644
--- a/runtime/native/java_lang_reflect_AbstractMethod.h
+++ b/test/902-hello-transformation/src/Transform.java
@@ -14,15 +14,8 @@
* limitations under the License.
*/
-#ifndef ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
-#define ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
-
-#include <jni.h>
-
-namespace art {
-
-void register_java_lang_reflect_AbstractMethod(JNIEnv* env);
-
-} // namespace art
-
-#endif // ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+class Transform {
+ public void sayHi() {
+ System.out.println("Hello");
+ }
+}
diff --git a/test/902-hello-transformation/transform.cc b/test/902-hello-transformation/transform.cc
new file mode 100644
index 0000000..e0d623e
--- /dev/null
+++ b/test/902-hello-transformation/transform.cc
@@ -0,0 +1,154 @@
+/*
+ * Copyright (C) 2013 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <iostream>
+#include <pthread.h>
+#include <stdio.h>
+#include <vector>
+
+#include "art_method-inl.h"
+#include "base/logging.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "utils.h"
+
+namespace art {
+namespace Test902HelloTransformation {
+
+static bool RuntimeIsJvm = false;
+
+jvmtiEnv* jvmti_env;
+bool IsJVM() {
+ return RuntimeIsJvm;
+}
+
+// base64 encoded class/dex file for
+//
+// class Transform {
+// public void sayHi() {
+// System.out.println("Goodbye");
+// }
+// }
+const char* class_file_base64 =
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB"
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA"
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq"
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph"
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG"
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB"
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=";
+
+const char* dex_file_base64 =
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO"
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB"
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA"
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA"
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA"
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA"
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50"
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh"
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291"
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA"
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA"
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA"
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=";
+
+static void JNICALL transformationHook(jvmtiEnv *jvmtienv,
+ JNIEnv* jni_env ATTRIBUTE_UNUSED,
+ jclass class_being_redefined ATTRIBUTE_UNUSED,
+ jobject loader ATTRIBUTE_UNUSED,
+ const char* name,
+ jobject protection_domain ATTRIBUTE_UNUSED,
+ jint class_data_len ATTRIBUTE_UNUSED,
+ const unsigned char* class_data ATTRIBUTE_UNUSED,
+ jint* new_class_data_len,
+ unsigned char** new_class_data) {
+ if (strcmp("Transform", name)) {
+ return;
+ }
+ printf("modifying class '%s'\n", name);
+ bool is_jvm = IsJVM();
+ size_t decode_len = 0;
+ unsigned char* new_data;
+ std::unique_ptr<uint8_t[]> file_data(
+ DecodeBase64((is_jvm) ? class_file_base64 : dex_file_base64, &decode_len));
+ jvmtiError ret = JVMTI_ERROR_NONE;
+ if ((ret = jvmtienv->Allocate(static_cast<jlong>(decode_len), &new_data)) != JVMTI_ERROR_NONE) {
+ printf("Unable to allocate buffer!\n");
+ return;
+ }
+ memcpy(new_data, file_data.get(), decode_len);
+ *new_class_data_len = static_cast<jint>(decode_len);
+ *new_class_data = new_data;
+ return;
+}
+
+using RetransformWithHookFunction = jvmtiError (*)(jvmtiEnv*, jclass, jvmtiEventClassFileLoadHook);
+static void DoClassTransformation(jvmtiEnv* jvmtienv, JNIEnv* jnienv, jclass target) {
+ if (IsJVM()) {
+ UNUSED(jnienv);
+ jvmtienv->SetEventNotificationMode(JVMTI_ENABLE, JVMTI_EVENT_CLASS_FILE_LOAD_HOOK, nullptr);
+ jvmtiError ret = jvmtienv->RetransformClasses(1, &target);
+ if (ret != JVMTI_ERROR_NONE) {
+ char* err;
+ jvmtienv->GetErrorName(ret, &err);
+ printf("Error transforming: %s\n", err);
+ }
+ } else {
+ RetransformWithHookFunction f =
+ reinterpret_cast<RetransformWithHookFunction>(jvmtienv->functions->reserved1);
+ if (f(jvmtienv, target, transformationHook) != JVMTI_ERROR_NONE) {
+ printf("Failed to tranform class!");
+ return;
+ }
+ }
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_doClassTransformation(JNIEnv* env,
+ jclass,
+ jclass target) {
+ JavaVM* vm;
+ if (env->GetJavaVM(&vm)) {
+ printf("Unable to get javaVM!\n");
+ return;
+ }
+ DoClassTransformation(jvmti_env, env, target);
+}
+
+// Don't do anything
+jint OnLoad(JavaVM* vm,
+ char* options,
+ void* reserved ATTRIBUTE_UNUSED) {
+ jvmtiCapabilities caps;
+ RuntimeIsJvm = (strcmp("jvm", options) == 0);
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ if (IsJVM()) {
+ jvmti_env->GetPotentialCapabilities(&caps);
+ jvmti_env->AddCapabilities(&caps);
+ jvmtiEventCallbacks cbs;
+ memset(&cbs, 0, sizeof(cbs));
+ cbs.ClassFileLoadHook = transformationHook;
+ jvmti_env->SetEventCallbacks(&cbs, sizeof(jvmtiEventCallbacks));
+ }
+ return 0;
+}
+
+} // namespace Test902HelloTransformation
+} // namespace art
+
diff --git a/runtime/native/java_lang_reflect_AbstractMethod.h b/test/902-hello-transformation/transform.h
similarity index 68%
copy from runtime/native/java_lang_reflect_AbstractMethod.h
copy to test/902-hello-transformation/transform.h
index 222e5a0..661058d 100644
--- a/runtime/native/java_lang_reflect_AbstractMethod.h
+++ b/test/902-hello-transformation/transform.h
@@ -14,15 +14,17 @@
* limitations under the License.
*/
-#ifndef ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
-#define ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
#include <jni.h>
namespace art {
+namespace Test902HelloTransformation {
-void register_java_lang_reflect_AbstractMethod(JNIEnv* env);
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+} // namespace Test902HelloTransformation
} // namespace art
-#endif // ART_RUNTIME_NATIVE_JAVA_LANG_REFLECT_ABSTRACTMETHOD_H_
+#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
diff --git a/test/961-default-iface-resolution-generated/build b/test/961-default-iface-resolution-gen/build
similarity index 100%
rename from test/961-default-iface-resolution-generated/build
rename to test/961-default-iface-resolution-gen/build
diff --git a/test/961-default-iface-resolution-generated/expected.txt b/test/961-default-iface-resolution-gen/expected.txt
similarity index 100%
rename from test/961-default-iface-resolution-generated/expected.txt
rename to test/961-default-iface-resolution-gen/expected.txt
diff --git a/test/961-default-iface-resolution-generated/info.txt b/test/961-default-iface-resolution-gen/info.txt
similarity index 100%
rename from test/961-default-iface-resolution-generated/info.txt
rename to test/961-default-iface-resolution-gen/info.txt
diff --git a/test/961-default-iface-resolution-generated/util-src/generate_java.py b/test/961-default-iface-resolution-gen/util-src/generate_java.py
similarity index 100%
rename from test/961-default-iface-resolution-generated/util-src/generate_java.py
rename to test/961-default-iface-resolution-gen/util-src/generate_java.py
diff --git a/test/964-default-iface-init-generated/build b/test/964-default-iface-init-gen/build
similarity index 100%
rename from test/964-default-iface-init-generated/build
rename to test/964-default-iface-init-gen/build
diff --git a/test/964-default-iface-init-generated/expected.txt b/test/964-default-iface-init-gen/expected.txt
similarity index 100%
rename from test/964-default-iface-init-generated/expected.txt
rename to test/964-default-iface-init-gen/expected.txt
diff --git a/test/964-default-iface-init-generated/info.txt b/test/964-default-iface-init-gen/info.txt
similarity index 100%
rename from test/964-default-iface-init-generated/info.txt
rename to test/964-default-iface-init-gen/info.txt
diff --git a/test/964-default-iface-init-generated/src/Displayer.java b/test/964-default-iface-init-gen/src/Displayer.java
similarity index 100%
rename from test/964-default-iface-init-generated/src/Displayer.java
rename to test/964-default-iface-init-gen/src/Displayer.java
diff --git a/test/964-default-iface-init-generated/util-src/generate_java.py b/test/964-default-iface-init-gen/util-src/generate_java.py
similarity index 100%
rename from test/964-default-iface-init-generated/util-src/generate_java.py
rename to test/964-default-iface-init-gen/util-src/generate_java.py
diff --git a/test/968-default-partial-compile-generated/build b/test/968-default-partial-compile-gen/build
similarity index 100%
rename from test/968-default-partial-compile-generated/build
rename to test/968-default-partial-compile-gen/build
diff --git a/test/968-default-partial-compile-generated/expected.txt b/test/968-default-partial-compile-gen/expected.txt
similarity index 100%
rename from test/968-default-partial-compile-generated/expected.txt
rename to test/968-default-partial-compile-gen/expected.txt
diff --git a/test/968-default-partial-compile-generated/info.txt b/test/968-default-partial-compile-gen/info.txt
similarity index 100%
rename from test/968-default-partial-compile-generated/info.txt
rename to test/968-default-partial-compile-gen/info.txt
diff --git a/test/968-default-partial-compile-generated/util-src/generate_java.py b/test/968-default-partial-compile-gen/util-src/generate_java.py
