Merge "Add support for parsing the ROOT_FINALIZING record."
diff --git a/benchmark/Android.bp b/benchmark/Android.bp
index 606734b..3995ca2 100644
--- a/benchmark/Android.bp
+++ b/benchmark/Android.bp
@@ -17,7 +17,7 @@
 art_cc_library {
     name: "libartbenchmark",
     host_supported: true,
-    defaults: ["art_defaults" ],
+    defaults: ["art_defaults"],
     srcs: [
         "jni_loader.cc",
         "jobject-benchmark/jobject_benchmark.cc",
@@ -31,15 +31,6 @@
         "libbase",
         "libnativehelper",
     ],
-    clang: true,
-    target: {
-        android: {
-            shared_libs: ["libdl"],
-        },
-        host: {
-            host_ldlibs: ["-ldl", "-lpthread"],
-        },
-    },
     cflags: [
         "-Wno-frame-larger-than=",
     ],
@@ -49,7 +40,10 @@
     name: "libartbenchmark-micronative-host",
     host_supported: true,
     device_supported: false,
-    defaults: ["art_debug_defaults", "art_defaults" ],
+    defaults: [
+        "art_debug_defaults",
+        "art_defaults",
+    ],
     srcs: [
         "jni_loader.cc",
         "micro-native/micro_native.cc",
@@ -60,12 +54,6 @@
     ],
     header_libs: ["jni_headers"],
     stl: "libc++_static",
-    clang: true,
-    target: {
-        host: {
-            host_ldlibs: ["-ldl", "-lpthread"],
-        },
-    },
     cflags: [
         "-Wno-frame-larger-than=",
     ],
diff --git a/build/Android.bp b/build/Android.bp
index 65df933..8e8a2f6 100644
--- a/build/Android.bp
+++ b/build/Android.bp
@@ -20,7 +20,6 @@
     // Additional flags are computed by art.go
 
     name: "art_defaults",
-    clang: true,
     cflags: [
         // Base set of cflags used by all things ART.
         "-fno-rtti",
@@ -90,9 +89,6 @@
                 // Apple, it's a pain.
                 "-Wmissing-noreturn",
             ],
-            host_ldlibs: [
-                "-lrt",
-            ],
         },
         host: {
             cflags: [
@@ -109,10 +105,6 @@
                 "-msse4.2",
                 "-mpopcnt",
             ],
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
         },
     },
 
diff --git a/compiler/Android.bp b/compiler/Android.bp
index c50c197..3044890 100644
--- a/compiler/Android.bp
+++ b/compiler/Android.bp
@@ -23,7 +23,6 @@
     name: "libart-compiler-defaults",
     defaults: ["art_defaults"],
     host_supported: true,
-    clang: true,
     srcs: [
         "compiled_method.cc",
         "debug/elf_debug_writer.cc",
@@ -54,6 +53,7 @@
         "optimizing/code_sinking.cc",
         "optimizing/constant_folding.cc",
         "optimizing/constructor_fence_redundancy_elimination.cc",
+        "optimizing/data_type.cc",
         "optimizing/dead_code_elimination.cc",
         "optimizing/escape.cc",
         "optimizing/graph_checker.cc",
@@ -181,10 +181,6 @@
         },
     },
     target: {
-        host: {
-            // For compiler driver TLS.
-            host_ldlibs: ["-lpthread"],
-        },
         android: {
             // For atrace.
             shared_libs: ["libcutils"],
@@ -321,6 +317,7 @@
         "linker/method_bss_mapping_encoder_test.cc",
         "linker/output_stream_test.cc",
         "optimizing/bounds_check_elimination_test.cc",
+        "optimizing/data_type_test.cc",
         "optimizing/dominator_test.cc",
         "optimizing/find_loops_test.cc",
         "optimizing/graph_checker_test.cc",
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index e49f83f..7581962 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -374,8 +374,8 @@
       // Dex pc is not serialized, only used for checking the instructions. Since we access the
       // array based on the index of the quickened instruction, the indexes must line up perfectly.
       // The reader side uses the NeedsIndexForInstruction function too.
-      const Instruction* inst = Instruction::At(code_item->insns_ + info.dex_pc);
-      CHECK(QuickenInfoTable::NeedsIndexForInstruction(inst)) << inst->Opcode();
+      const Instruction& inst = code_item->InstructionAt(info.dex_pc);
+      CHECK(QuickenInfoTable::NeedsIndexForInstruction(&inst)) << inst.Opcode();
       // Add the index.
       quicken_data.push_back(static_cast<uint8_t>(info.dex_member_index >> 0));
       quicken_data.push_back(static_cast<uint8_t>(info.dex_member_index >> 8));
diff --git a/compiler/dex/inline_method_analyser.cc b/compiler/dex/inline_method_analyser.cc
index c8e3d5e..925863e 100644
--- a/compiler/dex/inline_method_analyser.cc
+++ b/compiler/dex/inline_method_analyser.cc
@@ -64,14 +64,14 @@
  private:
   explicit Matcher(const DexFile::CodeItem* code_item)
       : code_item_(code_item),
-        instruction_(Instruction::At(code_item->insns_)),
+        instruction_(code_item->Instructions().begin()),
         pos_(0u),
         mark_(0u) { }
 
   static bool DoMatch(const DexFile::CodeItem* code_item, MatchFn* const* pattern, size_t size);
 
   const DexFile::CodeItem* const code_item_;
-  const Instruction* instruction_;
+  DexInstructionIterator instruction_;
   size_t pos_;
   size_t mark_;
 };
@@ -93,7 +93,7 @@
     return false;
   }
   matcher->pos_ += 1u;
-  matcher->instruction_ = matcher->instruction_->Next();
+  ++matcher->instruction_;
   return true;
 }
 
@@ -105,7 +105,7 @@
     return true;
   }
   matcher->pos_ = matcher->mark_;
-  matcher->instruction_ = matcher->instruction_->Next();
+  ++matcher->instruction_;
   return true;
 }
 
@@ -301,26 +301,27 @@
   // Verify the invoke, prevent a few odd cases and collect IPUTs.
   uint16_t this_vreg = code_item->registers_size_ - code_item->ins_size_;
   uint16_t zero_vreg_mask = 0u;
-  for (const Instruction* instruction = Instruction::At(code_item->insns_);
-      instruction->Opcode() != Instruction::RETURN_VOID;
-      instruction = instruction->Next()) {
-    if (instruction->Opcode() == Instruction::INVOKE_DIRECT) {
-      ArtMethod* target_method = GetTargetConstructor(method, instruction);
+
+  for (const Instruction& instruction : code_item->Instructions()) {
+    if (instruction.Opcode() == Instruction::RETURN_VOID) {
+      break;
+    } else if (instruction.Opcode() == Instruction::INVOKE_DIRECT) {
+      ArtMethod* target_method = GetTargetConstructor(method, &instruction);
       if (target_method == nullptr) {
         return false;
       }
       // We allow forwarding constructors only if they pass more arguments
       // to prevent infinite recursion.
       if (target_method->GetDeclaringClass() == method->GetDeclaringClass() &&
-          instruction->VRegA_35c() <= code_item->ins_size_) {
+          instruction.VRegA_35c() <= code_item->ins_size_) {
         return false;
       }
-      size_t forwarded = CountForwardedConstructorArguments(code_item, instruction, zero_vreg_mask);
+      size_t forwarded = CountForwardedConstructorArguments(code_item, &instruction, zero_vreg_mask);
       if (forwarded == static_cast<size_t>(-1)) {
         return false;
       }
       if (target_method->GetDeclaringClass()->IsObjectClass()) {
-        DCHECK_EQ(Instruction::At(target_method->GetCodeItem()->insns_)->Opcode(),
+        DCHECK_EQ(target_method->GetCodeItem()->Instructions().begin()->Opcode(),
                   Instruction::RETURN_VOID);
       } else {
         const DexFile::CodeItem* target_code_item = target_method->GetCodeItem();
@@ -345,15 +346,15 @@
           return false;
         }
       }
-    } else if (IsInstructionDirectConst(instruction->Opcode())) {
-      zero_vreg_mask |= GetZeroVRegMask(instruction);
+    } else if (IsInstructionDirectConst(instruction.Opcode())) {
+      zero_vreg_mask |= GetZeroVRegMask(&instruction);
       if ((zero_vreg_mask & (1u << this_vreg)) != 0u) {
         return false;  // Overwriting `this` is unsupported.
       }
     } else {
-      DCHECK(IsInstructionIPut(instruction->Opcode()));
-      DCHECK_EQ(instruction->VRegB_22c(), this_vreg);
-      if (!RecordConstructorIPut(method, instruction, this_vreg, zero_vreg_mask, iputs)) {
+      DCHECK(IsInstructionIPut(instruction.Opcode()));
+      DCHECK_EQ(instruction.VRegB_22c(), this_vreg);
+      if (!RecordConstructorIPut(method, &instruction, this_vreg, zero_vreg_mask, iputs)) {
         return false;
       }
     }
@@ -447,8 +448,7 @@
   // We currently support only plain return or 2-instruction methods.
 
   DCHECK_NE(code_item->insns_size_in_code_units_, 0u);
-  const Instruction* instruction = Instruction::At(code_item->insns_);
-  Instruction::Code opcode = instruction->Opcode();
+  Instruction::Code opcode = code_item->Instructions().begin()->Opcode();
 
   switch (opcode) {
     case Instruction::RETURN_VOID:
@@ -519,7 +519,7 @@
 
 bool InlineMethodAnalyser::AnalyseReturnMethod(const DexFile::CodeItem* code_item,
                                                InlineMethod* result) {
-  const Instruction* return_instruction = Instruction::At(code_item->insns_);
+  DexInstructionIterator return_instruction = code_item->Instructions().begin();
   Instruction::Code return_opcode = return_instruction->Opcode();
   uint32_t reg = return_instruction->VRegA_11x();
   uint32_t arg_start = code_item->registers_size_ - code_item->ins_size_;
@@ -541,7 +541,7 @@
 
 bool InlineMethodAnalyser::AnalyseConstMethod(const DexFile::CodeItem* code_item,
                                               InlineMethod* result) {
-  const Instruction* instruction = Instruction::At(code_item->insns_);
+  DexInstructionIterator instruction = code_item->Instructions().begin();
   const Instruction* return_instruction = instruction->Next();
   Instruction::Code return_opcode = return_instruction->Opcode();
   if (return_opcode != Instruction::RETURN &&
@@ -575,7 +575,7 @@
                                              bool is_static,
                                              ArtMethod* method,
                                              InlineMethod* result) {
-  const Instruction* instruction = Instruction::At(code_item->insns_);
+  DexInstructionIterator instruction = code_item->Instructions().begin();
   Instruction::Code opcode = instruction->Opcode();
   DCHECK(IsInstructionIGet(opcode));
 
@@ -639,7 +639,7 @@
                                              bool is_static,
                                              ArtMethod* method,
                                              InlineMethod* result) {
-  const Instruction* instruction = Instruction::At(code_item->insns_);
+  DexInstructionIterator instruction = code_item->Instructions().begin();
   Instruction::Code opcode = instruction->Opcode();
   DCHECK(IsInstructionIPut(opcode));
 
diff --git a/compiler/dex/verified_method.cc b/compiler/dex/verified_method.cc
index e46dc59..9c5b632 100644
--- a/compiler/dex/verified_method.cc
+++ b/compiler/dex/verified_method.cc
@@ -64,24 +64,21 @@
   if (method_verifier->HasFailures()) {
     return;
   }
-  const DexFile::CodeItem* code_item = method_verifier->CodeItem();
-  const Instruction* inst = Instruction::At(code_item->insns_);
-  const Instruction* end = Instruction::At(code_item->insns_ +
-                                           code_item->insns_size_in_code_units_);
-
-  for (; inst < end; inst = inst->Next()) {
-    Instruction::Code code = inst->Opcode();
+  IterationRange<DexInstructionIterator> instructions = method_verifier->CodeItem()->Instructions();
+  for (auto it = instructions.begin(); it != instructions.end(); ++it) {
+    const Instruction& inst = *it;
+    const Instruction::Code code = inst.Opcode();
     if (code == Instruction::CHECK_CAST) {
-      uint32_t dex_pc = inst->GetDexPc(code_item->insns_);
+      const uint32_t dex_pc = it.GetDexPC(instructions.begin());
       if (!method_verifier->GetInstructionFlags(dex_pc).IsVisited()) {
         // Do not attempt to quicken this instruction, it's unreachable anyway.
         continue;
       }
       const verifier::RegisterLine* line = method_verifier->GetRegLine(dex_pc);
       const verifier::RegType& reg_type(line->GetRegisterType(method_verifier,
-                                                              inst->VRegA_21c()));
+                                                              inst.VRegA_21c()));
       const verifier::RegType& cast_type =
-          method_verifier->ResolveCheckedClass(dex::TypeIndex(inst->VRegB_21c()));
+          method_verifier->ResolveCheckedClass(dex::TypeIndex(inst.VRegB_21c()));
       // Pass null for the method verifier to not record the VerifierDeps dependency
       // if the types are not assignable.
       if (cast_type.IsStrictlyAssignableFrom(reg_type, /* method_verifier */ nullptr)) {
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index 03d8ef5..7573367 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -762,18 +762,14 @@
     return;
   }
 
-  const uint16_t* code_ptr = code_item->insns_;
-  const uint16_t* code_end = code_item->insns_ + code_item->insns_size_in_code_units_;
   ClassLinker* const class_linker = Runtime::Current()->GetClassLinker();
-
-  while (code_ptr < code_end) {
-    const Instruction* inst = Instruction::At(code_ptr);
-    switch (inst->Opcode()) {
+  for (const Instruction& inst : code_item->Instructions()) {
+    switch (inst.Opcode()) {
       case Instruction::CONST_STRING:
       case Instruction::CONST_STRING_JUMBO: {
-        dex::StringIndex string_index((inst->Opcode() == Instruction::CONST_STRING)
-            ? inst->VRegB_21c()
-            : inst->VRegB_31c());
+        dex::StringIndex string_index((inst.Opcode() == Instruction::CONST_STRING)
+            ? inst.VRegB_21c()
+            : inst.VRegB_31c());
         mirror::String* string = class_linker->ResolveString(dex_file, string_index, dex_cache);
         CHECK(string != nullptr) << "Could not allocate a string when forcing determinism";
         break;
@@ -782,8 +778,6 @@
       default:
         break;
     }
-
-    code_ptr += inst->SizeInCodeUnits();
   }
 }
 
@@ -2439,21 +2433,16 @@
     if (clinit != nullptr) {
       const DexFile::CodeItem* code_item = clinit->GetCodeItem();
       DCHECK(code_item != nullptr);
-      const Instruction* inst = Instruction::At(code_item->insns_);
-
-      const uint32_t insns_size = code_item->insns_size_in_code_units_;
-      for (uint32_t dex_pc = 0; dex_pc < insns_size;) {
-        if (inst->Opcode() == Instruction::CONST_STRING) {
+      for (const Instruction& inst : code_item->Instructions()) {
+        if (inst.Opcode() == Instruction::CONST_STRING) {
           ObjPtr<mirror::String> s = class_linker->ResolveString(
-              *dex_file, dex::StringIndex(inst->VRegB_21c()), h_dex_cache);
+              *dex_file, dex::StringIndex(inst.VRegB_21c()), h_dex_cache);
           CHECK(s != nullptr);
-        } else if (inst->Opcode() == Instruction::CONST_STRING_JUMBO) {
+        } else if (inst.Opcode() == Instruction::CONST_STRING_JUMBO) {
           ObjPtr<mirror::String> s = class_linker->ResolveString(
-              *dex_file, dex::StringIndex(inst->VRegB_31c()), h_dex_cache);
+              *dex_file, dex::StringIndex(inst.VRegB_31c()), h_dex_cache);
           CHECK(s != nullptr);
         }
-        dex_pc += inst->SizeInCodeUnits();
-        inst = inst->Next();
       }
     }
   }
diff --git a/compiler/optimizing/bounds_check_elimination.cc b/compiler/optimizing/bounds_check_elimination.cc
index a170734..a7f7bce 100644
--- a/compiler/optimizing/bounds_check_elimination.cc
+++ b/compiler/optimizing/bounds_check_elimination.cc
@@ -927,7 +927,7 @@
 
   void VisitPhi(HPhi* phi) OVERRIDE {
     if (phi->IsLoopHeaderPhi()
-        && (phi->GetType() == Primitive::kPrimInt)
+        && (phi->GetType() == DataType::Type::kInt32)
         && HasSameInputAtBackEdges(phi)) {
       HInstruction* instruction = phi->InputAt(1);
       HInstruction *left;
@@ -1261,8 +1261,8 @@
       DCHECK_GE(min_c, 0);
     } else {
       HInstruction* lower = new (GetGraph()->GetArena())
-          HAdd(Primitive::kPrimInt, base, GetGraph()->GetIntConstant(min_c));
-      upper = new (GetGraph()->GetArena()) HAdd(Primitive::kPrimInt, base, upper);
+          HAdd(DataType::Type::kInt32, base, GetGraph()->GetIntConstant(min_c));
+      upper = new (GetGraph()->GetArena()) HAdd(DataType::Type::kInt32, base, upper);
       block->InsertInstructionBefore(lower, bounds_check);
       block->InsertInstructionBefore(upper, bounds_check);
       InsertDeoptInBlock(bounds_check, new (GetGraph()->GetArena()) HAbove(lower, upper));
@@ -1801,7 +1801,7 @@
       // Scan all instructions in a new deoptimization block.
       for (HInstructionIterator it(true_block->GetInstructions()); !it.Done(); it.Advance()) {
         HInstruction* instruction = it.Current();
-        Primitive::Type type = instruction->GetType();
+        DataType::Type type = instruction->GetType();
         HPhi* phi = nullptr;
         // Scan all uses of an instruction and replace each later use with a phi node.
         const HUseList<HInstruction*>& uses = instruction->GetUses();
@@ -1844,20 +1844,20 @@
    */
   HPhi* NewPhi(HBasicBlock* new_preheader,
                HInstruction* instruction,
-               Primitive::Type type) {
+               DataType::Type type) {
     HGraph* graph = GetGraph();
     HInstruction* zero;
     switch (type) {
-      case Primitive::kPrimNot: zero = graph->GetNullConstant(); break;
-      case Primitive::kPrimFloat: zero = graph->GetFloatConstant(0); break;
-      case Primitive::kPrimDouble: zero = graph->GetDoubleConstant(0); break;
+      case DataType::Type::kReference: zero = graph->GetNullConstant(); break;
+      case DataType::Type::kFloat32: zero = graph->GetFloatConstant(0); break;
+      case DataType::Type::kFloat64: zero = graph->GetDoubleConstant(0); break;
       default: zero = graph->GetConstant(type, 0); break;
     }
     HPhi* phi = new (graph->GetArena())
         HPhi(graph->GetArena(), kNoRegNumber, /*number_of_inputs*/ 2, HPhi::ToPhiType(type));
     phi->SetRawInputAt(0, instruction);
     phi->SetRawInputAt(1, zero);
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       phi->SetReferenceTypeInfo(instruction->GetReferenceTypeInfo());
     }
     new_preheader->AddPhi(phi);
diff --git a/compiler/optimizing/bounds_check_elimination_test.cc b/compiler/optimizing/bounds_check_elimination_test.cc
index 2aaf058..851838c 100644
--- a/compiler/optimizing/bounds_check_elimination_test.cc
+++ b/compiler/optimizing/bounds_check_elimination_test.cc
@@ -70,10 +70,10 @@
   HBasicBlock* entry = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
-  HInstruction* parameter1 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);  // array
-  HInstruction* parameter2 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);  // i
+  HInstruction* parameter1 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);  // array
+  HInstruction* parameter2 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);  // i
   entry->AddInstruction(parameter1);
   entry->AddInstruction(parameter2);
 
@@ -95,7 +95,7 @@
   HBoundsCheck* bounds_check2 = new (&allocator_)
       HBoundsCheck(parameter2, array_length, 0);
   HArraySet* array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check2, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check2, constant_1, DataType::Type::kInt32, 0);
   block2->AddInstruction(null_check);
   block2->AddInstruction(array_length);
   block2->AddInstruction(bounds_check2);
@@ -119,7 +119,7 @@
   HBoundsCheck* bounds_check4 = new (&allocator_)
       HBoundsCheck(parameter2, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check4, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check4, constant_1, DataType::Type::kInt32, 0);
   block4->AddInstruction(null_check);
   block4->AddInstruction(array_length);
   block4->AddInstruction(bounds_check4);
@@ -132,7 +132,7 @@
   HBoundsCheck* bounds_check5 = new (&allocator_)
       HBoundsCheck(parameter2, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check5, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check5, constant_1, DataType::Type::kInt32, 0);
   block5->AddInstruction(null_check);
   block5->AddInstruction(array_length);
   block5->AddInstruction(bounds_check5);
@@ -167,10 +167,10 @@
   HBasicBlock* entry = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
-  HInstruction* parameter1 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);  // array
-  HInstruction* parameter2 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);  // i
+  HInstruction* parameter1 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);  // array
+  HInstruction* parameter2 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);  // i
   entry->AddInstruction(parameter1);
   entry->AddInstruction(parameter2);
 
@@ -188,7 +188,7 @@
 
   HBasicBlock* block2 = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(block2);
-  HInstruction* add = new (&allocator_) HAdd(Primitive::kPrimInt, parameter2, constant_max_int);
+  HInstruction* add = new (&allocator_) HAdd(DataType::Type::kInt32, parameter2, constant_max_int);
   HNullCheck* null_check = new (&allocator_) HNullCheck(parameter1, 0);
   HArrayLength* array_length = new (&allocator_) HArrayLength(null_check, 0);
   HInstruction* cmp2 = new (&allocator_) HGreaterThanOrEqual(add, array_length);
@@ -204,7 +204,7 @@
   HBoundsCheck* bounds_check = new (&allocator_)
       HBoundsCheck(add, array_length, 0);
   HArraySet* array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check, constant_1, DataType::Type::kInt32, 0);
   block3->AddInstruction(bounds_check);
   block3->AddInstruction(array_set);
 
@@ -231,10 +231,10 @@
   HBasicBlock* entry = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
-  HInstruction* parameter1 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);  // array
-  HInstruction* parameter2 = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);  // i
+  HInstruction* parameter1 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);  // array
+  HInstruction* parameter2 = new (&allocator_) HParameterValue(
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);  // i
   entry->AddInstruction(parameter1);
   entry->AddInstruction(parameter2);
 
@@ -256,8 +256,8 @@
 
   HBasicBlock* block2 = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(block2);
-  HInstruction* sub1 = new (&allocator_) HSub(Primitive::kPrimInt, parameter2, constant_max_int);
-  HInstruction* sub2 = new (&allocator_) HSub(Primitive::kPrimInt, sub1, constant_max_int);
+  HInstruction* sub1 = new (&allocator_) HSub(DataType::Type::kInt32, parameter2, constant_max_int);
+  HInstruction* sub2 = new (&allocator_) HSub(DataType::Type::kInt32, sub1, constant_max_int);
   HInstruction* cmp2 = new (&allocator_) HLessThanOrEqual(sub2, constant_0);
   if_inst = new (&allocator_) HIf(cmp2);
   block2->AddInstruction(sub1);
@@ -270,7 +270,7 @@
   HBoundsCheck* bounds_check = new (&allocator_)
       HBoundsCheck(sub2, array_length, 0);
   HArraySet* array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check, constant_1, DataType::Type::kInt32, 0);
   block3->AddInstruction(bounds_check);
   block3->AddInstruction(array_set);
 
@@ -296,7 +296,7 @@
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
   HInstruction* parameter = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HInstruction* constant_5 = graph_->GetIntConstant(5);
@@ -313,7 +313,7 @@
   HBoundsCheck* bounds_check6 = new (&allocator_)
       HBoundsCheck(constant_6, array_length, 0);
   HInstruction* array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check6, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check6, constant_1, DataType::Type::kInt32, 0);
   block->AddInstruction(null_check);
   block->AddInstruction(array_length);
   block->AddInstruction(bounds_check6);
@@ -324,7 +324,7 @@
   HBoundsCheck* bounds_check5 = new (&allocator_)
       HBoundsCheck(constant_5, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check5, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check5, constant_1, DataType::Type::kInt32, 0);
   block->AddInstruction(null_check);
   block->AddInstruction(array_length);
   block->AddInstruction(bounds_check5);
@@ -335,7 +335,7 @@
   HBoundsCheck* bounds_check4 = new (&allocator_)
       HBoundsCheck(constant_4, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-    null_check, bounds_check4, constant_1, Primitive::kPrimInt, 0);
+    null_check, bounds_check4, constant_1, DataType::Type::kInt32, 0);
   block->AddInstruction(null_check);
   block->AddInstruction(array_length);
   block->AddInstruction(bounds_check4);
@@ -365,7 +365,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -389,7 +389,7 @@
   loop_header->AddSuccessor(loop_body);  // false successor
   loop_body->AddSuccessor(loop_header);
 
-  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, Primitive::kPrimInt);
+  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, DataType::Type::kInt32);
   HInstruction* null_check = new (allocator) HNullCheck(parameter, 0);
   HInstruction* array_length = new (allocator) HArrayLength(null_check, 0);
   HInstruction* cmp = nullptr;
@@ -411,9 +411,9 @@
   array_length = new (allocator) HArrayLength(null_check, 0);
   HInstruction* bounds_check = new (allocator) HBoundsCheck(phi, array_length, 0);
   HInstruction* array_set = new (allocator) HArraySet(
-      null_check, bounds_check, constant_10, Primitive::kPrimInt, 0);
+      null_check, bounds_check, constant_10, DataType::Type::kInt32, 0);
 