similarity index 100%
rename from test/968-default-partial-compile-generated/util-src/generate_java.py
rename to test/968-default-partial-compile-gen/util-src/generate_java.py
diff --git a/test/968-default-partial-compile-generated/util-src/generate_smali.py b/test/968-default-partial-compile-gen/util-src/generate_smali.py
similarity index 100%
rename from test/968-default-partial-compile-generated/util-src/generate_smali.py
rename to test/968-default-partial-compile-gen/util-src/generate_smali.py
diff --git a/test/970-iface-super-resolution-generated/build b/test/970-iface-super-resolution-gen/build
similarity index 100%
rename from test/970-iface-super-resolution-generated/build
rename to test/970-iface-super-resolution-gen/build
diff --git a/test/970-iface-super-resolution-generated/expected.txt b/test/970-iface-super-resolution-gen/expected.txt
similarity index 100%
rename from test/970-iface-super-resolution-generated/expected.txt
rename to test/970-iface-super-resolution-gen/expected.txt
diff --git a/test/970-iface-super-resolution-generated/info.txt b/test/970-iface-super-resolution-gen/info.txt
similarity index 100%
rename from test/970-iface-super-resolution-generated/info.txt
rename to test/970-iface-super-resolution-gen/info.txt
diff --git a/test/970-iface-super-resolution-generated/util-src/generate_java.py b/test/970-iface-super-resolution-gen/util-src/generate_java.py
similarity index 100%
rename from test/970-iface-super-resolution-generated/util-src/generate_java.py
rename to test/970-iface-super-resolution-gen/util-src/generate_java.py
diff --git a/test/970-iface-super-resolution-generated/util-src/generate_smali.py b/test/970-iface-super-resolution-gen/util-src/generate_smali.py
similarity index 100%
rename from test/970-iface-super-resolution-generated/util-src/generate_smali.py
rename to test/970-iface-super-resolution-gen/util-src/generate_smali.py
diff --git a/test/Android.bp b/test/Android.bp
index 54c85eb..2d61000 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -17,12 +17,43 @@
art_cc_defaults {
name: "art_test_defaults",
host_supported: true,
+ target: {
+ android_arm: {
+ relative_install_path: "art/arm",
+ },
+ android_arm64: {
+ relative_install_path: "art/arm64",
+ },
+ android_mips: {
+ relative_install_path: "art/mips",
+ },
+ android_mips64: {
+ relative_install_path: "art/mips64",
+ },
+ android_x86: {
+ relative_install_path: "art/x86",
+ },
+ android_x86_64: {
+ relative_install_path: "art/x86_64",
+ },
+ darwin: {
+ enabled: false,
+ },
+ },
+ cflags: [
+ "-Wno-frame-larger-than=",
+ ],
+}
+
+art_cc_defaults {
+ name: "art_gtest_defaults",
test_per_src: true,
// These really are gtests, but the gtest library comes from libart-gtest.so
gtest: false,
defaults: [
"art_defaults",
"art_debug_defaults",
+ "art_test_defaults",
],
shared_libs: [
@@ -69,9 +100,6 @@
"-Wno-missing-noreturn",
],
},
- darwin: {
- enabled: false,
- },
android: {
ldflags: [
// Allow jni_compiler_test to find Java_MyClassNatives_bar
@@ -92,25 +120,6 @@
"-Wno-missing-noreturn",
],
},
-
- android_arm: {
- relative_install_path: "art/arm",
- },
- android_arm64: {
- relative_install_path: "art/arm64",
- },
- android_mips: {
- relative_install_path: "art/mips",
- },
- android_mips64: {
- relative_install_path: "art/mips64",
- },
- android_x86: {
- relative_install_path: "art/x86",
- },
- android_x86_64: {
- relative_install_path: "art/x86_64",
- },
},
}
@@ -186,3 +195,168 @@
},
},
}
+
+cc_defaults {
+ name: "libartagent-defaults",
+ defaults: [
+ "art_defaults",
+ "art_test_defaults",
+ ],
+ shared_libs: [
+ "libbacktrace",
+ "libnativehelper",
+ ],
+ target: {
+ android: {
+ shared_libs: ["libdl"],
+ },
+ host: {
+ host_ldlibs: [
+ "-ldl",
+ "-lpthread",
+ ],
+ },
+ },
+}
+
+art_cc_test_library {
+ name: "libartagent",
+ srcs: ["900-hello-plugin/load_unload.cc"],
+ defaults: ["libartagent-defaults"],
+ shared_libs: ["libart"],
+}
+
+art_cc_test_library {
+ name: "libartagentd",
+ srcs: ["900-hello-plugin/load_unload.cc"],
+ defaults: [
+ "libartagent-defaults",
+ "art_debug_defaults",
+ ],
+ shared_libs: ["libartd"],
+}
+
+art_cc_test_library {
+ name: "libtiagent",
+ defaults: ["libartagent-defaults"],
+ srcs: [
+ "ti-agent/common_load.cc",
+ "901-hello-ti-agent/basics.cc",
+ "902-hello-transformation/transform.cc",
+ ],
+ shared_libs: [
+ "libart",
+ "libopenjdkjvmti",
+ ],
+}
+
+art_cc_test_library {
+ name: "libtiagentd",
+ defaults: [
+ "libartagent-defaults",
+ "art_debug_defaults",
+ ],
+ srcs: [
+ "ti-agent/common_load.cc",
+ "901-hello-ti-agent/basics.cc",
+ "902-hello-transformation/transform.cc",
+ ],
+ shared_libs: [
+ "libartd",
+ "libopenjdkjvmtid",
+ ],
+}
+
+cc_defaults {
+ name: "libarttest-defaults",
+ defaults: [
+ "art_defaults",
+ "art_test_defaults",
+ ],
+ srcs: [
+ "common/runtime_state.cc",
+ "common/stack_inspect.cc",
+ "004-JniTest/jni_test.cc",
+ "004-SignalTest/signaltest.cc",
+ "004-ReferenceMap/stack_walk_refmap_jni.cc",
+ "004-StackWalk/stack_walk_jni.cc",
+ "004-ThreadStress/thread_stress.cc",
+ "004-UnsafeTest/unsafe_test.cc",
+ "044-proxy/native_proxy.cc",
+ "051-thread/thread_test.cc",
+ "117-nopatchoat/nopatchoat.cc",
+ "1337-gc-coverage/gc_coverage.cc",
+ "136-daemon-jni-shutdown/daemon_jni_shutdown.cc",
+ "137-cfi/cfi.cc",
+ "139-register-natives/regnative.cc",
+ "141-class-unload/jni_unload.cc",
+ "148-multithread-gc-annotations/gc_coverage.cc",
+ "149-suspend-all-stress/suspend_all.cc",
+ "454-get-vreg/get_vreg_jni.cc",
+ "457-regs/regs_jni.cc",
+ "461-get-reference-vreg/get_reference_vreg_jni.cc",
+ "466-get-live-vreg/get_live_vreg_jni.cc",
+ "497-inlining-and-class-loader/clear_dex_cache.cc",
+ "543-env-long-ref/env_long_ref.cc",
+ "566-polymorphic-inlining/polymorphic_inline.cc",
+ "570-checker-osr/osr.cc",
+ "595-profile-saving/profile-saving.cc",
+ "596-app-images/app_images.cc",
+ "597-deopt-new-string/deopt.cc",
+ ],
+ shared_libs: [
+ "libbacktrace",
+ "libnativehelper",
+ ],
+ target: {
+ android: {
+ shared_libs: ["libdl"],
+ },
+ host: {
+ host_ldlibs: [
+ "-ldl",
+ "-lpthread",
+ ],
+ },
+ },
+}
+
+art_cc_test_library {
+ name: "libarttest",
+ defaults: ["libarttest-defaults"],
+ shared_libs: ["libart"],
+}
+
+art_cc_test_library {
+ name: "libarttestd",
+ defaults: [
+ "libarttest-defaults",
+ "art_debug_defaults",
+ ],
+ shared_libs: ["libartd"],
+}
+
+art_cc_test_library {
+ name: "libnativebridgetest",
+ shared_libs: ["libart"],
+ defaults: [
+ "art_defaults",
+ "art_debug_defaults",
+ "art_test_defaults",
+ ],
+ srcs: ["115-native-bridge/nativebridge.cc"],
+ target: {
+ android: {
+ shared_libs: ["libdl"],
+ },
+ host: {
+ host_ldlibs: [
+ "-ldl",
+ "-lpthread",
+ ],
+ },
+ linux: {
+ host_ldlibs: ["-lrt"],
+ },
+ },
+}
diff --git a/test/Android.libartagent.mk b/test/Android.libartagent.mk
deleted file mode 100644
index 729de3f..0000000
--- a/test/Android.libartagent.mk
+++ /dev/null
@@ -1,101 +0,0 @@
-#
-# Copyright (C) 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-
-LOCAL_PATH := $(call my-dir)
-
-include art/build/Android.common_build.mk
-
-LIBARTAGENT_COMMON_SRC_FILES := \
- 900-hello-plugin/load_unload.cc
-
-# $(1): target or host
-# $(2): debug or <empty>
-define build-libartagent
- ifneq ($(1),target)
- ifneq ($(1),host)
- $$(error expected target or host for argument 1, received $(1))
- endif
- endif
- ifneq ($(2),debug)
- ifneq ($(2),)
- $$(error d or empty for argument 2, received $(2))
- endif
- suffix := d
- else
- suffix :=
- endif
-
- art_target_or_host := $(1)
-
- include $(CLEAR_VARS)
- LOCAL_CPP_EXTENSION := $(ART_CPP_EXTENSION)
- LOCAL_MODULE := libartagent$$(suffix)
- ifeq ($$(art_target_or_host),target)
- LOCAL_MODULE_TAGS := tests
- endif
- LOCAL_SRC_FILES := $(LIBARTAGENT_COMMON_SRC_FILES)
- LOCAL_SHARED_LIBRARIES += libart$$(suffix) libbacktrace libnativehelper
- LOCAL_C_INCLUDES += $(ART_C_INCLUDES) art/runtime
- LOCAL_ADDITIONAL_DEPENDENCIES := art/build/Android.common_build.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += $(LOCAL_PATH)/Android.libartagent.mk
- ifeq ($$(art_target_or_host),target)
- $(call set-target-local-clang-vars)
- ifeq ($$(suffix),d)
- $(call set-target-local-cflags-vars,debug)
- else
- $(call set-target-local-cflags-vars,ndebug)
- endif
- LOCAL_SHARED_LIBRARIES += libdl
- LOCAL_MULTILIB := both
- LOCAL_MODULE_PATH_32 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_32)
- LOCAL_MODULE_PATH_64 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_64)
- LOCAL_MODULE_TARGET_ARCH := $(ART_SUPPORTED_ARCH)
- include $(BUILD_SHARED_LIBRARY)
- else # host
- LOCAL_CLANG := $(ART_HOST_CLANG)
- LOCAL_CFLAGS := $(ART_HOST_CFLAGS)
- LOCAL_ASFLAGS := $(ART_HOST_ASFLAGS)
- ifeq ($$(suffix),d)
- LOCAL_CFLAGS += $(ART_HOST_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_DEBUG_ASFLAGS)
- else
- LOCAL_CFLAGS += $(ART_HOST_NON_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_NON_DEBUG_ASFLAGS)
- endif
- LOCAL_LDLIBS := $(ART_HOST_LDLIBS) -ldl -lpthread
- LOCAL_IS_HOST_MODULE := true
- LOCAL_MULTILIB := both
- include $(BUILD_HOST_SHARED_LIBRARY)
- endif
-
- # Clear locally used variables.
- art_target_or_host :=
- suffix :=
-endef
-
-ifeq ($(ART_BUILD_TARGET),true)
- $(eval $(call build-libartagent,target,))
- $(eval $(call build-libartagent,target,debug))
-endif
-ifeq ($(ART_BUILD_HOST),true)
- $(eval $(call build-libartagent,host,))
- $(eval $(call build-libartagent,host,debug))
-endif
-
-# Clear locally used variables.