-  HInstruction* add = new (allocator) HAdd(Primitive::kPrimInt, phi, constant_increment);
+  HInstruction* add = new (allocator) HAdd(DataType::Type::kInt32, phi, constant_increment);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
   loop_body->AddInstruction(bounds_check);
@@ -480,7 +480,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -509,7 +509,7 @@
   loop_header->AddSuccessor(loop_body);  // false successor
   loop_body->AddSuccessor(loop_header);
 
-  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, Primitive::kPrimInt);
+  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, DataType::Type::kInt32);
   HInstruction* cmp = nullptr;
   if (cond == kCondLE) {
     cmp = new (allocator) HLessThanOrEqual(phi, constant_initial);
@@ -523,13 +523,13 @@
   loop_header->AddInstruction(if_inst);
   phi->AddInput(array_length);
 
-  HInstruction* add = new (allocator) HAdd(Primitive::kPrimInt, phi, constant_minus_1);
+  HInstruction* add = new (allocator) HAdd(DataType::Type::kInt32, phi, constant_minus_1);
   null_check = new (allocator) HNullCheck(parameter, 0);
   array_length = new (allocator) HArrayLength(null_check, 0);
   HInstruction* bounds_check = new (allocator) HBoundsCheck(add, array_length, 0);
   HInstruction* array_set = new (allocator) HArraySet(
-      null_check, bounds_check, constant_10, Primitive::kPrimInt, 0);
-  HInstruction* add_phi = new (allocator) HAdd(Primitive::kPrimInt, phi, constant_increment);
+      null_check, bounds_check, constant_10, DataType::Type::kInt32, 0);
+  HInstruction* add_phi = new (allocator) HAdd(DataType::Type::kInt32, phi, constant_increment);
   loop_body->AddInstruction(add);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
@@ -617,7 +617,7 @@
   loop_header->AddSuccessor(loop_body);  // false successor
   loop_body->AddSuccessor(loop_header);
 
-  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, Primitive::kPrimInt);
+  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, DataType::Type::kInt32);
   HInstruction* cmp = nullptr;
   if (cond == kCondGE) {
     cmp = new (allocator) HGreaterThanOrEqual(phi, constant_10);
@@ -635,8 +635,8 @@
   HArrayLength* array_length = new (allocator) HArrayLength(null_check, 0);
   HInstruction* bounds_check = new (allocator) HBoundsCheck(phi, array_length, 0);
   HInstruction* array_set = new (allocator) HArraySet(
-      null_check, bounds_check, constant_10, Primitive::kPrimInt, 0);
-  HInstruction* add = new (allocator) HAdd(Primitive::kPrimInt, phi, constant_increment);
+      null_check, bounds_check, constant_10, DataType::Type::kInt32, 0);
+  HInstruction* add = new (allocator) HAdd(DataType::Type::kInt32, phi, constant_increment);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
   loop_body->AddInstruction(bounds_check);
@@ -691,7 +691,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -716,7 +716,7 @@
   loop_header->AddSuccessor(loop_body);  // false successor
   loop_body->AddSuccessor(loop_header);
 
-  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, Primitive::kPrimInt);
+  HPhi* phi = new (allocator) HPhi(allocator, 0, 0, DataType::Type::kInt32);
   HInstruction* null_check = new (allocator) HNullCheck(parameter, 0);
   HInstruction* array_length = new (allocator) HArrayLength(null_check, 0);
   HInstruction* cmp = nullptr;
@@ -735,13 +735,13 @@
 
   null_check = new (allocator) HNullCheck(parameter, 0);
   array_length = new (allocator) HArrayLength(null_check, 0);
-  HInstruction* sub = new (allocator) HSub(Primitive::kPrimInt, array_length, phi);
+  HInstruction* sub = new (allocator) HSub(DataType::Type::kInt32, array_length, phi);
   HInstruction* add_minus_1 = new (allocator)
-      HAdd(Primitive::kPrimInt, sub, constant_minus_1);
+      HAdd(DataType::Type::kInt32, sub, constant_minus_1);
   HInstruction* bounds_check = new (allocator) HBoundsCheck(add_minus_1, array_length, 0);
   HInstruction* array_set = new (allocator) HArraySet(
-      null_check, bounds_check, constant_10, Primitive::kPrimInt, 0);
-  HInstruction* add = new (allocator) HAdd(Primitive::kPrimInt, phi, constant_1);
+      null_check, bounds_check, constant_10, DataType::Type::kInt32, 0);
+  HInstruction* add = new (allocator) HAdd(DataType::Type::kInt32, phi, constant_1);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
   loop_body->AddInstruction(sub);
@@ -794,7 +794,7 @@
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
   HInstruction* parameter = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HInstruction* constant_0 = graph_->GetIntConstant(0);
@@ -812,10 +812,10 @@
 
   HBasicBlock* outer_header = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(outer_header);
-  HPhi* phi_i = new (&allocator_) HPhi(&allocator_, 0, 0, Primitive::kPrimInt);
+  HPhi* phi_i = new (&allocator_) HPhi(&allocator_, 0, 0, DataType::Type::kInt32);
   HNullCheck* null_check = new (&allocator_) HNullCheck(parameter, 0);
   HArrayLength* array_length = new (&allocator_) HArrayLength(null_check, 0);
-  HAdd* add = new (&allocator_) HAdd(Primitive::kPrimInt, array_length, constant_minus_1);
+  HAdd* add = new (&allocator_) HAdd(DataType::Type::kInt32, array_length, constant_minus_1);
   HInstruction* cmp = new (&allocator_) HGreaterThanOrEqual(phi_i, add);
   HIf* if_inst = new (&allocator_) HIf(cmp);
   outer_header->AddPhi(phi_i);
@@ -828,11 +828,11 @@
 
   HBasicBlock* inner_header = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(inner_header);
-  HPhi* phi_j = new (&allocator_) HPhi(&allocator_, 0, 0, Primitive::kPrimInt);
+  HPhi* phi_j = new (&allocator_) HPhi(&allocator_, 0, 0, DataType::Type::kInt32);
   null_check = new (&allocator_) HNullCheck(parameter, 0);
   array_length = new (&allocator_) HArrayLength(null_check, 0);
-  HSub* sub = new (&allocator_) HSub(Primitive::kPrimInt, array_length, phi_i);
-  add = new (&allocator_) HAdd(Primitive::kPrimInt, sub, constant_minus_1);
+  HSub* sub = new (&allocator_) HSub(DataType::Type::kInt32, array_length, phi_i);
+  add = new (&allocator_) HAdd(DataType::Type::kInt32, sub, constant_minus_1);
   cmp = new (&allocator_) HGreaterThanOrEqual(phi_j, add);
   if_inst = new (&allocator_) HIf(cmp);
   inner_header->AddPhi(phi_j);
@@ -850,17 +850,17 @@
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HBoundsCheck* bounds_check1 = new (&allocator_) HBoundsCheck(phi_j, array_length, 0);
   HArrayGet* array_get_j = new (&allocator_)
-      HArrayGet(null_check, bounds_check1, Primitive::kPrimInt, 0);
+      HArrayGet(null_check, bounds_check1, DataType::Type::kInt32, 0);
   inner_body_compare->AddInstruction(null_check);
   inner_body_compare->AddInstruction(array_length);
   inner_body_compare->AddInstruction(bounds_check1);
   inner_body_compare->AddInstruction(array_get_j);
-  HInstruction* j_plus_1 = new (&allocator_) HAdd(Primitive::kPrimInt, phi_j, constant_1);
+  HInstruction* j_plus_1 = new (&allocator_) HAdd(DataType::Type::kInt32, phi_j, constant_1);
   null_check = new (&allocator_) HNullCheck(parameter, 0);
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HBoundsCheck* bounds_check2 = new (&allocator_) HBoundsCheck(j_plus_1, array_length, 0);
   HArrayGet* array_get_j_plus_1 = new (&allocator_)
-      HArrayGet(null_check, bounds_check2, Primitive::kPrimInt, 0);
+      HArrayGet(null_check, bounds_check2, DataType::Type::kInt32, 0);
   cmp = new (&allocator_) HGreaterThanOrEqual(array_get_j, array_get_j_plus_1);
   if_inst = new (&allocator_) HIf(cmp);
   inner_body_compare->AddInstruction(j_plus_1);
@@ -873,13 +873,13 @@
 
   HBasicBlock* inner_body_swap = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(inner_body_swap);
-  j_plus_1 = new (&allocator_) HAdd(Primitive::kPrimInt, phi_j, constant_1);
+  j_plus_1 = new (&allocator_) HAdd(DataType::Type::kInt32, phi_j, constant_1);
   // temp = array[j+1]
   null_check = new (&allocator_) HNullCheck(parameter, 0);
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HInstruction* bounds_check3 = new (&allocator_) HBoundsCheck(j_plus_1, array_length, 0);
   array_get_j_plus_1 = new (&allocator_)
-      HArrayGet(null_check, bounds_check3, Primitive::kPrimInt, 0);
+      HArrayGet(null_check, bounds_check3, DataType::Type::kInt32, 0);
   inner_body_swap->AddInstruction(j_plus_1);
   inner_body_swap->AddInstruction(null_check);
   inner_body_swap->AddInstruction(array_length);
@@ -890,7 +890,7 @@
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HInstruction* bounds_check4 = new (&allocator_) HBoundsCheck(phi_j, array_length, 0);
   array_get_j = new (&allocator_)
-      HArrayGet(null_check, bounds_check4, Primitive::kPrimInt, 0);
+      HArrayGet(null_check, bounds_check4, DataType::Type::kInt32, 0);
   inner_body_swap->AddInstruction(null_check);
   inner_body_swap->AddInstruction(array_length);
   inner_body_swap->AddInstruction(bounds_check4);
@@ -899,7 +899,7 @@
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HInstruction* bounds_check5 = new (&allocator_) HBoundsCheck(j_plus_1, array_length, 0);
   HArraySet* array_set_j_plus_1 = new (&allocator_)
-      HArraySet(null_check, bounds_check5, array_get_j, Primitive::kPrimInt, 0);
+      HArraySet(null_check, bounds_check5, array_get_j, DataType::Type::kInt32, 0);
   inner_body_swap->AddInstruction(null_check);
   inner_body_swap->AddInstruction(array_length);
   inner_body_swap->AddInstruction(bounds_check5);
@@ -909,7 +909,7 @@
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HInstruction* bounds_check6 = new (&allocator_) HBoundsCheck(phi_j, array_length, 0);
   HArraySet* array_set_j = new (&allocator_)
-      HArraySet(null_check, bounds_check6, array_get_j_plus_1, Primitive::kPrimInt, 0);
+      HArraySet(null_check, bounds_check6, array_get_j_plus_1, DataType::Type::kInt32, 0);
   inner_body_swap->AddInstruction(null_check);
   inner_body_swap->AddInstruction(array_length);
   inner_body_swap->AddInstruction(bounds_check6);
@@ -918,14 +918,14 @@
 
   HBasicBlock* inner_body_add = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(inner_body_add);
-  add = new (&allocator_) HAdd(Primitive::kPrimInt, phi_j, constant_1);
+  add = new (&allocator_) HAdd(DataType::Type::kInt32, phi_j, constant_1);
   inner_body_add->AddInstruction(add);
   inner_body_add->AddInstruction(new (&allocator_) HGoto());
   phi_j->AddInput(add);
 
   HBasicBlock* outer_body_add = new (&allocator_) HBasicBlock(graph_);
   graph_->AddBlock(outer_body_add);
-  add = new (&allocator_) HAdd(Primitive::kPrimInt, phi_i, constant_1);
+  add = new (&allocator_) HAdd(DataType::Type::kInt32, phi_i, constant_1);
   outer_body_add->AddInstruction(add);
   outer_body_add->AddInstruction(new (&allocator_) HGoto());
   phi_i->AddInput(add);
@@ -965,7 +965,7 @@
   graph_->AddBlock(entry);
   graph_->SetEntryBlock(entry);
   HInstruction* param_i = new (&allocator_)
-      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   entry->AddInstruction(param_i);
 
   HInstruction* constant_0 = graph_->GetIntConstant(0);
@@ -994,7 +994,7 @@
   loop_header->AddSuccessor(loop_body);  // false successor
   loop_body->AddSuccessor(loop_header);
 
-  HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, Primitive::kPrimInt);
+  HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, DataType::Type::kInt32);
   HInstruction* cmp = new (&allocator_) HGreaterThanOrEqual(phi, constant_200);
   HInstruction* if_inst = new (&allocator_) HIf(cmp);
   loop_header->AddPhi(phi);
@@ -1005,38 +1005,38 @@
   //////////////////////////////////////////////////////////////////////////////////
   // LOOP BODY:
   // array[i % 10] = 10;
-  HRem* i_mod_10 = new (&allocator_) HRem(Primitive::kPrimInt, phi, constant_10, 0);
+  HRem* i_mod_10 = new (&allocator_) HRem(DataType::Type::kInt32, phi, constant_10, 0);
   HBoundsCheck* bounds_check_i_mod_10 = new (&allocator_) HBoundsCheck(i_mod_10, constant_10, 0);
   HInstruction* array_set = new (&allocator_) HArraySet(
-      new_array, bounds_check_i_mod_10, constant_10, Primitive::kPrimInt, 0);
+      new_array, bounds_check_i_mod_10, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(i_mod_10);
   loop_body->AddInstruction(bounds_check_i_mod_10);
   loop_body->AddInstruction(array_set);
 
   // array[i % 1] = 10;
-  HRem* i_mod_1 = new (&allocator_) HRem(Primitive::kPrimInt, phi, constant_1, 0);
+  HRem* i_mod_1 = new (&allocator_) HRem(DataType::Type::kInt32, phi, constant_1, 0);
   HBoundsCheck* bounds_check_i_mod_1 = new (&allocator_) HBoundsCheck(i_mod_1, constant_10, 0);
   array_set = new (&allocator_) HArraySet(
-      new_array, bounds_check_i_mod_1, constant_10, Primitive::kPrimInt, 0);
+      new_array, bounds_check_i_mod_1, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(i_mod_1);
   loop_body->AddInstruction(bounds_check_i_mod_1);
   loop_body->AddInstruction(array_set);
 
   // array[i % 200] = 10;
-  HRem* i_mod_200 = new (&allocator_) HRem(Primitive::kPrimInt, phi, constant_1, 0);
+  HRem* i_mod_200 = new (&allocator_) HRem(DataType::Type::kInt32, phi, constant_1, 0);
   HBoundsCheck* bounds_check_i_mod_200 = new (&allocator_) HBoundsCheck(i_mod_200, constant_10, 0);
   array_set = new (&allocator_) HArraySet(
-      new_array, bounds_check_i_mod_200, constant_10, Primitive::kPrimInt, 0);
+      new_array, bounds_check_i_mod_200, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(i_mod_200);
   loop_body->AddInstruction(bounds_check_i_mod_200);
   loop_body->AddInstruction(array_set);
 
   // array[i % -10] = 10;
-  HRem* i_mod_minus_10 = new (&allocator_) HRem(Primitive::kPrimInt, phi, constant_minus_10, 0);
+  HRem* i_mod_minus_10 = new (&allocator_) HRem(DataType::Type::kInt32, phi, constant_minus_10, 0);
   HBoundsCheck* bounds_check_i_mod_minus_10 = new (&allocator_) HBoundsCheck(
       i_mod_minus_10, constant_10, 0);
   array_set = new (&allocator_) HArraySet(
-      new_array, bounds_check_i_mod_minus_10, constant_10, Primitive::kPrimInt, 0);
+      new_array, bounds_check_i_mod_minus_10, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(i_mod_minus_10);
   loop_body->AddInstruction(bounds_check_i_mod_minus_10);
   loop_body->AddInstruction(array_set);
@@ -1044,11 +1044,11 @@
   // array[i%array.length] = 10;
   HNullCheck* null_check = new (&allocator_) HNullCheck(new_array, 0);
   HArrayLength* array_length = new (&allocator_) HArrayLength(null_check, 0);
-  HRem* i_mod_array_length = new (&allocator_) HRem(Primitive::kPrimInt, phi, array_length, 0);
+  HRem* i_mod_array_length = new (&allocator_) HRem(DataType::Type::kInt32, phi, array_length, 0);
   HBoundsCheck* bounds_check_i_mod_array_len = new (&allocator_) HBoundsCheck(
       i_mod_array_length, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-      null_check, bounds_check_i_mod_array_len, constant_10, Primitive::kPrimInt, 0);
+      null_check, bounds_check_i_mod_array_len, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
   loop_body->AddInstruction(i_mod_array_length);
@@ -1056,11 +1056,11 @@
   loop_body->AddInstruction(array_set);
 
   // array[param_i % 10] = 10;
-  HRem* param_i_mod_10 = new (&allocator_) HRem(Primitive::kPrimInt, param_i, constant_10, 0);
+  HRem* param_i_mod_10 = new (&allocator_) HRem(DataType::Type::kInt32, param_i, constant_10, 0);
   HBoundsCheck* bounds_check_param_i_mod_10 = new (&allocator_) HBoundsCheck(
       param_i_mod_10, constant_10, 0);
   array_set = new (&allocator_) HArraySet(
-      new_array, bounds_check_param_i_mod_10, constant_10, Primitive::kPrimInt, 0);
+      new_array, bounds_check_param_i_mod_10, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(param_i_mod_10);
   loop_body->AddInstruction(bounds_check_param_i_mod_10);
   loop_body->AddInstruction(array_set);
@@ -1069,11 +1069,11 @@
   null_check = new (&allocator_) HNullCheck(new_array, 0);
   array_length = new (&allocator_) HArrayLength(null_check, 0);
   HRem* param_i_mod_array_length = new (&allocator_) HRem(
-      Primitive::kPrimInt, param_i, array_length, 0);
+      DataType::Type::kInt32, param_i, array_length, 0);
   HBoundsCheck* bounds_check_param_i_mod_array_len = new (&allocator_) HBoundsCheck(
       param_i_mod_array_length, array_length, 0);
   array_set = new (&allocator_) HArraySet(
-      null_check, bounds_check_param_i_mod_array_len, constant_10, Primitive::kPrimInt, 0);
+      null_check, bounds_check_param_i_mod_array_len, constant_10, DataType::Type::kInt32, 0);
   loop_body->AddInstruction(null_check);
   loop_body->AddInstruction(array_length);
   loop_body->AddInstruction(param_i_mod_array_length);
@@ -1081,7 +1081,7 @@
   loop_body->AddInstruction(array_set);
 
   // i++;
-  HInstruction* add = new (&allocator_) HAdd(Primitive::kPrimInt, phi, constant_1);
+  HInstruction* add = new (&allocator_) HAdd(DataType::Type::kInt32, phi, constant_1);
   loop_body->AddInstruction(add);
   loop_body->AddInstruction(new (&allocator_) HGoto());
   phi->AddInput(add);
diff --git a/compiler/optimizing/builder.cc b/compiler/optimizing/builder.cc
index 0d9d3d4..0e708ed 100644
--- a/compiler/optimizing/builder.cc
+++ b/compiler/optimizing/builder.cc
@@ -20,17 +20,52 @@
 #include "base/arena_bit_vector.h"
 #include "base/bit_vector-inl.h"
 #include "base/logging.h"
+#include "data_type-inl.h"
 #include "dex/verified_method.h"
 #include "driver/compiler_options.h"
 #include "mirror/class_loader.h"
 #include "mirror/dex_cache.h"
 #include "nodes.h"
-#include "primitive.h"
 #include "thread.h"
 #include "utils/dex_cache_arrays_layout-inl.h"
 
 namespace art {
 
+HGraphBuilder::HGraphBuilder(HGraph* graph,
+                             DexCompilationUnit* dex_compilation_unit,
+                             const DexCompilationUnit* const outer_compilation_unit,
+                             CompilerDriver* driver,
+                             CodeGenerator* code_generator,
+                             OptimizingCompilerStats* compiler_stats,
+                             const uint8_t* interpreter_metadata,
+                             Handle<mirror::DexCache> dex_cache,
+                             VariableSizedHandleScope* handles)
+    : graph_(graph),
+      dex_file_(&graph->GetDexFile()),
+      code_item_(*dex_compilation_unit->GetCodeItem()),
+      dex_compilation_unit_(dex_compilation_unit),
+      compiler_driver_(driver),
+      compilation_stats_(compiler_stats),
+      block_builder_(graph, dex_file_, code_item_),
+      ssa_builder_(graph,
+                   dex_compilation_unit->GetClassLoader(),
+                   dex_compilation_unit->GetDexCache(),
+                   handles),
+      instruction_builder_(graph,
+                           &block_builder_,
+                           &ssa_builder_,
+                           dex_file_,
+                           code_item_,
+                           DataType::FromShorty(dex_compilation_unit_->GetShorty()[0]),
+                           dex_compilation_unit,
+                           outer_compilation_unit,
+                           driver,
+                           code_generator,
+                           interpreter_metadata,
+                           compiler_stats,
+                           dex_cache,
+                           handles) {}
+
 bool HGraphBuilder::SkipCompilation(size_t number_of_branches) {
   if (compiler_driver_ == nullptr) {
     // Note that the compiler driver is null when unit testing.
diff --git a/compiler/optimizing/builder.h b/compiler/optimizing/builder.h
index 2c9a9ef..9524fe2 100644
--- a/compiler/optimizing/builder.h
+++ b/compiler/optimizing/builder.h
@@ -27,7 +27,6 @@
 #include "instruction_builder.h"
 #include "nodes.h"
 #include "optimizing_compiler_stats.h"
-#include "primitive.h"
 #include "ssa_builder.h"
 
 namespace art {
@@ -39,45 +38,18 @@
   HGraphBuilder(HGraph* graph,
                 DexCompilationUnit* dex_compilation_unit,
                 const DexCompilationUnit* const outer_compilation_unit,
-                const DexFile* dex_file,
-                const DexFile::CodeItem& code_item,
                 CompilerDriver* driver,
                 CodeGenerator* code_generator,
                 OptimizingCompilerStats* compiler_stats,
                 const uint8_t* interpreter_metadata,
                 Handle<mirror::DexCache> dex_cache,
-                VariableSizedHandleScope* handles)
-      : graph_(graph),
-        dex_file_(dex_file),
-        code_item_(code_item),
-        dex_compilation_unit_(dex_compilation_unit),
-        compiler_driver_(driver),
-        compilation_stats_(compiler_stats),
-        block_builder_(graph, dex_file, code_item),
-        ssa_builder_(graph,
-                     dex_compilation_unit->GetClassLoader(),
-                     dex_compilation_unit->GetDexCache(),
-                     handles),
-        instruction_builder_(graph,
-                             &block_builder_,
-                             &ssa_builder_,
-                             dex_file,
-                             code_item_,
-                             Primitive::GetType(dex_compilation_unit_->GetShorty()[0]),
-                             dex_compilation_unit,
-                             outer_compilation_unit,
-                             driver,
-                             code_generator,
-                             interpreter_metadata,
-                             compiler_stats,
-                             dex_cache,
-                             handles) {}
+                VariableSizedHandleScope* handles);
 
   // Only for unit testing.
   HGraphBuilder(HGraph* graph,
                 const DexFile::CodeItem& code_item,
                 VariableSizedHandleScope* handles,
-                Primitive::Type return_type = Primitive::kPrimInt)
+                DataType::Type return_type = DataType::Type::kInt32)
       : graph_(graph),
         dex_file_(nullptr),
         code_item_(code_item),
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index 6533e2b..3cb3792 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -68,35 +68,35 @@
 static constexpr bool kEnableDexLayoutOptimizations = false;
 