-LOCAL_PATH :=
-LIBARTAGENT_COMMON_SRC_FILES :=
diff --git a/test/Android.libarttest.mk b/test/Android.libarttest.mk
deleted file mode 100644
index ec5b7d2..0000000
--- a/test/Android.libarttest.mk
+++ /dev/null
@@ -1,134 +0,0 @@
-#
-# Copyright (C) 2011 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-LOCAL_PATH := $(call my-dir)
-
-include art/build/Android.common_build.mk
-
-LIBARTTEST_COMMON_SRC_FILES := \
- common/runtime_state.cc \
- common/stack_inspect.cc \
- 004-JniTest/jni_test.cc \
- 004-SignalTest/signaltest.cc \
- 004-ReferenceMap/stack_walk_refmap_jni.cc \
- 004-StackWalk/stack_walk_jni.cc \
- 004-ThreadStress/thread_stress.cc \
- 004-UnsafeTest/unsafe_test.cc \
- 044-proxy/native_proxy.cc \
- 051-thread/thread_test.cc \
- 117-nopatchoat/nopatchoat.cc \
- 1337-gc-coverage/gc_coverage.cc \
- 136-daemon-jni-shutdown/daemon_jni_shutdown.cc \
- 137-cfi/cfi.cc \
- 139-register-natives/regnative.cc \
- 141-class-unload/jni_unload.cc \
- 148-multithread-gc-annotations/gc_coverage.cc \
- 149-suspend-all-stress/suspend_all.cc \
- 454-get-vreg/get_vreg_jni.cc \
- 457-regs/regs_jni.cc \
- 461-get-reference-vreg/get_reference_vreg_jni.cc \
- 466-get-live-vreg/get_live_vreg_jni.cc \
- 497-inlining-and-class-loader/clear_dex_cache.cc \
- 543-env-long-ref/env_long_ref.cc \
- 566-polymorphic-inlining/polymorphic_inline.cc \
- 570-checker-osr/osr.cc \
- 595-profile-saving/profile-saving.cc \
- 596-app-images/app_images.cc \
- 597-deopt-new-string/deopt.cc
-
-ART_TARGET_LIBARTTEST_$(ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libarttest.so
-ART_TARGET_LIBARTTEST_$(ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libarttestd.so
-ifdef TARGET_2ND_ARCH
- ART_TARGET_LIBARTTEST_$(2ND_ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libarttest.so
- ART_TARGET_LIBARTTEST_$(2ND_ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libarttestd.so
-endif
-
-# $(1): target or host
-define build-libarttest
- ifneq ($(1),target)
- ifneq ($(1),host)
- $$(error expected target or host for argument 1, received $(1))
- endif
- endif
- ifneq ($(2),debug)
- ifneq ($(2),)
- $$(error d or empty for argument 2, received $(2))
- endif
- suffix := d
- else
- suffix :=
- endif
-
- art_target_or_host := $(1)
-
- include $(CLEAR_VARS)
- LOCAL_CPP_EXTENSION := $(ART_CPP_EXTENSION)
- LOCAL_MODULE := libarttest$$(suffix)
- ifeq ($$(art_target_or_host),target)
- LOCAL_MODULE_TAGS := tests
- endif
- LOCAL_SRC_FILES := $(LIBARTTEST_COMMON_SRC_FILES)
- LOCAL_SHARED_LIBRARIES += libart$$(suffix) libbacktrace libnativehelper
- LOCAL_C_INCLUDES += $(ART_C_INCLUDES) art/runtime
- LOCAL_ADDITIONAL_DEPENDENCIES := art/build/Android.common_build.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += $(LOCAL_PATH)/Android.libarttest.mk
- ifeq ($$(art_target_or_host),target)
- LOCAL_CLANG := $(ART_TARGET_CLANG)
- ifeq ($$(suffix),d)
- $(call set-target-local-cflags-vars,debug)
- else
- $(call set-target-local-cflags-vars,ndebug)
- endif
- LOCAL_SHARED_LIBRARIES += libdl
- LOCAL_MULTILIB := both
- LOCAL_MODULE_PATH_32 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_32)
- LOCAL_MODULE_PATH_64 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_64)
- LOCAL_MODULE_TARGET_ARCH := $(ART_SUPPORTED_ARCH)
- include $(BUILD_SHARED_LIBRARY)
- else # host
- LOCAL_CLANG := $(ART_HOST_CLANG)
- LOCAL_CFLAGS := $(ART_HOST_CFLAGS)
- LOCAL_ASFLAGS := $(ART_HOST_ASFLAGS)
- ifeq ($$(suffix),d)
- LOCAL_CFLAGS += $(ART_HOST_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_DEBUG_ASFLAGS)
- else
- LOCAL_CFLAGS += $(ART_HOST_NON_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_NON_DEBUG_ASFLAGS)
- endif
- LOCAL_LDLIBS := -ldl -lpthread
- LOCAL_IS_HOST_MODULE := true
- LOCAL_MULTILIB := both
- include $(BUILD_HOST_SHARED_LIBRARY)
- endif
-
- # Clear locally used variables.
- art_target_or_host :=
- suffix :=
-endef
-
-ifeq ($(ART_BUILD_TARGET),true)
- $(eval $(call build-libarttest,target,))
- $(eval $(call build-libarttest,target,debug))
-endif
-ifeq ($(ART_BUILD_HOST),true)
- $(eval $(call build-libarttest,host,))
- $(eval $(call build-libarttest,host,debug))
-endif
-
-# Clear locally used variables.
-LOCAL_PATH :=
-LIBARTTEST_COMMON_SRC_FILES :=
diff --git a/test/Android.libnativebridgetest.mk b/test/Android.libnativebridgetest.mk
deleted file mode 100644
index aa83016..0000000
--- a/test/Android.libnativebridgetest.mk
+++ /dev/null
@@ -1,87 +0,0 @@
-#
-# Copyright (C) 2014 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-LOCAL_PATH := $(call my-dir)
-
-include art/build/Android.common_build.mk
-
-LIBNATIVEBRIDGETEST_COMMON_SRC_FILES := \
- 115-native-bridge/nativebridge.cc
-
-ART_TARGET_LIBNATIVEBRIDGETEST_$(ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libnativebridgetest.so
-ifdef TARGET_2ND_ARCH
- ART_TARGET_LIBNATIVEBRIDGETEST_$(2ND_ART_PHONY_TEST_TARGET_SUFFIX) += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libnativebridgetest.so
-endif
-
-# $(1): target or host
-define build-libnativebridgetest
- ifneq ($(1),target)
- ifneq ($(1),host)
- $$(error expected target or host for argument 1, received $(1))
- endif
- endif
-
- art_target_or_host := $(1)
-
- include $(CLEAR_VARS)
- LOCAL_CPP_EXTENSION := $(ART_CPP_EXTENSION)
- LOCAL_MODULE := libnativebridgetest
- ifeq ($$(art_target_or_host),target)
- LOCAL_MODULE_TAGS := tests
- endif
- LOCAL_SRC_FILES := $(LIBNATIVEBRIDGETEST_COMMON_SRC_FILES)
- LOCAL_SHARED_LIBRARIES += libartd
- LOCAL_C_INCLUDES += $(ART_C_INCLUDES) art/runtime
- LOCAL_ADDITIONAL_DEPENDENCIES := art/build/Android.common_build.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += $(LOCAL_PATH)/Android.libnativebridgetest.mk
- ifeq ($$(art_target_or_host),target)
- LOCAL_CLANG := $(ART_TARGET_CLANG)
- $(call set-target-local-cflags-vars,debug)
- LOCAL_SHARED_LIBRARIES += libdl
- LOCAL_STATIC_LIBRARIES := libgtest
- LOCAL_MULTILIB := both
- LOCAL_MODULE_PATH_32 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_32)
- LOCAL_MODULE_PATH_64 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_64)
- LOCAL_MODULE_TARGET_ARCH := $(ART_SUPPORTED_ARCH)
- include $(BUILD_SHARED_LIBRARY)
- else # host
- LOCAL_CLANG := $(ART_HOST_CLANG)
- LOCAL_CFLAGS := $(ART_HOST_CFLAGS) $(ART_HOST_DEBUG_CFLAGS)
- LOCAL_ASFLAGS := $(ART_HOST_ASFLAGS) $(ART_HOST_DEBUG_ASFLAGS)
- LOCAL_SHARED_LIBRARIES += libcutils
- LOCAL_LDLIBS := -ldl -lpthread
- ifeq ($(HOST_OS),linux)
- LOCAL_LDLIBS += -lrt
- endif
- LOCAL_IS_HOST_MODULE := true
- LOCAL_MULTILIB := both
- include $(BUILD_HOST_SHARED_LIBRARY)
- endif
-
- # Clear locally used variables.
- art_target_or_host :=
-endef
-
-ifeq ($(ART_BUILD_TARGET),true)
- $(eval $(call build-libnativebridgetest,target))
-endif
-ifeq ($(ART_BUILD_HOST),true)
- $(eval $(call build-libnativebridgetest,host))
-endif
-
-# Clear locally used variables.
-LOCAL_PATH :=
-LIBNATIVEBRIDGETEST_COMMON_SRC_FILES :=
diff --git a/test/Android.libtiagent.mk b/test/Android.libtiagent.mk
deleted file mode 100644
index 626dc3b..0000000
--- a/test/Android.libtiagent.mk
+++ /dev/null
@@ -1,102 +0,0 @@
-#
-# Copyright (C) 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-
-LOCAL_PATH := $(call my-dir)
-
-include art/build/Android.common_build.mk
-
-LIBARTAGENT_COMMON_SRC_FILES := \
- ti-agent/common_load.cc \
- 901-hello-ti-agent/basics.cc
-
-# $(1): target or host
-# $(2): debug or <empty>
-define build-libtiagent
- ifneq ($(1),target)
- ifneq ($(1),host)
- $$(error expected target or host for argument 1, received $(1))
- endif
- endif
- ifneq ($(2),debug)
- ifneq ($(2),)
- $$(error d or empty for argument 2, received $(2))
- endif
- suffix := d
- else
- suffix :=
- endif
-
- art_target_or_host := $(1)
-
- include $(CLEAR_VARS)
- LOCAL_CPP_EXTENSION := $(ART_CPP_EXTENSION)
- LOCAL_MODULE := libtiagent$$(suffix)
- ifeq ($$(art_target_or_host),target)
- LOCAL_MODULE_TAGS := tests
- endif
- LOCAL_SRC_FILES := $(LIBARTAGENT_COMMON_SRC_FILES)
- LOCAL_SHARED_LIBRARIES += libart$$(suffix) libbacktrace libnativehelper libopenjdkjvmti$$(suffix)
- LOCAL_C_INCLUDES += $(ART_C_INCLUDES) art/runtime art/test
- LOCAL_ADDITIONAL_DEPENDENCIES := art/build/Android.common_build.mk
- LOCAL_ADDITIONAL_DEPENDENCIES += $(LOCAL_PATH)/Android.libtiagent.mk
- ifeq ($$(art_target_or_host),target)
- $(call set-target-local-clang-vars)
- ifeq ($$(suffix),d)
- $(call set-target-local-cflags-vars,debug)
- else
- $(call set-target-local-cflags-vars,ndebug)
- endif
- LOCAL_SHARED_LIBRARIES += libdl
- LOCAL_MULTILIB := both
- LOCAL_MODULE_PATH_32 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_32)
- LOCAL_MODULE_PATH_64 := $(ART_TARGET_TEST_OUT)/$(ART_TARGET_ARCH_64)
- LOCAL_MODULE_TARGET_ARCH := $(ART_SUPPORTED_ARCH)
- include $(BUILD_SHARED_LIBRARY)
- else # host
- LOCAL_CLANG := $(ART_HOST_CLANG)
- LOCAL_CFLAGS := $(ART_HOST_CFLAGS)
- LOCAL_ASFLAGS := $(ART_HOST_ASFLAGS)
- ifeq ($$(suffix),d)
- LOCAL_CFLAGS += $(ART_HOST_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_DEBUG_ASFLAGS)
- else
- LOCAL_CFLAGS += $(ART_HOST_NON_DEBUG_CFLAGS)
- LOCAL_ASFLAGS += $(ART_HOST_NON_DEBUG_ASFLAGS)
- endif
- LOCAL_LDLIBS := $(ART_HOST_LDLIBS) -ldl -lpthread
- LOCAL_IS_HOST_MODULE := true
- LOCAL_MULTILIB := both
- include $(BUILD_HOST_SHARED_LIBRARY)
- endif
-
- # Clear locally used variables.
- art_target_or_host :=
- suffix :=
-endef
-
-ifeq ($(ART_BUILD_TARGET),true)
- $(eval $(call build-libtiagent,target,))
- $(eval $(call build-libtiagent,target,debug))
-endif
-ifeq ($(ART_BUILD_HOST),true)
- $(eval $(call build-libtiagent,host,))
- $(eval $(call build-libtiagent,host,debug))
-endif
-
-# Clear locally used variables.
-LOCAL_PATH :=
-LIBARTAGENT_COMMON_SRC_FILES :=
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e12fd28..0497735 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -47,6 +47,14 @@
ART_TEST_WITH_STRACE := true
endif
+ifeq ($(ART_TEST_BISECTION),true)
+ # Need to keep rebuilding the test to bisection search it.
+ ART_TEST_RUN_TEST_NO_PREBUILD := true
+ ART_TEST_RUN_TEST_PREBUILD := false
+ # Bisection search writes to standard output.