 // Return whether a location is consistent with a type.
-static bool CheckType(Primitive::Type type, Location location) {
+static bool CheckType(DataType::Type type, Location location) {
   if (location.IsFpuRegister()
       || (location.IsUnallocated() && (location.GetPolicy() == Location::kRequiresFpuRegister))) {
-    return (type == Primitive::kPrimFloat) || (type == Primitive::kPrimDouble);
+    return (type == DataType::Type::kFloat32) || (type == DataType::Type::kFloat64);
   } else if (location.IsRegister() ||
              (location.IsUnallocated() && (location.GetPolicy() == Location::kRequiresRegister))) {
-    return Primitive::IsIntegralType(type) || (type == Primitive::kPrimNot);
+    return DataType::IsIntegralType(type) || (type == DataType::Type::kReference);
   } else if (location.IsRegisterPair()) {
-    return type == Primitive::kPrimLong;
+    return type == DataType::Type::kInt64;
   } else if (location.IsFpuRegisterPair()) {
-    return type == Primitive::kPrimDouble;
+    return type == DataType::Type::kFloat64;
   } else if (location.IsStackSlot()) {
-    return (Primitive::IsIntegralType(type) && type != Primitive::kPrimLong)
-           || (type == Primitive::kPrimFloat)
-           || (type == Primitive::kPrimNot);
+    return (DataType::IsIntegralType(type) && type != DataType::Type::kInt64)
+           || (type == DataType::Type::kFloat32)
+           || (type == DataType::Type::kReference);
   } else if (location.IsDoubleStackSlot()) {
-    return (type == Primitive::kPrimLong) || (type == Primitive::kPrimDouble);
+    return (type == DataType::Type::kInt64) || (type == DataType::Type::kFloat64);
   } else if (location.IsConstant()) {
     if (location.GetConstant()->IsIntConstant()) {
-      return Primitive::IsIntegralType(type) && (type != Primitive::kPrimLong);
+      return DataType::IsIntegralType(type) && (type != DataType::Type::kInt64);
     } else if (location.GetConstant()->IsNullConstant()) {
-      return type == Primitive::kPrimNot;
+      return type == DataType::Type::kReference;
     } else if (location.GetConstant()->IsLongConstant()) {
-      return type == Primitive::kPrimLong;
+      return type == DataType::Type::kInt64;
     } else if (location.GetConstant()->IsFloatConstant()) {
-      return type == Primitive::kPrimFloat;
+      return type == DataType::Type::kFloat32;
     } else {
       return location.GetConstant()->IsDoubleConstant()
-          && (type == Primitive::kPrimDouble);
+          && (type == DataType::Type::kFloat64);
     }
   } else {
     return location.IsInvalid() || (location.GetPolicy() == Location::kAny);
@@ -130,7 +130,7 @@
   HEnvironment* environment = instruction->GetEnvironment();
   for (size_t i = 0; i < instruction->EnvironmentSize(); ++i) {
     if (environment->GetInstructionAt(i) != nullptr) {
-      Primitive::Type type = environment->GetInstructionAt(i)->GetType();
+      DataType::Type type = environment->GetInstructionAt(i)->GetType();
       DCHECK(CheckType(type, environment->GetLocationAt(i)))
         << type << " " << environment->GetLocationAt(i);
     } else {
@@ -157,10 +157,10 @@
 }
 
 uint32_t CodeGenerator::GetArrayDataOffset(HArrayGet* array_get) {
-  DCHECK(array_get->GetType() == Primitive::kPrimChar || !array_get->IsStringCharAt());
+  DCHECK(array_get->GetType() == DataType::Type::kUint16 || !array_get->IsStringCharAt());
   return array_get->IsStringCharAt()
       ? mirror::String::ValueOffset().Uint32Value()
-      : mirror::Array::DataOffset(Primitive::ComponentSize(array_get->GetType())).Uint32Value();
+      : mirror::Array::DataOffset(DataType::Size(array_get->GetType())).Uint32Value();
 }
 
 bool CodeGenerator::GoesToNextBlock(HBasicBlock* current, HBasicBlock* next) const {
@@ -413,7 +413,7 @@
 
 void CodeGenerator::CreateUnresolvedFieldLocationSummary(
     HInstruction* field_access,
-    Primitive::Type field_type,
+    DataType::Type field_type,
     const FieldAccessCallingConvention& calling_convention) {
   bool is_instance = field_access->IsUnresolvedInstanceFieldGet()
       || field_access->IsUnresolvedInstanceFieldSet();
@@ -435,7 +435,7 @@
   // regardless of the the type. Because of that we forced to special case
   // the access to floating point values.
   if (is_get) {
-    if (Primitive::IsFloatingPointType(field_type)) {
+    if (DataType::IsFloatingPointType(field_type)) {
       // The return value will be stored in regular registers while register
       // allocator expects it in a floating point register.
       // Note We don't need to request additional temps because the return
@@ -448,7 +448,7 @@
     }
   } else {
      size_t set_index = is_instance ? 1 : 0;
-     if (Primitive::IsFloatingPointType(field_type)) {
+     if (DataType::IsFloatingPointType(field_type)) {
       // The set value comes from a float location while the calling convention
       // expects it in a regular register location. Allocate a temp for it and
       // make the transfer at codegen.
@@ -463,7 +463,7 @@
 
 void CodeGenerator::GenerateUnresolvedFieldAccess(
     HInstruction* field_access,
-    Primitive::Type field_type,
+    DataType::Type field_type,
     uint32_t field_index,
     uint32_t dex_pc,
     const FieldAccessCallingConvention& calling_convention) {
@@ -476,51 +476,52 @@
   bool is_get = field_access->IsUnresolvedInstanceFieldGet()
       || field_access->IsUnresolvedStaticFieldGet();
 
-  if (!is_get && Primitive::IsFloatingPointType(field_type)) {
+  if (!is_get && DataType::IsFloatingPointType(field_type)) {
     // Copy the float value to be set into the calling convention register.
     // Note that using directly the temp location is problematic as we don't
     // support temp register pairs. To avoid boilerplate conversion code, use
     // the location from the calling convention.
     MoveLocation(calling_convention.GetSetValueLocation(field_type, is_instance),
                  locations->InAt(is_instance ? 1 : 0),
-                 (Primitive::Is64BitType(field_type) ? Primitive::kPrimLong : Primitive::kPrimInt));
+                 (DataType::Is64BitType(field_type) ? DataType::Type::kInt64
+                                                    : DataType::Type::kInt32));
   }
 
   QuickEntrypointEnum entrypoint = kQuickSet8Static;  // Initialize to anything to avoid warnings.
   switch (field_type) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       entrypoint = is_instance
           ? (is_get ? kQuickGetBooleanInstance : kQuickSet8Instance)
           : (is_get ? kQuickGetBooleanStatic : kQuickSet8Static);
       break;
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       entrypoint = is_instance
           ? (is_get ? kQuickGetByteInstance : kQuickSet8Instance)
           : (is_get ? kQuickGetByteStatic : kQuickSet8Static);
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       entrypoint = is_instance
           ? (is_get ? kQuickGetShortInstance : kQuickSet16Instance)
           : (is_get ? kQuickGetShortStatic : kQuickSet16Static);
       break;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       entrypoint = is_instance
           ? (is_get ? kQuickGetCharInstance : kQuickSet16Instance)
           : (is_get ? kQuickGetCharStatic : kQuickSet16Static);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       entrypoint = is_instance
           ? (is_get ? kQuickGet32Instance : kQuickSet32Instance)
           : (is_get ? kQuickGet32Static : kQuickSet32Static);
       break;
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       entrypoint = is_instance
           ? (is_get ? kQuickGetObjInstance : kQuickSetObjInstance)
           : (is_get ? kQuickGetObjStatic : kQuickSetObjStatic);
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       entrypoint = is_instance
           ? (is_get ? kQuickGet64Instance : kQuickSet64Instance)
           : (is_get ? kQuickGet64Static : kQuickSet64Static);
@@ -530,7 +531,7 @@
   }
   InvokeRuntime(entrypoint, field_access, dex_pc, nullptr);
 
-  if (is_get && Primitive::IsFloatingPointType(field_type)) {
+  if (is_get && DataType::IsFloatingPointType(field_type)) {
     MoveLocation(locations->Out(), calling_convention.GetReturnLocation(field_type), field_type);
   }
 }
@@ -721,12 +722,10 @@
     }
   }
   ArenaVector<size_t> covered(loop_headers.size(), 0, graph.GetArena()->Adapter(kArenaAllocMisc));
-  const uint16_t* code_ptr = code_item.insns_;
-  const uint16_t* code_end = code_item.insns_ + code_item.insns_size_in_code_units_;
-
-  size_t dex_pc = 0;
-  while (code_ptr < code_end) {
-    const Instruction& instruction = *Instruction::At(code_ptr);
+  IterationRange<DexInstructionIterator> instructions = code_item.Instructions();
+  for (auto it = instructions.begin(); it != instructions.end(); ++it) {
+    const uint32_t dex_pc = it.GetDexPC(instructions.begin());
+    const Instruction& instruction = *it;
     if (instruction.IsBranch()) {
       uint32_t target = dex_pc + instruction.GetTargetOffset();
       CheckCovers(target, graph, code_info, loop_headers, &covered);
@@ -742,8 +741,6 @@
         CheckCovers(target, graph, code_info, loop_headers, &covered);
       }
     }
-    dex_pc += instruction.SizeInCodeUnits();
-    code_ptr += instruction.SizeInCodeUnits();
   }
 
   for (size_t i = 0; i < covered.size(); ++i) {
@@ -780,8 +777,8 @@
       return;
     }
     if (instruction->IsRem()) {
-      Primitive::Type type = instruction->AsRem()->GetResultType();
-      if ((type == Primitive::kPrimFloat) || (type == Primitive::kPrimDouble)) {
+      DataType::Type type = instruction->AsRem()->GetResultType();
+      if ((type == DataType::Type::kFloat32) || (type == DataType::Type::kFloat64)) {
         return;
       }
     }
@@ -1052,7 +1049,7 @@
         if (slow_path != nullptr && slow_path->IsCoreRegisterSaved(id)) {
           uint32_t offset = slow_path->GetStackOffsetOfCoreRegister(id);
           stack_map_stream_.AddDexRegisterEntry(DexRegisterLocation::Kind::kInStack, offset);
-          if (current->GetType() == Primitive::kPrimLong) {
+          if (current->GetType() == DataType::Type::kInt64) {
             stack_map_stream_.AddDexRegisterEntry(
                 DexRegisterLocation::Kind::kInStack, offset + kVRegSize);
             ++i;
@@ -1060,7 +1057,7 @@
           }
         } else {
           stack_map_stream_.AddDexRegisterEntry(DexRegisterLocation::Kind::kInRegister, id);
-          if (current->GetType() == Primitive::kPrimLong) {
+          if (current->GetType() == DataType::Type::kInt64) {
             stack_map_stream_.AddDexRegisterEntry(DexRegisterLocation::Kind::kInRegisterHigh, id);
             ++i;
             DCHECK_LT(i, environment_size);
@@ -1074,7 +1071,7 @@
         if (slow_path != nullptr && slow_path->IsFpuRegisterSaved(id)) {
           uint32_t offset = slow_path->GetStackOffsetOfFpuRegister(id);
           stack_map_stream_.AddDexRegisterEntry(DexRegisterLocation::Kind::kInStack, offset);
-          if (current->GetType() == Primitive::kPrimDouble) {
+          if (current->GetType() == DataType::Type::kFloat64) {
             stack_map_stream_.AddDexRegisterEntry(
                 DexRegisterLocation::Kind::kInStack, offset + kVRegSize);
             ++i;
@@ -1082,7 +1079,7 @@
           }
         } else {
           stack_map_stream_.AddDexRegisterEntry(DexRegisterLocation::Kind::kInFpuRegister, id);
-          if (current->GetType() == Primitive::kPrimDouble) {
+          if (current->GetType() == DataType::Type::kFloat64) {
             stack_map_stream_.AddDexRegisterEntry(
                 DexRegisterLocation::Kind::kInFpuRegisterHigh, id);
             ++i;
@@ -1226,7 +1223,7 @@
     LiveInterval* interval = current->GetLiveInterval();
     // We only need to clear bits of loop phis containing objects and allocated in register.
     // Loop phis allocated on stack already have the object in the stack.
-    if (current->GetType() == Primitive::kPrimNot
+    if (current->GetType() == DataType::Type::kReference
         && interval->HasRegister()
         && interval->HasSpillSlot()) {
       locations->ClearStackBit(interval->GetSpillSlot() / kVRegSize);
@@ -1236,10 +1233,10 @@
 
 void CodeGenerator::EmitParallelMoves(Location from1,
                                       Location to1,
-                                      Primitive::Type type1,
+                                      DataType::Type type1,
                                       Location from2,
                                       Location to2,
-                                      Primitive::Type type2) {
+                                      DataType::Type type2) {
   HParallelMove parallel_move(GetGraph()->GetArena());
   parallel_move.AddMove(from1, to1, type1, nullptr);
   parallel_move.AddMove(from2, to2, type2, nullptr);
diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h
index 4b4abdf..ac3c839 100644
--- a/compiler/optimizing/code_generator.h
+++ b/compiler/optimizing/code_generator.h
@@ -146,8 +146,8 @@
 
 class InvokeDexCallingConventionVisitor {
  public:
-  virtual Location GetNextLocation(Primitive::Type type) = 0;
-  virtual Location GetReturnLocation(Primitive::Type type) const = 0;
+  virtual Location GetNextLocation(DataType::Type type) = 0;
+  virtual Location GetReturnLocation(DataType::Type type) const = 0;
   virtual Location GetMethodLocation() const = 0;
 
  protected:
@@ -169,9 +169,9 @@
  public:
   virtual Location GetObjectLocation() const = 0;
   virtual Location GetFieldIndexLocation() const = 0;
-  virtual Location GetReturnLocation(Primitive::Type type) const = 0;
-  virtual Location GetSetValueLocation(Primitive::Type type, bool is_instance) const = 0;
-  virtual Location GetFpuLocation(Primitive::Type type) const = 0;
+  virtual Location GetReturnLocation(DataType::Type type) const = 0;
+  virtual Location GetSetValueLocation(DataType::Type type, bool is_instance) const = 0;
+  virtual Location GetFpuLocation(DataType::Type type) const = 0;
   virtual ~FieldAccessCallingConvention() {}
 
  protected:
@@ -213,7 +213,7 @@
   virtual void GenerateFrameExit() = 0;
   virtual void Bind(HBasicBlock* block) = 0;
   virtual void MoveConstant(Location destination, int32_t value) = 0;
-  virtual void MoveLocation(Location dst, Location src, Primitive::Type dst_type) = 0;
+  virtual void MoveLocation(Location dst, Location src, DataType::Type dst_type) = 0;
   virtual void AddLocationAsTemp(Location location, LocationSummary* locations) = 0;
 
   virtual Assembler* GetAssembler() = 0;
@@ -265,7 +265,7 @@
   virtual size_t SaveFloatingPointRegister(size_t stack_index, uint32_t reg_id) = 0;
   virtual size_t RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) = 0;
 
-  virtual bool NeedsTwoRegisters(Primitive::Type type) const = 0;
+  virtual bool NeedsTwoRegisters(DataType::Type type) const = 0;
   // Returns whether we should split long moves in parallel moves.
   virtual bool ShouldSplitLongMoves() const { return false; }
 
@@ -407,15 +407,15 @@
 
   void EmitParallelMoves(Location from1,
                          Location to1,
-                         Primitive::Type type1,
+                         DataType::Type type1,
                          Location from2,
                          Location to2,
-                         Primitive::Type type2);
+                         DataType::Type type2);
 
-  static bool StoreNeedsWriteBarrier(Primitive::Type type, HInstruction* value) {
+  static bool StoreNeedsWriteBarrier(DataType::Type type, HInstruction* value) {
     // Check that null value is not represented as an integer constant.
-    DCHECK(type != Primitive::kPrimNot || !value->IsIntConstant());
-    return type == Primitive::kPrimNot && !value->IsNullConstant();
+    DCHECK(type != DataType::Type::kReference || !value->IsIntConstant());
+    return type == DataType::Type::kReference && !value->IsNullConstant();
   }
 
 
@@ -504,12 +504,12 @@
 
   void CreateUnresolvedFieldLocationSummary(
       HInstruction* field_access,
-      Primitive::Type field_type,
+      DataType::Type field_type,
       const FieldAccessCallingConvention& calling_convention);
 
   void GenerateUnresolvedFieldAccess(
       HInstruction* field_access,
-      Primitive::Type field_type,
+      DataType::Type field_type,
       uint32_t field_index,
       uint32_t dex_pc,
       const FieldAccessCallingConvention& calling_convention);
@@ -573,7 +573,7 @@
       HInvokeVirtual* invoke, Location temp, SlowPathCode* slow_path = nullptr) = 0;
 
   // Copy the result of a call into the given target.
-  virtual void MoveFromReturnRegister(Location trg, Primitive::Type type) = 0;
+  virtual void MoveFromReturnRegister(Location trg, DataType::Type type) = 0;
 
   virtual void GenerateNop() = 0;
 
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index aaea7c1..42e9f68 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -144,24 +144,24 @@
   }
 }
 
-Location ARM64ReturnLocation(Primitive::Type return_type) {
+Location ARM64ReturnLocation(DataType::Type return_type) {
   // Note that in practice, `LocationFrom(x0)` and `LocationFrom(w0)` create the
   // same Location object, and so do `LocationFrom(d0)` and `LocationFrom(s0)`,
   // but we use the exact registers for clarity.
-  if (return_type == Primitive::kPrimFloat) {
+  if (return_type == DataType::Type::kFloat32) {
     return LocationFrom(s0);
-  } else if (return_type == Primitive::kPrimDouble) {
+  } else if (return_type == DataType::Type::kFloat64) {
     return LocationFrom(d0);
-  } else if (return_type == Primitive::kPrimLong) {
+  } else if (return_type == DataType::Type::kInt64) {
     return LocationFrom(x0);
-  } else if (return_type == Primitive::kPrimVoid) {
+  } else if (return_type == DataType::Type::kVoid) {
     return Location::NoLocation();
   } else {
     return LocationFrom(w0);
   }
 }
 
-Location InvokeRuntimeCallingConvention::GetReturnLocation(Primitive::Type return_type) {
+Location InvokeRuntimeCallingConvention::GetReturnLocation(DataType::Type return_type) {
   return ARM64ReturnLocation(return_type);
 }
 
@@ -265,9 +265,12 @@
     // We're moving two locations to locations that could overlap, so we need a parallel
     // move resolver.
     InvokeRuntimeCallingConvention calling_convention;
-    codegen->EmitParallelMoves(
-        locations->InAt(0), LocationFrom(calling_convention.GetRegisterAt(0)), Primitive::kPrimInt,
-        locations->InAt(1), LocationFrom(calling_convention.GetRegisterAt(1)), Primitive::kPrimInt);
+    codegen->EmitParallelMoves(locations->InAt(0),
+                               LocationFrom(calling_convention.GetRegisterAt(0)),
+                               DataType::Type::kInt32,
+                               locations->InAt(1),
+                               LocationFrom(calling_convention.GetRegisterAt(1)),
+                               DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -356,7 +359,7 @@
     // Move the class to the desired location.
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = instruction_->GetType();
+      DataType::Type type = instruction_->GetType();
       arm64_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
     }
     RestoreLiveRegisters(codegen, locations);
@@ -376,7 +379,7 @@
       {
         SingleEmissionCheckScope guard(arm64_codegen->GetVIXLAssembler());
         __ Bind(strp_label);
-        __ str(RegisterFrom(locations->Out(), Primitive::kPrimNot),
+        __ str(RegisterFrom(locations->Out(), DataType::Type::kReference),
                MemOperand(bss_entry_temp_, /* offset placeholder */ 0));
       }
     }
@@ -427,7 +430,7 @@
     __ Mov(calling_convention.GetRegisterAt(0).W(), string_index.index_);
     arm64_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
-    Primitive::Type type = instruction_->GetType();
+    DataType::Type type = instruction_->GetType();
     arm64_codegen->MoveLocation(locations->Out(), calling_convention.GetReturnLocation(type), type);
 
     RestoreLiveRegisters(codegen, locations);
@@ -446,7 +449,7 @@
     {
       SingleEmissionCheckScope guard(arm64_codegen->GetVIXLAssembler());
       __ Bind(strp_label);
-      __ str(RegisterFrom(locations->Out(), Primitive::kPrimNot),
+      __ str(RegisterFrom(locations->Out(), DataType::Type::kReference),
              MemOperand(temp_, /* offset placeholder */ 0));
     }
 
@@ -553,14 +556,14 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                LocationFrom(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimNot,
+                               DataType::Type::kReference,
                                locations->InAt(1),
                                LocationFrom(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       arm64_codegen->InvokeRuntime(kQuickInstanceofNonTrivial, instruction_, dex_pc, this);
       CheckEntrypointTypes<kQuickInstanceofNonTrivial, size_t, mirror::Object*, mirror::Class*>();
-      Primitive::Type ret_type = instruction_->GetType();
+      DataType::Type ret_type = instruction_->GetType();
       Location ret_loc = calling_convention.GetReturnLocation(ret_type);
       arm64_codegen->MoveLocation(locations->Out(), ret_loc, ret_type);
     } else {
@@ -621,17 +624,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         LocationFrom(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         LocationFrom(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         LocationFrom(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -1200,7 +1203,7 @@
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
     CodeGeneratorARM64* arm64_codegen = down_cast<CodeGeneratorARM64*>(codegen);
     LocationSummary* locations = instruction_->GetLocations();
-    Primitive::Type type = Primitive::kPrimNot;
+    DataType::Type type = DataType::Type::kReference;
     DCHECK(locations->CanCall());
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(out_.reg()));
     DCHECK(instruction_->IsInstanceFieldGet() ||
@@ -1229,7 +1232,7 @@
       // Handle `index_` for HArrayGet and UnsafeGetObject/UnsafeGetObjectVolatile intrinsics.
       if (instruction_->IsArrayGet()) {
         // Compute the actual memory offset and store it in `index`.
-        Register index_reg = RegisterFrom(index_, Primitive::kPrimInt);
+        Register index_reg = RegisterFrom(index_, DataType::Type::kInt32);
         DCHECK(locations->GetLiveRegisters()->ContainsCoreRegister(index_.reg()));
         if (codegen->IsCoreCalleeSaveRegister(index_.reg())) {
           // We are about to change the value of `index_reg` (see the
@@ -1268,7 +1271,7 @@
         // factor (2) cannot overflow in practice, as the runtime is
         // unable to allocate object arrays with a size larger than
         // 2^26 - 1 (that is, 2^28 - 4 bytes).
-        __ Lsl(index_reg, index_reg, Primitive::ComponentSizeShift(type));
+        __ Lsl(index_reg, index_reg, DataType::SizeShift(type));
         static_assert(
             sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
             "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -1303,7 +1306,7 @@
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             LocationFrom(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -1365,7 +1368,7 @@
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
     LocationSummary* locations = instruction_->GetLocations();
-    Primitive::Type type = Primitive::kPrimNot;
+    DataType::Type type = DataType::Type::kReference;
     DCHECK(locations->CanCall());
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(out_.reg()));
     DCHECK(instruction_->IsLoadClass() || instruction_->IsLoadString())
@@ -1387,7 +1390,7 @@
     //       type);
     //
     // which would emit a 32-bit move, as `type` is a (32-bit wide)
-    // reference type (`Primitive::kPrimNot`).
+    // reference type (`DataType::Type::kReference`).
     __ Mov(calling_convention.GetRegisterAt(0), XRegisterFrom(out_));
     arm64_codegen->InvokeRuntime(kQuickReadBarrierForRootSlow,
                                  instruction_,
@@ -1411,26 +1414,26 @@
 
 #undef __
 
-Location InvokeDexCallingConventionVisitorARM64::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorARM64::GetNextLocation(DataType::Type type) {
   Location next_location;
-  if (type == Primitive::kPrimVoid) {
+  if (type == DataType::Type::kVoid) {
     LOG(FATAL) << "Unreachable type " << type;
   }
 
-  if (Primitive::IsFloatingPointType(type) &&
+  if (DataType::IsFloatingPointType(type) &&
       (float_index_ < calling_convention.GetNumberOfFpuRegisters())) {
     next_location = LocationFrom(calling_convention.GetFpuRegisterAt(float_index_++));
-  } else if (!Primitive::IsFloatingPointType(type) &&
+  } else if (!DataType::IsFloatingPointType(type) &&
              (gp_index_ < calling_convention.GetNumberOfRegisters())) {
     next_location = LocationFrom(calling_convention.GetRegisterAt(gp_index_++));
   } else {
     size_t stack_offset = calling_convention.GetStackOffsetOf(stack_index_);
-    next_location = Primitive::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
-                                                 : Location::StackSlot(stack_offset);
+    next_location = DataType::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
+                                                : Location::StackSlot(stack_offset);
   }
 
   // Space on the stack is reserved for all arguments.
-  stack_index_ += Primitive::Is64BitType(type) ? 2 : 1;
+  stack_index_ += DataType::Is64BitType(type) ? 2 : 1;
   return next_location;
 }
 
@@ -1547,7 +1550,7 @@
 
 void ParallelMoveResolverARM64::EmitMove(size_t index) {
   MoveOperands* move = moves_[index];
-  codegen_->MoveLocation(move->GetDestination(), move->GetSource(), Primitive::kPrimVoid);
+  codegen_->MoveLocation(move->GetDestination(), move->GetSource(), DataType::Type::kVoid);
 }
 
 void CodeGeneratorARM64::GenerateFrameEntry() {
@@ -1638,7 +1641,7 @@
 
 void CodeGeneratorARM64::MoveConstant(Location location, int32_t value) {
   DCHECK(location.IsRegister());
-  __ Mov(RegisterFrom(location, Primitive::kPrimInt), value);
+  __ Mov(RegisterFrom(location, DataType::Type::kInt32), value);
 }
 
 void CodeGeneratorARM64::AddLocationAsTemp(Location location, LocationSummary* locations) {
@@ -1745,15 +1748,15 @@
 }
 
 
-static bool CoherentConstantAndType(Location constant, Primitive::Type type) {
+static bool CoherentConstantAndType(Location constant, DataType::Type type) {
   DCHECK(constant.IsConstant());
   HConstant* cst = constant.GetConstant();
-  return (cst->IsIntConstant() && type == Primitive::kPrimInt) ||
+  return (cst->IsIntConstant() && type == DataType::Type::kInt32) ||
          // Null is mapped to a core W register, which we associate with kPrimInt.
-         (cst->IsNullConstant() && type == Primitive::kPrimInt) ||
-         (cst->IsLongConstant() && type == Primitive::kPrimLong) ||
-         (cst->IsFloatConstant() && type == Primitive::kPrimFloat) ||
-         (cst->IsDoubleConstant() && type == Primitive::kPrimDouble);
+         (cst->IsNullConstant() && type == DataType::Type::kInt32) ||
+         (cst->IsLongConstant() && type == DataType::Type::kInt64) ||
+         (cst->IsFloatConstant() && type == DataType::Type::kFloat32) ||
+         (cst->IsDoubleConstant() && type == DataType::Type::kFloat64);
 }
 