+ ART_TEST_QUIET := false
+endif
+
# Helper to create individual build targets for tests. Must be called with $(eval).
# $(1): the test number
define define-build-art-run-test
@@ -270,11 +278,11 @@
# Tests that require python3.
TEST_ART_PYTHON3_DEPENDENCY_RUN_TESTS := \
960-default-smali \
- 961-default-iface-resolution-generated \
- 964-default-iface-init-generated \
- 968-default-partial-compile-generated \
+ 961-default-iface-resolution-gen \
+ 964-default-iface-init-gen \
+ 968-default-partial-compile-gen \
969-iface-super \
- 970-iface-super-resolution-generated \
+ 970-iface-super-resolution-gen \
971-iface-super
# Check if we have python3 to run our tests.
@@ -338,9 +346,7 @@
TEST_ART_BROKEN_NO_RELOCATE_TESTS :=
# Temporarily disable some broken tests when forcing access checks in interpreter b/22414682
-# 004-JniTest is disabled because @CriticalNative is unsupported by generic JNI b/31400248
TEST_ART_BROKEN_INTERPRETER_ACCESS_CHECK_TESTS := \
- 004-JniTest \
137-cfi
ifneq (,$(filter interp-ac,$(COMPILER_TYPES)))
@@ -354,13 +360,13 @@
# Tests that are broken with GC stress.
# * 137-cfi needs to unwind a second forked process. We're using a primitive sleep to wait till we
# hope the second process got into the expected state. The slowness of gcstress makes this bad.
-# * 961-default-iface-resolution-generated and 964-default-iface-init-generated are very long tests
-# that often will take more than the timeout to run when gcstress is enabled. This is because
-# gcstress slows down allocations significantly which these tests do a lot.
+# * 961-default-iface-resolution-gen and 964-default-iface-init-genare very long tests that often
+# will take more than the timeout to run when gcstress is enabled. This is because gcstress
+# slows down allocations significantly which these tests do a lot.
TEST_ART_BROKEN_GCSTRESS_RUN_TESTS := \
137-cfi \
- 961-default-iface-resolution-generated \
- 964-default-iface-init-generated
+ 961-default-iface-resolution-gen \
+ 964-default-iface-init-gen
ifneq (,$(filter gcstress,$(GC_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -399,11 +405,9 @@
# All these tests check that we have sane behavior if we don't have a patchoat or dex2oat.
# Therefore we shouldn't run them in situations where we actually don't have these since they
# explicitly test for them. These all also assume we have an image.
-# 004-JniTest is disabled because @CriticalNative is unsupported by generic JNI b/31400248
# 147-stripped-dex-fallback is disabled because it requires --prebuild.
# 554-jit-profile-file is disabled because it needs a primary oat file to know what it should save.
TEST_ART_BROKEN_FALLBACK_RUN_TESTS := \
- 004-JniTest \
116-nodex2oat \
117-nopatchoat \
118-noimage-dex2oat \
@@ -477,9 +481,7 @@
# Known broken tests for the JIT.
# CFI unwinding expects managed frames, and the test does not iterate enough to even compile. JIT
# also uses Generic JNI instead of the JNI compiler.
-# 004-JniTest is disabled because @CriticalNative is unsupported by generic JNI b/31400248
TEST_ART_BROKEN_JIT_RUN_TESTS := \
- 004-JniTest \
137-cfi
ifneq (,$(filter jit,$(COMPILER_TYPES)))
@@ -644,6 +646,38 @@
TEST_ART_BROKEN_OPTIMIZING_HEAP_POISONING_RUN_TESTS :=
+# Tests incompatible with bisection bug search. Sorted by incompatibility reason.
+# 000 through 595 do not compile anything. 089 tests a build failure. 018 through 137
+# run dalvikvm more than once. 115 and 088 assume they are always compiled.
+# 055 tests performance which is degraded during bisecting.
+TEST_ART_INCOMPATIBLE_BISECTION_SEARCH_RUN_TESTS := \
+ 000-nop \
+ 134-nodex2oat-nofallback \
+ 147-stripped-dex-fallback \
+ 595-profile-saving \
+ \
+ 089-many-methods \
+ \
+ 018-stack-overflow \
+ 116-nodex2oat \
+ 117-nopatchoat \
+ 118-noimage-dex2oat \
+ 119-noimage-patchoat \
+ 126-miranda-multidex \
+ 137-cfi \
+ \
+ 115-native-bridge \
+ 088-monitor-verification \
+ \
+ 055-enum-performance
+
+ifeq ($(ART_TEST_BISECTION),true)
+ ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES), \
+ $(PREBUILD_TYPES),$(OPTIMIZING_COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES),$(JNI_TYPES), \
+ $(IMAGE_TYPES),$(PICTEST_TYPES),$(DEBUGGABLE_TYPES), \
+ $(TEST_ART_INCOMPATIBLE_BISECTION_SEARCH_RUN_TESTS),$(ALL_ADDRESS_SIZES))
+endif
+
# Clear variables ahead of appending to them when defining tests.
$(foreach target, $(TARGET_TYPES), $(eval ART_RUN_TEST_$(call name-to-var,$(target))_RULES :=))
$(foreach target, $(TARGET_TYPES), \
@@ -685,59 +719,59 @@
TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_EXECUTABLES) $(TARGET_CORE_IMG_OUTS)
# Also need libartagent.
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libartagent.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libartagentd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libartagent)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libartagentd)
ifdef TARGET_2ND_ARCH
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libartagent.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libartagentd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libartagent)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libartagentd)
endif
# Also need libtiagent.
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libtiagent.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libtiagentd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libtiagent)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libtiagentd)
ifdef TARGET_2ND_ARCH
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libtiagent.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libtiagentd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libtiagent)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libtiagentd)
endif
# Also need libarttest.
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libarttest.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libarttestd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libarttest)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libarttestd)
ifdef TARGET_2ND_ARCH
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libarttest.so
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libarttestd.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libarttest)
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libarttestd)
endif
# Also need libnativebridgetest.
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_ARCH)/libnativebridgetest.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_ARCH)_libnativebridgetest)
ifdef TARGET_2ND_ARCH
-TEST_ART_TARGET_SYNC_DEPS += $(ART_TARGET_TEST_OUT)/$(TARGET_2ND_ARCH)/libnativebridgetest.so
+TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libnativebridgetest)
endif
# All tests require the host executables. The tests also depend on the core images, but on
# specific version depending on the compiler.
ART_TEST_HOST_RUN_TEST_DEPENDENCIES := \
$(ART_HOST_EXECUTABLES) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libtiagent$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libtiagentd$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libartagent$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libartagentd$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libarttest$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libarttestd$(ART_HOST_SHLIB_EXTENSION) \
- $(ART_HOST_OUT_SHARED_LIBRARIES)/libnativebridgetest$(ART_HOST_SHLIB_EXTENSION) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libtiagent) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libtiagentd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libartagent) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libartagentd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libarttest) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libarttestd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(ART_HOST_ARCH)_libnativebridgetest) \
$(ART_HOST_OUT_SHARED_LIBRARIES)/libjavacore$(ART_HOST_SHLIB_EXTENSION) \
$(ART_HOST_OUT_SHARED_LIBRARIES)/libopenjdk$(ART_HOST_SHLIB_EXTENSION) \
$(ART_HOST_OUT_SHARED_LIBRARIES)/libopenjdkd$(ART_HOST_SHLIB_EXTENSION)
ifneq ($(HOST_PREFER_32_BIT),true)
ART_TEST_HOST_RUN_TEST_DEPENDENCIES += \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libtiagent$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libtiagentd$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libartagent$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libartagentd$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libarttest$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libarttestd$(ART_HOST_SHLIB_EXTENSION) \
- $(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libnativebridgetest$(ART_HOST_SHLIB_EXTENSION) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libtiagent) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libtiagentd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libartagent) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libartagentd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libarttest) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libarttestd) \
+ $(OUT_DIR)/$(ART_TEST_LIST_host_$(2ND_ART_HOST_ARCH)_libnativebridgetest) \
$(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libjavacore$(ART_HOST_SHLIB_EXTENSION) \
$(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libopenjdk$(ART_HOST_SHLIB_EXTENSION) \
$(2ND_ART_HOST_OUT_SHARED_LIBRARIES)/libopenjdkd$(ART_HOST_SHLIB_EXTENSION)
@@ -762,6 +796,9 @@
ifeq ($(ART_TEST_RUN_TEST_ALWAYS_CLEAN),true)
run_test_options += --always-clean
endif
+ ifeq ($(ART_TEST_BISECTION),true)
+ run_test_options += --bisection-search
+ endif
ifeq ($(1),host)
uc_host_or_target := HOST
test_groups := ART_RUN_TEST_HOST_RULES
@@ -1152,10 +1189,4 @@
RUN_TYPES :=
DEBUGGABLE_TYPES :=
-MY_LOCAL_PATH := $(LOCAL_PATH)
-include $(MY_LOCAL_PATH)/Android.libartagent.mk
-include $(MY_LOCAL_PATH)/Android.libtiagent.mk
-include $(MY_LOCAL_PATH)/Android.libarttest.mk
-include $(MY_LOCAL_PATH)/Android.libnativebridgetest.mk
-MY_LOCAL_PATH :=
LOCAL_PATH :=
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index d12bd79..c51cb0d 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -32,6 +32,7 @@
INVOKE_WITH=""
ISA=x86
LIBRARY_DIRECTORY="lib"
+TEST_DIRECTORY="nativetest"
MAIN=""
OPTIMIZE="y"
PATCHOAT=""
@@ -55,6 +56,8 @@
USE_DEX2OAT_AND_PATCHOAT="y"
INSTRUCTION_SET_FEATURES=""
ARGS=""
+EXTERNAL_LOG_TAGS="n" # if y respect externally set ANDROID_LOG_TAGS.
+DRY_RUN="n" # if y prepare to run the test but don't run it.
while true; do
if [ "x$1" = "x--quiet" ]; then
@@ -220,6 +223,7 @@
GDB_SERVER="gdbserver64"
DALVIKVM="dalvikvm64"
LIBRARY_DIRECTORY="lib64"
+ TEST_DIRECTORY="nativetest64"
ARCHITECTURES_PATTERN="${ARCHITECTURES_64}"
shift
elif [ "x$1" = "x--pic-test" ]; then
@@ -233,6 +237,12 @@
fi
EXPERIMENTAL="$EXPERIMENTAL $2"
shift 2
+ elif [ "x$1" = "x--external-log-tags" ]; then
+ EXTERNAL_LOG_TAGS="y"
+ shift
+ elif [ "x$1" = "x--dry-run" ]; then
+ DRY_RUN="y"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
exit 1
@@ -300,8 +310,9 @@
fi
if [ "$USE_JVM" = "y" ]; then
+ export LD_LIBRARY_PATH=${ANDROID_HOST_OUT}/lib64
# Xmx is necessary since we don't pass down the ART flags to JVM.
- cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes ${FLAGS} $MAIN $@"
+ cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes ${FLAGS} $MAIN $@ ${ARGS}"
if [ "$DEV_MODE" = "y" ]; then
echo $cmdline
fi
@@ -479,7 +490,7 @@
adb push $TEST_NAME-ex.jar $DEX_LOCATION >/dev/null 2>&1
fi
- LD_LIBRARY_PATH=/data/art-test/$ISA
+ LD_LIBRARY_PATH=/data/$TEST_DIRECTORY/art/$ISA
if [ "$ANDROID_ROOT" != "/system" ]; then
# Current default installation is dalvikvm 64bits and dex2oat 32bits,
# so we can only use LD_LIBRARY_PATH when testing on a local
@@ -491,12 +502,14 @@
# Create a script with the command. The command can get longer than the longest
# allowed adb command and there is no way to get the exit status from a adb shell
- # command.
+ # command. Dalvik cache is cleaned before running to make subsequent executions
+ # of the script follow the same runtime path.
cmdline="cd $DEX_LOCATION && \
export ANDROID_DATA=$DEX_LOCATION && \
export ANDROID_ADDITIONAL_PUBLIC_LIBRARIES=$PUBLIC_LIBS && \
export DEX_LOCATION=$DEX_LOCATION && \
export ANDROID_ROOT=$ANDROID_ROOT && \
+ rm -rf ${DEX_LOCATION}/dalvik-cache/ && \
mkdir -p ${mkdir_locations} && \
export LD_LIBRARY_PATH=$LD_LIBRARY_PATH && \
export PATH=$ANDROID_ROOT/bin:$PATH && \
@@ -517,7 +530,9 @@
adb push $cmdfile $DEX_LOCATION/cmdline.sh > /dev/null 2>&1
fi
- adb shell sh $DEX_LOCATION/cmdline.sh
+ if [ "$DRY_RUN" != "y" ]; then
+ adb shell sh $DEX_LOCATION/cmdline.sh
+ fi
rm -f $cmdfile
else
@@ -525,16 +540,18 @@
# By default, and for prebuild dex2oat, we are interested in errors being logged. In dev mode
# we want debug messages.
- if [ "$DEV_MODE" = "y" ]; then
- export ANDROID_LOG_TAGS='*:d'
- else
- export ANDROID_LOG_TAGS='*:e'
+ if [ "$EXTERNAL_LOG_TAGS" = "n" ]; then
+ if [ "$DEV_MODE" = "y" ]; then
+ export ANDROID_LOG_TAGS='*:d'
+ else
+ export ANDROID_LOG_TAGS='*:e'
+ fi
fi
export ANDROID_DATA="$DEX_LOCATION"
export ANDROID_ROOT="${ANDROID_ROOT}"
- export LD_LIBRARY_PATH="${ANDROID_ROOT}/lib"
- export DYLD_LIBRARY_PATH="${ANDROID_ROOT}/lib"
+ export LD_LIBRARY_PATH="${ANDROID_ROOT}/${LIBRARY_DIRECTORY}:${ANDROID_ROOT}/${TEST_DIRECTORY}"
+ export DYLD_LIBRARY_PATH="${ANDROID_ROOT}/${LIBRARY_DIRECTORY}:${ANDROID_ROOT}/${TEST_DIRECTORY}"
export PATH="$PATH:${ANDROID_ROOT}/bin"
# Temporarily disable address space layout randomization (ASLR).
@@ -582,15 +599,21 @@
# For running, we must turn off logging when dex2oat or patchoat are missing. Otherwise we use
# the same defaults as for prebuilt: everything when --dev, otherwise errors and above only.
- if [ "$DEV_MODE" = "y" ]; then
- export ANDROID_LOG_TAGS='*:d'
- elif [ "$USE_DEX2OAT_AND_PATCHOAT" = "n" ]; then
- # All tests would log the error of failing dex2oat/patchoat. Be silent here and only
- # log fatal events.
- export ANDROID_LOG_TAGS='*:s'
- else
- # We are interested in LOG(ERROR) output.
- export ANDROID_LOG_TAGS='*:e'
+ if [ "$EXTERNAL_LOG_TAGS" = "n" ]; then
+ if [ "$DEV_MODE" = "y" ]; then
+ export ANDROID_LOG_TAGS='*:d'
+ elif [ "$USE_DEX2OAT_AND_PATCHOAT" = "n" ]; then
+ # All tests would log the error of failing dex2oat/patchoat. Be silent here and only
+ # log fatal events.
+ export ANDROID_LOG_TAGS='*:s'
+ else
+ # We are interested in LOG(ERROR) output.
+ export ANDROID_LOG_TAGS='*:e'
+ fi
+ fi
+
+ if [ "$DRY_RUN" = "y" ]; then
+ exit 0
fi
if [ "$USE_GDB" = "y" ]; then
diff --git a/test/run-test b/test/run-test
index 8fb2adf..250263a 100755
--- a/test/run-test
+++ b/test/run-test
@@ -130,6 +130,7 @@
pic_image_suffix=""
multi_image_suffix=""
android_root="/system"
+bisection_search="no"
# By default we will use optimizing.
image_args=""
image_suffix=""
@@ -347,6 +348,9 @@
shift
run_args="${run_args} --instruction-set-features $1"
shift
+ elif [ "x$1" = "x--bisection-search" ]; then
+ bisection_search="yes"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
usage="yes"
@@ -469,10 +473,10 @@
if [ "$target_mode" = "no" ]; then
guess_host_arch_name
run_args="${run_args} --boot ${ANDROID_HOST_OUT}/framework/core${image_suffix}${pic_image_suffix}${multi_image_suffix}.art"
- run_args="${run_args} --runtime-option -Djava.library.path=${ANDROID_HOST_OUT}/lib${suffix64}"
+ run_args="${run_args} --runtime-option -Djava.library.path=${ANDROID_HOST_OUT}/lib${suffix64}:${ANDROID_HOST_OUT}/nativetest${suffix64}"
else
guess_target_arch_name
- run_args="${run_args} --runtime-option -Djava.library.path=/data/art-test/${target_arch_name}:/system/lib${suffix64}"
+ run_args="${run_args} --runtime-option -Djava.library.path=/data/nativetest${suffix64}/art/${target_arch_name}:/system/lib${suffix64}"
run_args="${run_args} --boot /data/art-test/core${image_suffix}${pic_image_suffix}${multi_image_suffix}.art"
fi
if [ "$relocate" = "yes" ]; then
@@ -519,6 +523,21 @@
usage="yes"
fi
+if [ "$bisection_search" = "yes" -a "$prebuild_mode" = "yes" ]; then
+ err_echo "--bisection-search and --prebuild are mutually exclusive"
+ usage="yes"
+fi
+
+if [ "$bisection_search" = "yes" -a "$have_dex2oat" = "no" ]; then
+ err_echo "--bisection-search and --no-dex2oat are mutually exclusive"
+ usage="yes"
+fi
+
+if [ "$bisection_search" = "yes" -a "$have_patchoat" = "no" ]; then
+ err_echo "--bisection-search and --no-patchoat are mutually exclusive"
+ usage="yes"
+fi
+
if [ "$usage" = "no" ]; then
if [ "x$1" = "x" -o "x$1" = "x-" ]; then
test_dir=`basename "$oldwd"`
@@ -539,6 +558,13 @@
shift
fi
+# For building with javac and dx always use Java 7. The dx compiler
+# only support byte codes from Java 7 or earlier (class file major
+# version 51 or lower).
+if [ "$USE_JACK" != "true" ] && [ "$NEED_DEX" = "true" ]; then
+ export JAVAC="${JAVAC} -source 1.7 -target 1.7"
+fi
+
if [ "$usage" = "yes" ]; then
prog=`basename $prog`
(
@@ -560,8 +586,8 @@
echo " --gdb Run under gdb; incompatible with some tests."
echo " --gdb-arg Pass an option to gdb."
echo " --build-only Build test files only (off by default)."
- echo " --build-with-javac-dx Build test files with javac and dx (on by default)."
- echo " --build-with-jack Build test files with jack and jill (off by default)."
+ echo " --build-with-javac-dx Build test files with javac and dx (off by default)."
+ echo " --build-with-jack Build test files with jack and jill (on by default)."
echo " --interpreter Enable interpreter only mode (off by default)."
echo " --jit Enable jit (off by default)."
echo " --optimizing Enable optimizing compiler (default)."
@@ -613,6 +639,7 @@
echo " the boot class path."
echo " --pic-test Compile the test code position independent."
echo " --quiet Don't print anything except failure messages"
+ echo " --bisection-search Perform bisection bug search."
) 1>&2 # Direct to stderr so usage is not printed if --quiet is set.
exit 1
fi
@@ -716,9 +743,7 @@
fi
fi
-if [ "$runtime" != "jvm" ]; then
run_args="${run_args} --testlib ${testlib}"
-fi
# To cause tests to fail fast, limit the file sizes created by dx, dex2oat and ART output to 2MB.
build_file_size_limit=2048
@@ -881,6 +906,41 @@
) 2>&${real_stderr} 1>&2
+# Attempt bisection only if the test failed.
+if [ "$bisection_search" = "yes" -a "$good" != "yes" ]; then
+ # Bisecting works by skipping different optimization passes which breaks checker assertions.
+ if [ "$run_checker" == "yes" ]; then
+ echo "${test_dir}: not bisecting, checker test." 1>&2
+ else
+ # Increase file size limit, bisection search can generate large logfiles.
+ if ! ulimit -S unlimited; then
+ err_echo "ulimit file size setting failed"
+ fi
+ echo "${test_dir}: bisecting..." 1>&2
+ cwd=`pwd`
+ maybe_device_mode=""
+ raw_cmd=""
+ if [ "$target_mode" = "yes" ]; then
+ # Produce cmdline.sh in $DEX_LOCATION. "$@" is passed as a runtime option
+ # so that cmdline.sh forwards its arguments to dalvikvm. invoke-with is set
+ # to exec in order to preserve pid when calling dalvikvm. This is required
+ # for bisection search to correctly retrieve logs from device.
+ "./${run}" $run_args --runtime-option '"$@"' --invoke-with exec --dry-run "$@" &> /dev/null
+ adb shell chmod u+x "$DEX_LOCATION/cmdline.sh"
+ maybe_device_mode="--device"
+ raw_cmd="$DEX_LOCATION/cmdline.sh"
+ else
+ raw_cmd="$cwd/${run} --external-log-tags $run_args $@"
+ fi
+ $ANDROID_BUILD_TOP/art/tools/bisection_search/bisection_search.py \
+ $maybe_device_mode \
+ --raw-cmd="$raw_cmd" \
+ --check-script="$cwd/check" \
+ --expected-output="$cwd/expected.txt" \
+ --timeout=300
+ fi
+fi
+
# Clean up test files.
if [ "$always_clean" = "yes" -o "$good" = "yes" ] && [ "$never_clean" = "no" ]; then
cd "$oldwd"
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index ed280e4..53bb153 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -24,6 +24,7 @@
#include "base/macros.h"
#include "901-hello-ti-agent/basics.h"
+#include "902-hello-transformation/transform.h"
namespace art {
@@ -39,6 +40,7 @@
// A list of all the agents we have for testing.
AgentLib agents[] = {
{ "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
+ { "902-hello-transformation", Test902HelloTransformation::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
diff --git a/tools/ahat/Android.mk b/tools/ahat/Android.mk
index 60e0cd8..4003ee0 100644
--- a/tools/ahat/Android.mk
+++ b/tools/ahat/Android.mk
@@ -16,7 +16,7 @@
LOCAL_PATH := $(call my-dir)
-include art/build/Android.common_test.mk
+include art/build/Android.common_path.mk
# --- ahat.jar ----------------
include $(CLEAR_VARS)
diff --git a/tools/bisection_search/README.md b/tools/bisection_search/README.md
index 64ccb20..d641102 100644
--- a/tools/bisection_search/README.md
+++ b/tools/bisection_search/README.md
@@ -21,12 +21,14 @@
./bisection_search.py -cp classes.dex --expected-output out_int --class Test
-2. Raw-cmd invocation, dalvikvm command is accepted as an argument. The command
- has to start with an executable.
+2. Raw-cmd invocation, dalvikvm command is accepted as an argument.
Extra dalvikvm arguments will be placed on second position in the command
by default. {ARGS} tag can be used to specify a custom position.
+ If used in device mode, the command has to exec a dalvikvm instance. Bisection
+ will fail if pid of the process started by raw-cmd is different than pid of runtime.
+
./bisection_search.py --raw-cmd='run.sh -cp classes.dex Test' --expected-retcode SUCCESS
./bisection_search.py --raw-cmd='/bin/sh art {ARGS} -cp classes.dex Test' --expected-retcode SUCCESS
diff --git a/tools/bisection_search/bisection_search.py b/tools/bisection_search/bisection_search.py
index 0d36aa4..c5971e6 100755
--- a/tools/bisection_search/bisection_search.py
+++ b/tools/bisection_search/bisection_search.py
@@ -24,17 +24,23 @@
import abc
import argparse
+import os
import re
import shlex
-from subprocess import call
import sys
+
+from subprocess import call
from tempfile import NamedTemporaryFile
-from common import DeviceTestEnv
-from common import FatalError
-from common import GetEnvVariableOrError
-from common import HostTestEnv
-from common import RetCode
+sys.path.append(os.path.dirname(os.path.dirname(
+ os.path.realpath(__file__))))
+
+from common.common import DeviceTestEnv
+from common.common import FatalError
+from common.common import GetEnvVariableOrError
+from common.common import HostTestEnv
+from common.common import LogSeverity
+from common.common import RetCode
# Passes that are never disabled during search process because disabling them
@@ -57,6 +63,9 @@
# position in the command.
RAW_CMD_RUNTIME_ARGS_TAG = '{ARGS}'
+# Default core image path relative to ANDROID_HOST_OUT.