 // Allocate a scratch register from the VIXL pool, querying first
@@ -1771,7 +1774,7 @@
 
 void CodeGeneratorARM64::MoveLocation(Location destination,
                                       Location source,
-                                      Primitive::Type dst_type) {
+                                      DataType::Type dst_type) {
   if (source.Equals(destination)) {
     return;
   }
@@ -1780,7 +1783,7 @@
   // locations. When moving from and to a register, the argument type can be
   // used to generate 32bit instead of 64bit moves. In debug mode we also
   // checks the coherency of the locations and the type.
-  bool unspecified_type = (dst_type == Primitive::kPrimVoid);
+  bool unspecified_type = (dst_type == DataType::Type::kVoid);
 
   if (destination.IsRegister() || destination.IsFpuRegister()) {
     if (unspecified_type) {
@@ -1790,17 +1793,17 @@
                                   || src_cst->IsFloatConstant()
                                   || src_cst->IsNullConstant()))) {
         // For stack slots and 32bit constants, a 64bit type is appropriate.
-        dst_type = destination.IsRegister() ? Primitive::kPrimInt : Primitive::kPrimFloat;
+        dst_type = destination.IsRegister() ? DataType::Type::kInt32 : DataType::Type::kFloat32;
       } else {
         // If the source is a double stack slot or a 64bit constant, a 64bit
         // type is appropriate. Else the source is a register, and since the
         // type has not been specified, we chose a 64bit type to force a 64bit
         // move.
-        dst_type = destination.IsRegister() ? Primitive::kPrimLong : Primitive::kPrimDouble;
+        dst_type = destination.IsRegister() ? DataType::Type::kInt64 : DataType::Type::kFloat64;
       }
     }
-    DCHECK((destination.IsFpuRegister() && Primitive::IsFloatingPointType(dst_type)) ||
-           (destination.IsRegister() && !Primitive::IsFloatingPointType(dst_type)));
+    DCHECK((destination.IsFpuRegister() && DataType::IsFloatingPointType(dst_type)) ||
+           (destination.IsRegister() && !DataType::IsFloatingPointType(dst_type)));
     CPURegister dst = CPURegisterFrom(destination, dst_type);
     if (source.IsStackSlot() || source.IsDoubleStackSlot()) {
       DCHECK(dst.Is64Bits() == source.IsDoubleStackSlot());
@@ -1815,17 +1818,17 @@
         __ Mov(Register(dst), RegisterFrom(source, dst_type));
       } else {
         DCHECK(destination.IsFpuRegister());
-        Primitive::Type source_type = Primitive::Is64BitType(dst_type)
-            ? Primitive::kPrimLong
-            : Primitive::kPrimInt;
+        DataType::Type source_type = DataType::Is64BitType(dst_type)
+            ? DataType::Type::kInt64
+            : DataType::Type::kInt32;
         __ Fmov(FPRegisterFrom(destination, dst_type), RegisterFrom(source, source_type));
       }
     } else {
       DCHECK(source.IsFpuRegister());
       if (destination.IsRegister()) {
-        Primitive::Type source_type = Primitive::Is64BitType(dst_type)
-            ? Primitive::kPrimDouble
-            : Primitive::kPrimFloat;
+        DataType::Type source_type = DataType::Is64BitType(dst_type)
+            ? DataType::Type::kFloat64
+            : DataType::Type::kFloat32;
         __ Fmov(RegisterFrom(destination, dst_type), FPRegisterFrom(source, source_type));
       } else {
         DCHECK(destination.IsFpuRegister());
@@ -1859,13 +1862,14 @@
     if (source.IsRegister() || source.IsFpuRegister()) {
       if (unspecified_type) {
         if (source.IsRegister()) {
-          dst_type = destination.IsStackSlot() ? Primitive::kPrimInt : Primitive::kPrimLong;
+          dst_type = destination.IsStackSlot() ? DataType::Type::kInt32 : DataType::Type::kInt64;
         } else {
-          dst_type = destination.IsStackSlot() ? Primitive::kPrimFloat : Primitive::kPrimDouble;
+          dst_type =
+              destination.IsStackSlot() ? DataType::Type::kFloat32 : DataType::Type::kFloat64;
         }
       }
-      DCHECK((destination.IsDoubleStackSlot() == Primitive::Is64BitType(dst_type)) &&
-             (source.IsFpuRegister() == Primitive::IsFloatingPointType(dst_type)));
+      DCHECK((destination.IsDoubleStackSlot() == DataType::Is64BitType(dst_type)) &&
+             (source.IsFpuRegister() == DataType::IsFloatingPointType(dst_type)));
       __ Str(CPURegisterFrom(source, dst_type), StackOperandFrom(destination));
     } else if (source.IsConstant()) {
       DCHECK(unspecified_type || CoherentConstantAndType(source, dst_type))
@@ -1920,31 +1924,31 @@
   }
 }
 
-void CodeGeneratorARM64::Load(Primitive::Type type,
+void CodeGeneratorARM64::Load(DataType::Type type,
                               CPURegister dst,
                               const MemOperand& src) {
   switch (type) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       __ Ldrb(Register(dst), src);
       break;
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       __ Ldrsb(Register(dst), src);
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ Ldrsh(Register(dst), src);
       break;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       __ Ldrh(Register(dst), src);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
-      DCHECK_EQ(dst.Is64Bits(), Primitive::Is64BitType(type));
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
+      DCHECK_EQ(dst.Is64Bits(), DataType::Is64BitType(type));
       __ Ldr(dst, src);
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
   }
 }
@@ -1956,7 +1960,7 @@
   MacroAssembler* masm = GetVIXLAssembler();
   UseScratchRegisterScope temps(masm);
   Register temp_base = temps.AcquireX();
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   DCHECK(!src.IsPreIndex());
   DCHECK(!src.IsPostIndex());
@@ -1967,7 +1971,7 @@
     // Ensure that between load and MaybeRecordImplicitNullCheck there are no pools emitted.
     MemOperand base = MemOperand(temp_base);
     switch (type) {
-      case Primitive::kPrimBoolean:
+      case DataType::Type::kBool:
         {
           ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
           __ ldarb(Register(dst), base);
@@ -1976,7 +1980,7 @@
           }
         }
         break;
-      case Primitive::kPrimByte:
+      case DataType::Type::kInt8:
         {
           ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
           __ ldarb(Register(dst), base);
@@ -1984,9 +1988,9 @@
             MaybeRecordImplicitNullCheck(instruction);
           }
         }
-        __ Sbfx(Register(dst), Register(dst), 0, Primitive::ComponentSize(type) * kBitsPerByte);
+        __ Sbfx(Register(dst), Register(dst), 0, DataType::Size(type) * kBitsPerByte);
         break;
-      case Primitive::kPrimChar:
+      case DataType::Type::kUint16:
         {
           ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
           __ ldarh(Register(dst), base);
@@ -1995,7 +1999,7 @@
           }
         }
         break;
-      case Primitive::kPrimShort:
+      case DataType::Type::kInt16:
         {
           ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
           __ ldarh(Register(dst), base);
@@ -2003,12 +2007,12 @@
             MaybeRecordImplicitNullCheck(instruction);
           }
         }
-        __ Sbfx(Register(dst), Register(dst), 0, Primitive::ComponentSize(type) * kBitsPerByte);
+        __ Sbfx(Register(dst), Register(dst), 0, DataType::Size(type) * kBitsPerByte);
         break;
-      case Primitive::kPrimInt:
-      case Primitive::kPrimNot:
-      case Primitive::kPrimLong:
-        DCHECK_EQ(dst.Is64Bits(), Primitive::Is64BitType(type));
+      case DataType::Type::kInt32:
+      case DataType::Type::kReference:
+      case DataType::Type::kInt64:
+        DCHECK_EQ(dst.Is64Bits(), DataType::Is64BitType(type));
         {
           ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
           __ ldar(Register(dst), base);
@@ -2017,10 +2021,10 @@
           }
         }
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble: {
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64: {
         DCHECK(dst.IsFPRegister());
-        DCHECK_EQ(dst.Is64Bits(), Primitive::Is64BitType(type));
+        DCHECK_EQ(dst.Is64Bits(), DataType::Is64BitType(type));
 
         Register temp = dst.Is64Bits() ? temps.AcquireX() : temps.AcquireW();
         {
@@ -2033,39 +2037,39 @@
         __ Fmov(FPRegister(dst), temp);
         break;
       }
-      case Primitive::kPrimVoid:
+      case DataType::Type::kVoid:
         LOG(FATAL) << "Unreachable type " << type;
     }
   }
 }
 
-void CodeGeneratorARM64::Store(Primitive::Type type,
+void CodeGeneratorARM64::Store(DataType::Type type,
                                CPURegister src,
                                const MemOperand& dst) {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       __ Strb(Register(src), dst);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       __ Strh(Register(src), dst);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
-      DCHECK_EQ(src.Is64Bits(), Primitive::Is64BitType(type));
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
+      DCHECK_EQ(src.Is64Bits(), DataType::Is64BitType(type));
       __ Str(src, dst);
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
   }
 }
 
 void CodeGeneratorARM64::StoreRelease(HInstruction* instruction,
-                                      Primitive::Type type,
+                                      DataType::Type type,
                                       CPURegister src,
                                       const MemOperand& dst,
                                       bool needs_null_check) {
@@ -2082,8 +2086,8 @@
   MemOperand base = MemOperand(temp_base);
   // Ensure that between store and MaybeRecordImplicitNullCheck there are no pools emitted.
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       {
         ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
         __ stlrb(Register(src), base);
@@ -2092,8 +2096,8 @@
         }
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       {
         ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
         __ stlrh(Register(src), base);
@@ -2102,10 +2106,10 @@
         }
       }
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
-      DCHECK_EQ(src.Is64Bits(), Primitive::Is64BitType(type));
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
+      DCHECK_EQ(src.Is64Bits(), DataType::Is64BitType(type));
       {
         ExactAssemblyScope eas(masm, kInstructionSize, CodeBufferCheckScope::kExactSize);
         __ stlr(Register(src), base);
@@ -2114,9 +2118,9 @@
         }
       }
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
-      DCHECK_EQ(src.Is64Bits(), Primitive::Is64BitType(type));
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
+      DCHECK_EQ(src.Is64Bits(), DataType::Is64BitType(type));
       Register temp_src;
       if (src.IsZero()) {
         // The zero register is used to avoid synthesizing zero constants.
@@ -2135,7 +2139,7 @@
       }
       break;
     }
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
   }
 }
@@ -2269,17 +2273,17 @@
 void LocationsBuilderARM64::HandleBinaryOp(HBinaryOperation* instr) {
   DCHECK_EQ(instr->InputCount(), 2U);
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instr);
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, ARM64EncodableConstantOrRegister(instr->InputAt(1), instr));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -2295,7 +2299,7 @@
   DCHECK(instruction->IsInstanceFieldGet() || instruction->IsStaticFieldGet());
 
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_field_get_with_read_barrier ?
@@ -2318,7 +2322,7 @@
     }
   }
   locations->SetInAt(0, Location::RequiresRegister());
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister());
   } else {
     // The output overlaps for an object field get when read barriers
@@ -2337,13 +2341,14 @@
   Location base_loc = locations->InAt(0);
   Location out = locations->Out();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   MemOperand field = HeapOperand(InputRegisterAt(instruction, 0), field_info.GetFieldOffset());
 
-  if (field_type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (kEmitCompilerReadBarrier && kUseBakerReadBarrier &&
+      field_type == DataType::Type::kReference) {
     // Object FieldGet with Baker's read barrier case.
     // /* HeapReference<Object> */ out = *(base + offset)
-    Register base = RegisterFrom(base_loc, Primitive::kPrimNot);
+    Register base = RegisterFrom(base_loc, DataType::Type::kReference);
     Location maybe_temp =
         (locations->GetTempCount() != 0) ? locations->GetTemp(0) : Location::NoLocation();
     // Note that potential implicit null checks are handled in this
@@ -2370,7 +2375,7 @@
       codegen_->Load(field_type, OutputCPURegister(instruction), field);
       codegen_->MaybeRecordImplicitNullCheck(instruction);
     }
-    if (field_type == Primitive::kPrimNot) {
+    if (field_type == DataType::Type::kReference) {
       // If read barriers are enabled, emit read barriers other than
       // Baker's using a slow path (and also unpoison the loaded
       // reference, if heap poisoning is enabled).
@@ -2385,7 +2390,7 @@
   locations->SetInAt(0, Location::RequiresRegister());
   if (IsConstantZeroBitPattern(instruction->InputAt(1))) {
     locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
-  } else if (Primitive::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
+  } else if (DataType::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
     locations->SetInAt(1, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(1, Location::RequiresRegister());
@@ -2401,14 +2406,14 @@
   CPURegister value = InputCPURegisterOrZeroRegAt(instruction, 1);
   CPURegister source = value;
   Offset offset = field_info.GetFieldOffset();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
 