+DEFAULT_IMAGE_RELATIVE_PATH = '/framework/core.art'
+
class Dex2OatWrapperTestable(object):
"""Class representing a testable compilation.
@@ -104,10 +113,9 @@
print('Testing methods: {0} passes: {1}.'.format(
compiled_methods, passes_to_run))
cmd = self._PrepareCmd(compiled_methods=compiled_methods,
- passes_to_run=passes_to_run,
- verbose_compiler=False)
+ passes_to_run=passes_to_run)
(output, ret_code) = self._test_env.RunCommand(
- cmd, {'ANDROID_LOG_TAGS': '*:e'})
+ cmd, LogSeverity.ERROR)
res = True
if self._expected_retcode:
res = self._expected_retcode == ret_code
@@ -126,8 +134,8 @@
Raises:
FatalError: An error occurred when retrieving methods list.
"""
- cmd = self._PrepareCmd(verbose_compiler=True)
- (output, _) = self._test_env.RunCommand(cmd, {'ANDROID_LOG_TAGS': '*:i'})
+ cmd = self._PrepareCmd()
+ (output, _) = self._test_env.RunCommand(cmd, LogSeverity.INFO)
match_methods = re.findall(r'Building ([^\n]+)\n', output)
if not match_methods:
raise FatalError('Failed to retrieve methods list. '
@@ -146,17 +154,15 @@
Raises:
FatalError: An error occurred when retrieving passes list.
"""
- cmd = self._PrepareCmd(compiled_methods=[compiled_method],
- verbose_compiler=True)
- (output, _) = self._test_env.RunCommand(cmd, {'ANDROID_LOG_TAGS': '*:i'})
+ cmd = self._PrepareCmd(compiled_methods=[compiled_method])
+ (output, _) = self._test_env.RunCommand(cmd, LogSeverity.INFO)
match_passes = re.findall(r'Starting pass: ([^\n]+)\n', output)
if not match_passes:
raise FatalError('Failed to retrieve passes list. '
'Not recognized output format.')
return [p for p in match_passes if p not in NON_PASSES]
- def _PrepareCmd(self, compiled_methods=None, passes_to_run=None,
- verbose_compiler=False):
+ def _PrepareCmd(self, compiled_methods=None, passes_to_run=None):
"""Prepare command to run."""
cmd = self._base_cmd[0:self._arguments_position]
# insert additional arguments before the first argument
@@ -168,9 +174,8 @@
self._test_env.WriteLines(self._passes_to_run_path, passes_to_run)
cmd += ['-Xcompiler-option', '--run-passes={0}'.format(
self._passes_to_run_path)]
- if verbose_compiler:
- cmd += ['-Xcompiler-option', '--runtime-arg', '-Xcompiler-option',
- '-verbose:compiler', '-Xcompiler-option', '-j1']
+ cmd += ['-Xcompiler-option', '--runtime-arg', '-Xcompiler-option',
+ '-verbose:compiler', '-Xcompiler-option', '-j1']
cmd += self._base_cmd[self._arguments_position:]
return cmd
@@ -361,8 +366,8 @@
if not args.device:
base_cmd += ['-XXlib:{0}'.format(args.lib)]
if not args.image:
- image_path = '{0}/framework/core-optimizing-pic.art'.format(
- GetEnvVariableOrError('ANDROID_HOST_OUT'))
+ image_path = (GetEnvVariableOrError('ANDROID_HOST_OUT') +
+ DEFAULT_IMAGE_RELATIVE_PATH)
else:
image_path = args.image
base_cmd += ['-Ximage:{0}'.format(image_path)]
diff --git a/tools/javafuzz/__init__.py b/tools/common/__init__.py
similarity index 100%
copy from tools/javafuzz/__init__.py
copy to tools/common/__init__.py
diff --git a/tools/bisection_search/common.py b/tools/common/common.py
similarity index 67%
rename from tools/bisection_search/common.py
rename to tools/common/common.py
index b69b606..b822dca 100755
--- a/tools/bisection_search/common.py
+++ b/tools/common/common.py
@@ -21,7 +21,12 @@
import signal
import shlex
import shutil
+import time
+from enum import Enum
+from enum import unique
+
+from subprocess import DEVNULL
from subprocess import check_call
from subprocess import PIPE
from subprocess import Popen
@@ -31,9 +36,6 @@
from tempfile import mkdtemp
from tempfile import NamedTemporaryFile
-from enum import Enum
-from enum import unique
-
# Temporary directory path on device.
DEVICE_TMP_PATH = '/data/local/tmp'
@@ -51,6 +53,48 @@
NOTRUN = 4
+@unique
+class LogSeverity(Enum):
+ VERBOSE = 0
+ DEBUG = 1
+ INFO = 2
+ WARNING = 3
+ ERROR = 4
+ FATAL = 5
+ SILENT = 6
+
+ @property
+ def symbol(self):
+ return self.name[0]
+
+ @classmethod
+ def FromSymbol(cls, s):
+ for log_severity in LogSeverity:
+ if log_severity.symbol == s:
+ return log_severity
+ raise ValueError("{0} is not a valid log severity symbol".format(s))
+
+ def __ge__(self, other):
+ if self.__class__ is other.__class__:
+ return self.value >= other.value
+ return NotImplemented
+
+ def __gt__(self, other):
+ if self.__class__ is other.__class__:
+ return self.value > other.value
+ return NotImplemented
+
+ def __le__(self, other):
+ if self.__class__ is other.__class__:
+ return self.value <= other.value
+ return NotImplemented
+
+ def __lt__(self, other):
+ if self.__class__ is other.__class__:
+ return self.value < other.value
+ return NotImplemented
+
+
def GetEnvVariableOrError(variable_name):
"""Gets value of an environmental variable.
@@ -72,6 +116,14 @@
return top
+def GetJackClassPath():
+ """Returns Jack's classpath."""
+ top = GetEnvVariableOrError('ANDROID_BUILD_TOP')
+ libdir = top + '/out/host/common/obj/JAVA_LIBRARIES'
+ return libdir + '/core-libart-hostdex_intermediates/classes.jack:' \
+ + libdir + '/core-oj-hostdex_intermediates/classes.jack'
+
+
def _DexArchCachePaths(android_data_path):
"""Returns paths to architecture specific caches.
@@ -116,23 +168,44 @@
return (output, stderr_output, retcode)
-def _RunCommandForOutputAndLog(cmd, env, logfile, timeout=60):
- """Runs command and logs its output. Returns the output.
+def _LogCmdOutput(logfile, cmd, output, retcode):
+ """Logs output of a command.
Args:
- cmd: list of strings, command to run.
- env: shell environment to run the command with.
logfile: file handle to logfile.
- timeout: int, timeout in seconds.
-
- Returns:
- tuple (string, string, RetCode) stdout output, stderr output, normalized
- return code.
+ cmd: list of strings, command.
+ output: command output.
+ retcode: RetCode, normalized retcode.
"""
- (output, _, retcode) = RunCommandForOutput(cmd, env, PIPE, STDOUT, timeout)
logfile.write('Command:\n{0}\n{1}\nReturn code: {2}\n'.format(
CommandListToCommandString(cmd), output, retcode))
- return (output, retcode)
+
+
+def RunCommand(cmd, out, err, timeout=5):
+ """Executes a command, and returns its return code.
+
+ Args:
+ cmd: list of strings, a command to execute
+ out: string, file name to open for stdout (or None)
+ err: string, file name to open for stderr (or None)
+ timeout: int, time out in seconds
+ Returns:
+ RetCode, return code of running command (forced RetCode.TIMEOUT
+ on timeout)
+ """
+ devnull = DEVNULL
+ outf = devnull
+ if out is not None:
+ outf = open(out, mode='w')
+ errf = devnull
+ if err is not None:
+ errf = open(err, mode='w')
+ (_, _, retcode) = RunCommandForOutput(cmd, None, outf, errf, timeout)
+ if outf != devnull:
+ outf.close()
+ if errf != devnull:
+ errf.close()
+ return retcode
def CommandListToCommandString(cmd):
@@ -187,15 +260,14 @@
"""
@abc.abstractmethod
- def RunCommand(self, cmd, env_updates=None):
- """Runs command in environment with updated environmental variables.
+ def RunCommand(self, cmd, log_severity=LogSeverity.ERROR):
+ """Runs command in environment.
Args:
cmd: list of strings, command to run.
- env_updates: dict, string to string, maps names of variables to their
- updated values.
+ log_severity: LogSeverity, minimum severity of logs included in output.
Returns:
- tuple (string, string, int) stdout output, stderr output, return code.
+ tuple (string, int) output, return code.
"""
@abc.abstractproperty
@@ -262,13 +334,17 @@
f.writelines('{0}\n'.format(line) for line in lines)
return
- def RunCommand(self, cmd, env_updates=None):
- if not env_updates:
- env_updates = {}
+ def RunCommand(self, cmd, log_severity=LogSeverity.ERROR):
self._EmptyDexCache()
env = self._shell_env.copy()
- env.update(env_updates)
- return _RunCommandForOutputAndLog(cmd, env, self._logfile, self._timeout)
+ env.update({'ANDROID_LOG_TAGS':'*:' + log_severity.symbol.lower()})
+ (output, err_output, retcode) = RunCommandForOutput(
+ cmd, env, PIPE, PIPE, self._timeout)
+ # We append err_output to output to stay consistent with DeviceTestEnv
+ # implementation.
+ output += err_output
+ _LogCmdOutput(self._logfile, cmd, output, retcode)
+ return (output, retcode)
@property
def logfile(self):
@@ -341,26 +417,63 @@
self._AdbPush(temp_file.name, file_path)
return
- def RunCommand(self, cmd, env_updates=None):
- if not env_updates:
- env_updates = {}
+ def _ExtractPid(self, brief_log_line):
+ """Extracts PID from a single logcat line in brief format."""
+ pid_start_idx = brief_log_line.find('(') + 2
+ if pid_start_idx == -1:
+ return None
+ pid_end_idx = brief_log_line.find(')', pid_start_idx)
+ if pid_end_idx == -1:
+ return None
+ return brief_log_line[pid_start_idx:pid_end_idx]
+
+ def _ExtractSeverity(self, brief_log_line):
+ """Extracts LogSeverity from a single logcat line in brief format."""
+ if not brief_log_line:
+ return None
+ return LogSeverity.FromSymbol(brief_log_line[0])
+
+ def RunCommand(self, cmd, log_severity=LogSeverity.ERROR):
self._EmptyDexCache()
- if 'ANDROID_DATA' not in env_updates:
- env_updates['ANDROID_DATA'] = self._device_env_path
- env_updates_cmd = ' '.join(['{0}={1}'.format(var, val) for var, val
- in env_updates.items()])
- cmd = CommandListToCommandString(cmd)
- adb = 'adb'
+ env_vars_cmd = 'ANDROID_DATA={0} ANDROID_LOG_TAGS=*:i'.format(
+ self._device_env_path)
+ adb_cmd = ['adb']
if self._specific_device:
- adb += ' -s ' + self._specific_device
- cmd = '{0} shell "logcat -c && {1} {2}"'.format(
- adb, env_updates_cmd, cmd)
- (output, retcode) = _RunCommandForOutputAndLog(
- shlex.split(cmd), self._shell_env, self._logfile, self._timeout)
- logcat_cmd = 'adb shell "logcat -d -s -b main dex2oat:* dex2oatd:*"'
- (err_output, _) = _RunCommandForOutputAndLog(
- shlex.split(logcat_cmd), self._shell_env, self._logfile)
- return (output + err_output, retcode)
+ adb_cmd += ['-s', self._specific_device]
+ logcat_cmd = adb_cmd + ['logcat', '-v', 'brief', '-s', '-b', 'main',
+ '-T', '1', 'dex2oat:*', 'dex2oatd:*']
+ logcat_proc = Popen(logcat_cmd, stdout=PIPE, stderr=STDOUT,
+ universal_newlines=True)
+ cmd_str = CommandListToCommandString(cmd)
+ # Print PID of the shell and exec command. We later retrieve this PID and
+ # use it to filter dex2oat logs, keeping those with matching parent PID.
+ device_cmd = ('echo $$ && ' + env_vars_cmd + ' exec ' + cmd_str)
+ cmd = adb_cmd + ['shell', device_cmd]
+ (output, _, retcode) = RunCommandForOutput(cmd, self._shell_env, PIPE,
+ STDOUT, self._timeout)
+ # We need to make sure to only kill logcat once all relevant logs arrive.
+ # Sleep is used for simplicity.
+ time.sleep(0.5)
+ logcat_proc.kill()
+ end_of_first_line = output.find('\n')
+ if end_of_first_line != -1:
+ parent_pid = output[:end_of_first_line]
+ output = output[end_of_first_line + 1:]
+ logcat_output, _ = logcat_proc.communicate()
+ logcat_lines = logcat_output.splitlines(keepends=True)
+ dex2oat_pids = []
+ for line in logcat_lines:
+ # Dex2oat was started by our runtime instance.
+ if 'Running dex2oat (parent PID = ' + parent_pid in line:
+ dex2oat_pids.append(self._ExtractPid(line))
+ break
+ if dex2oat_pids:
+ for line in logcat_lines:
+ if (self._ExtractPid(line) in dex2oat_pids and
+ self._ExtractSeverity(line) >= log_severity):
+ output += line
+ _LogCmdOutput(self._logfile, cmd, output, retcode)
+ return (output, retcode)
@property
def logfile(self):
diff --git a/tools/javafuzz/Android.mk b/tools/jfuzz/Android.mk
similarity index 90%
rename from tools/javafuzz/Android.mk
rename to tools/jfuzz/Android.mk
index 63db57a..c7002d6 100644
--- a/tools/javafuzz/Android.mk
+++ b/tools/jfuzz/Android.mk
@@ -12,14 +12,14 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# Java fuzzer tool.
+# Fuzzer tool.
LOCAL_PATH:= $(call my-dir)
include $(CLEAR_VARS)
LOCAL_CPP_EXTENSION := cc
-LOCAL_SRC_FILES := javafuzz.cc
+LOCAL_SRC_FILES := jfuzz.cc
LOCAL_CFLAGS += -O0 -g -Wall
LOCAL_MODULE_HOST_OS := darwin linux windows
-LOCAL_MODULE := javafuzz
+LOCAL_MODULE := jfuzz
include $(BUILD_HOST_EXECUTABLE)
diff --git a/tools/javafuzz/README.md b/tools/jfuzz/README.md
similarity index 77%
rename from tools/javafuzz/README.md
rename to tools/jfuzz/README.md
index b08075a..1d566a9 100644
--- a/tools/javafuzz/README.md
+++ b/tools/jfuzz/README.md
@@ -1,19 +1,19 @@
-JavaFuzz
-========
+JFuzz
+=====
-JavaFuzz is a tool for generating random Java programs with the objective
-of fuzz testing the ART infrastructure. Each randomly generated Java program
+JFuzz is a tool for generating random programs with the objective
+of fuzz testing the ART infrastructure. Each randomly generated program
can be run under various modes of execution, such as using the interpreter,
using the optimizing compiler, using an external reference implementation,
or using various target architectures. Any difference between the outputs
(**divergence**) may indicate a bug in one of the execution modes.
-JavaFuzz can be combined with dexfuzz to get multi-layered fuzz testing.
+JFuzz can be combined with DexFuzz to get multi-layered fuzz testing.
-How to run JavaFuzz
+How to run JFuzz
===================
- javafuzz [-s seed] [-d expr-depth] [-l stmt-length]
+ jfuzz [-s seed] [-d expr-depth] [-l stmt-length]
[-i if-nest] [-n loop-nest]
where
@@ -29,18 +29,18 @@
-n : defines a fuzzing nest for for/while/do-while loops
(higher values yield deeper nested loops)
-The current version of JavaFuzz sends all output to stdout, and uses
+The current version of JFuzz sends all output to stdout, and uses
a fixed testing class named Test. So a typical test run looks as follows.
- javafuzz > Test.java
+ jfuzz > Test.java
jack -cp ${JACK_CLASSPATH} --output-dex . Test.java
art -classpath classes.dex Test
-How to start the JavaFuzz tests
-===============================
+How to start JFuzz testing
+=============================
- run_java_fuzz_test.py
- [--num_tests=#TESTS]
+ run_jfuzz_test.py
+ [--num_tests=NUM_TESTS]
[--device=DEVICE]
[--mode1=MODE] [--mode2=MODE]
@@ -56,6 +56,20 @@
tint = Art interpreter on target
topt = Art optimizing on target
+How to start J/DexFuzz testing (multi-layered)
+==============================================
+
+ run_dex_fuzz_test.py
+ [--num_tests=NUM_TESTS]
+ [--num_inputs=NUM_INPUTS]
+ [--device=DEVICE]
+
+where
+
+ --num_tests : number of tests to run (10000 by default)
+ --num_inputs: number of JFuzz programs to generate
+ --device : target device serial number (passed to adb -s)
+
Background
==========
diff --git a/tools/javafuzz/__init__.py b/tools/jfuzz/__init__.py
similarity index 100%
rename from tools/javafuzz/__init__.py
rename to tools/jfuzz/__init__.py
diff --git a/tools/javafuzz/javafuzz.cc b/tools/jfuzz/jfuzz.cc
similarity index 96%
rename from tools/javafuzz/javafuzz.cc
rename to tools/jfuzz/jfuzz.cc
index 161ae0a..125b56a 100644
--- a/tools/javafuzz/javafuzz.cc
+++ b/tools/jfuzz/jfuzz.cc
@@ -26,7 +26,7 @@
namespace {
/*
- * Java operators.
+ * Operators.
*/
#define EMIT(x) fputs((x)[random0(sizeof(x)/sizeof(const char*))], out_);
@@ -49,33 +49,33 @@
static constexpr const char* kRelOps[] = { "==", "!=", ">", ">=", "<", "<=" };
/*
- * Version of JavaFuzz. Increase this each time changes are made to the program
- * to preserve the property that a given version of JavaFuzz yields the same
- * fuzzed Java program for a deterministic random seed.
+ * Version of JFuzz. Increase this each time changes are made to the program
+ * to preserve the property that a given version of JFuzz yields the same
+ * fuzzed program for a deterministic random seed.
*/
const char* VERSION = "1.1";
static const uint32_t MAX_DIMS[11] = { 0, 1000, 32, 10, 6, 4, 3, 3, 2, 2, 2 };
/**
- * A class that generates a random Java program that compiles correctly. The program
+ * A class that generates a random program that compiles correctly. The program
* is generated using rules that generate various programming constructs. Each rule
* has a fixed probability to "fire". Running a generated program yields deterministic
* output, making it suited to test various modes of execution (e.g an interpreter vs.
* an compiler or two different run times) for divergences.
*
- * TODO: Due to the original scope of this project, the generated Java program is heavy
- * on loops, arrays, and basic operations; fuzzing other aspects of Java programs,
- * like elaborate typing, class hierarchies, and interfaces is still TBD.
+ * TODO: Due to the original scope of this project, the generated program is heavy
+ * on loops, arrays, and basic operations; fuzzing other aspects, like elaborate
+ * typing, class hierarchies, and interfaces is still TBD.
*/
-class JavaFuzz {
+class JFuzz {
public:
- JavaFuzz(FILE* out,
- uint32_t seed,
- uint32_t expr_depth,
- uint32_t stmt_length,
- uint32_t if_nest,
- uint32_t loop_nest)
+ JFuzz(FILE* out,
+ uint32_t seed,
+ uint32_t expr_depth,
+ uint32_t stmt_length,
+ uint32_t if_nest,
+ uint32_t loop_nest)
: out_(out),
fuzz_random_engine_(seed),
fuzz_seed_(seed),
@@ -100,7 +100,7 @@
float_local_(0),
double_local_(0) { }
- ~JavaFuzz() { }
+ ~JFuzz() { }
void emitProgram() {
emitHeader();
@@ -978,10 +978,10 @@
// Emit program header. Emit command line options in the comments.
void emitHeader() {
- fputs("\n/**\n * AOSP Java Fuzz Tester.\n", out_);
- fputs(" * Automatically generated Java program.\n", out_);
+ fputs("\n/**\n * AOSP JFuzz Tester.\n", out_);
+ fputs(" * Automatically generated program.\n", out_);
fprintf(out_,
- " * javafuzz -s %u -d %u -l %u -i %u -n %u (version %s)\n */\n\n",
+ " * jfuzz -s %u -d %u -l %u -i %u -n %u (version %s)\n */\n\n",
fuzz_seed_,
fuzz_expr_depth_,
fuzz_stmt_length_,
@@ -1101,8 +1101,8 @@
// Seed global random generator.
srand(seed);
- // Generate fuzzed Java program.
- JavaFuzz fuzz(stdout, seed, expr_depth, stmt_length, if_nest, loop_nest);
+ // Generate fuzzed program.
+ JFuzz fuzz(stdout, seed, expr_depth, stmt_length, if_nest, loop_nest);
fuzz.emitProgram();
return 0;
}
diff --git a/tools/jfuzz/run_dex_fuzz_test.py b/tools/jfuzz/run_dex_fuzz_test.py
new file mode 100755
index 0000000..56cdf02
--- /dev/null
+++ b/tools/jfuzz/run_dex_fuzz_test.py
@@ -0,0 +1,139 @@
+#!/usr/bin/env python3.4
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+import argparse
+import os
+import shutil
+import sys
+
+from subprocess import check_call
+from tempfile import mkdtemp
+
+sys.path.append(os.path.dirname(os.path.dirname(
+ os.path.realpath(__file__))))
+
+from common.common import FatalError
+from common.common import GetJackClassPath
+from common.common import RetCode
+from common.common import RunCommand
+
+
+#
+# Tester class.
+#
+
+
+class DexFuzzTester(object):
+ """Tester that feeds JFuzz programs into DexFuzz testing."""
+
+ def __init__(self, num_tests, num_inputs, device):
+ """Constructor for the tester.
+
+ Args:
+ num_tests: int, number of tests to run
+ num_inputs: int, number of JFuzz programs to generate
+ device: string, target device serial number (or None)
+ """
+ self._num_tests = num_tests
+ self._num_inputs = num_inputs
+ self._device = device
+ self._save_dir = None
+ self._results_dir = None
+ self._dexfuzz_dir = None
+ self._inputs_dir = None
+
+ def __enter__(self):
+ """On entry, enters new temp directory after saving current directory.
+
+ Raises:
+ FatalError: error when temp directory cannot be constructed
+ """
+ self._save_dir = os.getcwd()
+ self._results_dir = mkdtemp(dir='/tmp/')
+ self._dexfuzz_dir = mkdtemp(dir=self._results_dir)
+ self._inputs_dir = mkdtemp(dir=self._dexfuzz_dir)
+ if self._results_dir is None or self._dexfuzz_dir is None or \
+ self._inputs_dir is None:
+ raise FatalError('Cannot obtain temp directory')
+ os.chdir(self._dexfuzz_dir)
+ return self
+
+ def __exit__(self, etype, evalue, etraceback):
+ """On exit, re-enters previously saved current directory and cleans up."""
+ os.chdir(self._save_dir)
+ # TODO: detect divergences or shutil.rmtree(self._results_dir)
+
+ def Run(self):
+ """Feeds JFuzz programs into DexFuzz testing."""
+ print()
+ print('**\n**** JFuzz Testing\n**')
+ print()
+ print('#Tests :', self._num_tests)
+ print('Device :', self._device)
+ print('Directory :', self._results_dir)
+ print()
+ self.GenerateJFuzzPrograms()
+ self.RunDexFuzz()
+
+
+ def GenerateJFuzzPrograms(self):
+ """Generates JFuzz programs.
+
+ Raises:
+ FatalError: error when generation fails
+ """
+ os.chdir(self._inputs_dir)
+ for i in range(1, self._num_inputs + 1):
+ jack_args = ['-cp', GetJackClassPath(), '--output-dex', '.', 'Test.java']
+ if RunCommand(['jfuzz'], out='Test.java', err=None) != RetCode.SUCCESS:
+ raise FatalError('Unexpected error while running JFuzz')
+ if RunCommand(['jack'] + jack_args, out=None, err='jackerr.txt',
+ timeout=30) != RetCode.SUCCESS:
+ raise FatalError('Unexpected error while running Jack')
+ shutil.move('Test.java', '../Test' + str(i) + '.java')
+ shutil.move('classes.dex', 'classes' + str(i) + '.dex')
+ os.unlink('jackerr.txt')
+
+ def RunDexFuzz(self):
+ """Starts the DexFuzz testing."""
+ os.chdir(self._dexfuzz_dir)
+ os.environ['ANDROID_DATA'] = self._dexfuzz_dir
+ dexfuzz_args = ['--inputs=' + self._inputs_dir, '--execute',
+ '--execute-class=Test', '--repeat=' + str(self._num_tests),
+ '--dump-output', '--interpreter', '--optimizing']
+ if self._device is not None:
+ dexfuzz_args += ['--device=' + self._device, '--allarm']
+ else:
+ dexfuzz_args += ['--host'] # Assume host otherwise.
+ check_call(['dexfuzz'] + dexfuzz_args)
+ # TODO: summarize findings.
+
+
+def main():
+ # Handle arguments.
+ parser = argparse.ArgumentParser()
+ parser.add_argument('--num_tests', default=10000,
+ type=int, help='number of tests to run')
+ parser.add_argument('--num_inputs', default=50,
+ type=int, help='number of JFuzz program to generate')
+ parser.add_argument('--device', help='target device serial number')
+ args = parser.parse_args()
+ # Run the DexFuzz tester.
+ with DexFuzzTester(args.num_tests, args.num_inputs, args.device) as fuzzer:
+ fuzzer.Run()
+
+if __name__ == '__main__':
+ main()
diff --git a/tools/javafuzz/run_java_fuzz_test.py b/tools/jfuzz/run_jfuzz_test.py
similarity index 82%
rename from tools/javafuzz/run_java_fuzz_test.py
rename to tools/jfuzz/run_jfuzz_test.py
index 51d00be..cf2364b 100755
--- a/tools/javafuzz/run_java_fuzz_test.py
+++ b/tools/jfuzz/run_jfuzz_test.py
@@ -17,69 +17,28 @@
import abc
import argparse
import filecmp
-
-from glob import glob
-
import os
import shlex
import shutil
-import subprocess
import sys
+from glob import glob
from tempfile import mkdtemp
sys.path.append(os.path.dirname(os.path.dirname(
os.path.realpath(__file__))))
-from bisection_search.common import RetCode
-from bisection_search.common import CommandListToCommandString
-from bisection_search.common import FatalError
-from bisection_search.common import GetEnvVariableOrError
-from bisection_search.common import RunCommandForOutput
-from bisection_search.common import DeviceTestEnv
+from common.common import RetCode
+from common.common import CommandListToCommandString
+from common.common import FatalError
+from common.common import GetJackClassPath
+from common.common import GetEnvVariableOrError
+from common.common import RunCommand
+from common.common import DeviceTestEnv
# Return codes supported by bisection bug search.
BISECTABLE_RET_CODES = (RetCode.SUCCESS, RetCode.ERROR, RetCode.TIMEOUT)
-#
-# Utility methods.
-#
-
-
-def RunCommand(cmd, out, err, timeout=5):
- """Executes a command, and returns its return code.
-
- Args:
- cmd: list of strings, a command to execute
- out: string, file name to open for stdout (or None)
- err: string, file name to open for stderr (or None)
- timeout: int, time out in seconds
- Returns:
- RetCode, return code of running command (forced RetCode.TIMEOUT
- on timeout)
- """
- devnull = subprocess.DEVNULL
- outf = devnull
- if out is not None:
- outf = open(out, mode='w')
- errf = devnull
- if err is not None:
- errf = open(err, mode='w')
- (_, _, retcode) = RunCommandForOutput(cmd, None, outf, errf, timeout)
- if outf != devnull:
- outf.close()
- if errf != devnull:
- errf.close()
- return retcode
-
-
-def GetJackClassPath():
- """Returns Jack's classpath."""
- top = GetEnvVariableOrError('ANDROID_BUILD_TOP')
- libdir = top + '/out/host/common/obj/JAVA_LIBRARIES'
- return libdir + '/core-libart-hostdex_intermediates/classes.jack:' \
- + libdir + '/core-oj-hostdex_intermediates/classes.jack'
-
def GetExecutionModeRunner(device, mode):
"""Returns a runner for the given execution mode.
@@ -104,6 +63,7 @@
return TestRunnerArtOptOnTarget(device)
raise FatalError('Unknown execution mode')
+
#
# Execution mode classes.
#
@@ -248,7 +208,7 @@
device: string, target device serial number (or None)
extra_args: list of strings, extra arguments for dalvikvm
"""
- self._test_env = DeviceTestEnv('javafuzz_', specific_device=device)
+ self._test_env = DeviceTestEnv('jfuzz_', specific_device=device)
self._dalvik_cmd = ['dalvikvm']
if extra_args is not None:
self._dalvik_cmd += extra_args
@@ -335,12 +295,12 @@
#
-# Tester classes.
+# Tester class.
#
-class JavaFuzzTester(object):
- """Tester that runs JavaFuzz many times and report divergences."""
+class JFuzzTester(object):
+ """Tester that runs JFuzz many times and report divergences."""
def __init__(self, num_tests, device, mode1, mode2):
"""Constructor for the tester.
@@ -356,7 +316,8 @@
self._runner1 = GetExecutionModeRunner(device, mode1)
self._runner2 = GetExecutionModeRunner(device, mode2)
self._save_dir = None
- self._tmp_dir = None
+ self._results_dir = None
+ self._jfuzz_dir = None
# Statistics.
self._test = 0
self._num_success = 0
@@ -373,23 +334,23 @@
"""
self._save_dir = os.getcwd()
self._results_dir = mkdtemp(dir='/tmp/')
- self._tmp_dir = mkdtemp(dir=self._results_dir)
- if self._tmp_dir is None or self._results_dir is None:
+ self._jfuzz_dir = mkdtemp(dir=self._results_dir)
+ if self._results_dir is None or self._jfuzz_dir is None:
raise FatalError('Cannot obtain temp directory')
- os.chdir(self._tmp_dir)
+ os.chdir(self._jfuzz_dir)
return self
def __exit__(self, etype, evalue, etraceback):
"""On exit, re-enters previously saved current directory and cleans up."""
os.chdir(self._save_dir)
- shutil.rmtree(self._tmp_dir)
+ shutil.rmtree(self._jfuzz_dir)
if self._num_divergences == 0:
shutil.rmtree(self._results_dir)
def Run(self):
- """Runs JavaFuzz many times and report divergences."""
+ """Runs JFuzz many times and report divergences."""
print()
- print('**\n**** JavaFuzz Testing\n**')
+ print('**\n**** JFuzz Testing\n**')
print()
print('#Tests :', self._num_tests)
print('Device :', self._device)
@@ -399,7 +360,7 @@
print()
self.ShowStats()
for self._test in range(1, self._num_tests + 1):
- self.RunJavaFuzzTest()
+ self.RunJFuzzTest()
self.ShowStats()
if self._num_divergences == 0:
print('\n\nsuccess (no divergences)\n')
@@ -408,16 +369,17 @@
def ShowStats(self):
"""Shows current statistics (on same line) while tester is running."""
- print('\rTests:', self._test, \
- 'Success:', self._num_success, \
- 'Not-compiled:', self._num_not_compiled, \
- 'Not-run:', self._num_not_run, \
- 'Timed-out:', self._num_timed_out, \
- 'Divergences:', self._num_divergences, end='')
+ print('\rTests:', self._test,
+ 'Success:', self._num_success,
+ 'Not-compiled:', self._num_not_compiled,
+ 'Not-run:', self._num_not_run,
+ 'Timed-out:', self._num_timed_out,
+ 'Divergences:', self._num_divergences,
+ end='')
sys.stdout.flush()
- def RunJavaFuzzTest(self):
- """Runs a single JavaFuzz test, comparing two execution modes."""
+ def RunJFuzzTest(self):
+ """Runs a single JFuzz test, comparing two execution modes."""
self.ConstructTest()
retc1 = self._runner1.CompileAndRunTest()
retc2 = self._runner2.CompileAndRunTest()
@@ -425,13 +387,13 @@
self.CleanupTest()
def ConstructTest(self):
- """Use JavaFuzz to generate next Test.java test.
+ """Use JFuzz to generate next Test.java test.
Raises:
- FatalError: error when javafuzz fails
+ FatalError: error when jfuzz fails
"""
- if RunCommand(['javafuzz'], out='Test.java', err=None) != RetCode.SUCCESS:
- raise FatalError('Unexpected error while running JavaFuzz')
+ if RunCommand(['jfuzz'], out='Test.java', err=None) != RetCode.SUCCESS:
+ raise FatalError('Unexpected error while running JFuzz')
def CheckForDivergence(self, retc1, retc2):
"""Checks for divergences and updates statistics.
@@ -515,12 +477,12 @@
def CleanupTest(self):
"""Cleans up after a single test run."""
- for file_name in os.listdir(self._tmp_dir):
- file_path = os.path.join(self._tmp_dir, file_name)
- if os.path.isfile(file_path):
- os.unlink(file_path)
- elif os.path.isdir(file_path):
- shutil.rmtree(file_path)
+ for file_name in os.listdir(self._jfuzz_dir):
+ file_path = os.path.join(self._jfuzz_dir, file_name)
+ if os.path.isfile(file_path):
+ os.unlink(file_path)
+ elif os.path.isdir(file_path):
+ shutil.rmtree(file_path)
def main():
@@ -536,8 +498,8 @@
args = parser.parse_args()
if args.mode1 == args.mode2:
raise FatalError('Identical execution modes given')
- # Run the JavaFuzz tester.
- with JavaFuzzTester(args.num_tests, args.device,
+ # Run the JFuzz tester.
+ with JFuzzTester(args.num_tests, args.device,
args.mode1, args.mode2) as fuzzer:
fuzzer.Run()
diff --git a/tools/libcore_failures_concurrent_collector.txt b/tools/libcore_failures_concurrent_collector.txt
index 95f0c2d..0e289a6 100644
--- a/tools/libcore_failures_concurrent_collector.txt
+++ b/tools/libcore_failures_concurrent_collector.txt
@@ -10,11 +10,4 @@
*/
[
-{
- description: "Assertion failing on the concurrent collector configuration.",
- result: EXEC_FAILED,
- names: ["jsr166.LinkedTransferQueueTest#testTransfer2",
- "jsr166.LinkedTransferQueueTest#testWaitingConsumer"],
- bug: 25883050
-}
]