   {
     // We use a block to end the scratch scope before the write barrier, thus
     // freeing the temporary registers so they can be used in `MarkGCCard`.
     UseScratchRegisterScope temps(GetVIXLAssembler());
 
-    if (kPoisonHeapReferences && field_type == Primitive::kPrimNot) {
+    if (kPoisonHeapReferences && field_type == DataType::Type::kReference) {
       DCHECK(value.IsW());
       Register temp = temps.AcquireW();
       __ Mov(temp, value.W());
@@ -2433,11 +2438,11 @@
 }
 
 void InstructionCodeGeneratorARM64::HandleBinaryOp(HBinaryOperation* instr) {
-  Primitive::Type type = instr->GetType();
+  DataType::Type type = instr->GetType();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       Register dst = OutputRegister(instr);
       Register lhs = InputRegisterAt(instr, 0);
       Operand rhs = InputOperandAt(instr, 1);
@@ -2466,8 +2471,8 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FPRegister dst = OutputFPRegister(instr);
       FPRegister lhs = InputFPRegisterAt(instr, 0);
       FPRegister rhs = InputFPRegisterAt(instr, 1);
@@ -2489,10 +2494,10 @@
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr());
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instr);
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instr->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2506,16 +2511,16 @@
 void InstructionCodeGeneratorARM64::HandleShift(HBinaryOperation* instr) {
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr());
 
-  Primitive::Type type = instr->GetType();
+  DataType::Type type = instr->GetType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       Register dst = OutputRegister(instr);
       Register lhs = InputRegisterAt(instr, 0);
       Operand rhs = InputOperandAt(instr, 1);
       if (rhs.IsImmediate()) {
         uint32_t shift_value = rhs.GetImmediate() &
-            (type == Primitive::kPrimInt ? kMaxIntShiftDistance : kMaxLongShiftDistance);
+            (type == DataType::Type::kInt32 ? kMaxIntShiftDistance : kMaxLongShiftDistance);
         if (instr->IsShl()) {
           __ Lsl(dst, lhs, shift_value);
         } else if (instr->IsShr()) {
@@ -2558,7 +2563,7 @@
 }
 
 void LocationsBuilderARM64::VisitBitwiseNegatedRight(HBitwiseNegatedRight* instr) {
-  DCHECK(Primitive::IsIntegralType(instr->GetType())) << instr->GetType();
+  DCHECK(DataType::IsIntegralType(instr->GetType())) << instr->GetType();
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instr);
   locations->SetInAt(0, Location::RequiresRegister());
   // There is no immediate variant of negated bitwise instructions in AArch64.
@@ -2588,8 +2593,8 @@
 
 void LocationsBuilderARM64::VisitDataProcWithShifterOp(
     HDataProcWithShifterOp* instruction) {
-  DCHECK(instruction->GetType() == Primitive::kPrimInt ||
-         instruction->GetType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetType() == DataType::Type::kInt32 ||
+         instruction->GetType() == DataType::Type::kInt64);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
   if (instruction->GetInstrKind() == HInstruction::kNeg) {
@@ -2603,9 +2608,9 @@
 
 void InstructionCodeGeneratorARM64::VisitDataProcWithShifterOp(
     HDataProcWithShifterOp* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   HInstruction::InstructionKind kind = instruction->GetInstrKind();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
   Register out = OutputRegister(instruction);
   Register left;
   if (kind != HInstruction::kNeg) {
@@ -2731,7 +2736,7 @@
   // Avoid emitting code that could trigger Cortex A53's erratum 835769.
   // This fixup should be carried out for all multiply-accumulate instructions:
   // madd, msub, smaddl, smsubl, umaddl and umsubl.
-  if (instr->GetType() == Primitive::kPrimLong &&
+  if (instr->GetType() == DataType::Type::kInt64 &&
       codegen_->GetInstructionSetFeatures().NeedFixCortexA53_835769()) {
     MacroAssembler* masm = down_cast<CodeGeneratorARM64*>(codegen_)->GetVIXLAssembler();
     vixl::aarch64::Instruction* prev =
@@ -2760,7 +2765,7 @@
 
 void LocationsBuilderARM64::VisitArrayGet(HArrayGet* instruction) {
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier ?
@@ -2778,7 +2783,7 @@
       // constant index loads we need a temporary only if the offset is too big.
       uint32_t offset = CodeGenerator::GetArrayDataOffset(instruction);
       uint32_t index = instruction->GetIndex()->AsIntConstant()->GetValue();
-      offset += index << Primitive::ComponentSizeShift(Primitive::kPrimNot);
+      offset += index << DataType::SizeShift(DataType::Type::kReference);
       if (offset >= kReferenceLoadMinFarOffset) {
         locations->AddTemp(FixedTempLocation());
       }
@@ -2788,7 +2793,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps in the case of an object array get with
@@ -2801,7 +2806,7 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitArrayGet(HArrayGet* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   Register obj = InputRegisterAt(instruction, 0);
   LocationSummary* locations = instruction->GetLocations();
   Location index = locations->InAt(1);
@@ -2814,18 +2819,18 @@
 
   // The read barrier instrumentation of object ArrayGet instructions
   // does not support the HIntermediateAddress instruction.
-  DCHECK(!((type == Primitive::kPrimNot) &&
+  DCHECK(!((type == DataType::Type::kReference) &&
            instruction->GetArray()->IsIntermediateAddress() &&
            kEmitCompilerReadBarrier));
 
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // Object ArrayGet with Baker's read barrier case.
     // Note that a potential implicit null check is handled in the
     // CodeGeneratorARM64::GenerateArrayLoadWithBakerReadBarrier call.
     DCHECK(!instruction->CanDoImplicitNullCheckOn(instruction->InputAt(0)));
     if (index.IsConstant()) {
       // Array load with a constant index can be treated as a field load.
-      offset += Int64ConstantFrom(index) << Primitive::ComponentSizeShift(type);
+      offset += Int64ConstantFrom(index) << DataType::SizeShift(type);
       Location maybe_temp =
           (locations->GetTempCount() != 0) ? locations->GetTemp(0) : Location::NoLocation();
       codegen_->GenerateFieldLoadWithBakerReadBarrier(instruction,
@@ -2877,7 +2882,7 @@
                 HeapOperand(obj, offset + (Int64ConstantFrom(index) << 1)));
         __ Bind(&done);
       } else {
-        offset += Int64ConstantFrom(index) << Primitive::ComponentSizeShift(type);
+        offset += Int64ConstantFrom(index) << DataType::SizeShift(type);
         source = HeapOperand(obj, offset);
       }
     } else {
@@ -2907,7 +2912,7 @@
                 HeapOperand(temp, XRegisterFrom(index), LSL, 1));
         __ Bind(&done);
       } else {
-        source = HeapOperand(temp, XRegisterFrom(index), LSL, Primitive::ComponentSizeShift(type));
+        source = HeapOperand(temp, XRegisterFrom(index), LSL, DataType::SizeShift(type));
       }
     }
     if (!maybe_compressed_char_at) {
@@ -2917,7 +2922,7 @@
       codegen_->MaybeRecordImplicitNullCheck(instruction);
     }
 
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       static_assert(
           sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
           "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -2953,7 +2958,7 @@
 }
 
 void LocationsBuilderARM64::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(
@@ -2965,7 +2970,7 @@
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
   if (IsConstantZeroBitPattern(instruction->InputAt(2))) {
     locations->SetInAt(2, Location::ConstantLocation(instruction->InputAt(2)->AsConstant()));
-  } else if (Primitive::IsFloatingPointType(value_type)) {
+  } else if (DataType::IsFloatingPointType(value_type)) {
     locations->SetInAt(2, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(2, Location::RequiresRegister());
@@ -2973,7 +2978,7 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   LocationSummary* locations = instruction->GetLocations();
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   bool needs_write_barrier =
@@ -2983,14 +2988,14 @@
   CPURegister value = InputCPURegisterOrZeroRegAt(instruction, 2);
   CPURegister source = value;
   Location index = locations->InAt(1);
-  size_t offset = mirror::Array::DataOffset(Primitive::ComponentSize(value_type)).Uint32Value();
+  size_t offset = mirror::Array::DataOffset(DataType::Size(value_type)).Uint32Value();
   MemOperand destination = HeapOperand(array);
   MacroAssembler* masm = GetVIXLAssembler();
 
   if (!needs_write_barrier) {
     DCHECK(!may_need_runtime_call_for_type_check);
     if (index.IsConstant()) {
-      offset += Int64ConstantFrom(index) << Primitive::ComponentSizeShift(value_type);
+      offset += Int64ConstantFrom(index) << DataType::SizeShift(value_type);
       destination = HeapOperand(array, offset);
     } else {
       UseScratchRegisterScope temps(masm);
@@ -3010,7 +3015,7 @@
       destination = HeapOperand(temp,
                                 XRegisterFrom(index),
                                 LSL,
-                                Primitive::ComponentSizeShift(value_type));
+                                DataType::SizeShift(value_type));
     }
     {
       // Ensure that between store and MaybeRecordImplicitNullCheck there are no pools emitted.
@@ -3028,13 +3033,13 @@
       UseScratchRegisterScope temps(masm);
       Register temp = temps.AcquireSameSizeAs(array);
       if (index.IsConstant()) {
-        offset += Int64ConstantFrom(index) << Primitive::ComponentSizeShift(value_type);
+        offset += Int64ConstantFrom(index) << DataType::SizeShift(value_type);
         destination = HeapOperand(array, offset);
       } else {
         destination = HeapOperand(temp,
                                   XRegisterFrom(index),
                                   LSL,
-                                  Primitive::ComponentSizeShift(value_type));
+                                  DataType::SizeShift(value_type));
       }
 
       uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
@@ -3214,21 +3219,21 @@
 void LocationsBuilderARM64::VisitCompare(HCompare* compare) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(compare, LocationSummary::kNoCall);
-  Primitive::Type in_type = compare->InputAt(0)->GetType();
+  DataType::Type in_type = compare->InputAt(0)->GetType();
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, ARM64EncodableConstantOrRegister(compare->InputAt(1), compare));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1,
                          IsFloatingPointZeroConstant(compare->InputAt(1))
@@ -3243,18 +3248,18 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitCompare(HCompare* compare) {
-  Primitive::Type in_type = compare->InputAt(0)->GetType();
+  DataType::Type in_type = compare->InputAt(0)->GetType();
 
   //  0 if: left == right
   //  1 if: left  > right
   // -1 if: left  < right
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       Register result = OutputRegister(compare);
       Register left = InputRegisterAt(compare, 0);
       Operand right = InputOperandAt(compare, 1);
@@ -3263,8 +3268,8 @@
       __ Cneg(result, result, lt);  // result == -1 if LT or unchanged otherwise
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       Register result = OutputRegister(compare);
       GenerateFcmp(compare);
       __ Cset(result, ne);
@@ -3279,7 +3284,7 @@
 void LocationsBuilderARM64::HandleCondition(HCondition* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
 
-  if (Primitive::IsFloatingPointType(instruction->InputAt(0)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(0)->GetType())) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
     locations->SetInAt(1,
                        IsFloatingPointZeroConstant(instruction->InputAt(1))
@@ -3305,7 +3310,7 @@
   Register res = RegisterFrom(locations->Out(), instruction->GetType());
   IfCondition if_cond = instruction->GetCondition();
 
-  if (Primitive::IsFloatingPointType(instruction->InputAt(0)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(0)->GetType())) {
     GenerateFcmp(instruction);
     __ Cset(res, ARM64FPCondition(if_cond, instruction->IsGtBias()));
   } else {
@@ -3384,7 +3389,7 @@
       __ Neg(out, Operand(out, ASR, ctz_imm));
     }
   } else {
-    int bits = instruction->GetResultType() == Primitive::kPrimInt ? 32 : 64;
+    int bits = instruction->GetResultType() == DataType::Type::kInt32 ? 32 : 64;
     __ Asr(temp, dividend, bits - 1);
     __ Lsr(temp, temp, bits - ctz_imm);
     __ Add(out, dividend, temp);
@@ -3404,19 +3409,20 @@
   Register dividend = InputRegisterAt(instruction, 0);
   int64_t imm = Int64FromConstant(second.GetConstant());
 
-  Primitive::Type type = instruction->GetResultType();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DataType::Type type = instruction->GetResultType();
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   int64_t magic;
   int shift;
-  CalculateMagicAndShiftForDivRem(imm, type == Primitive::kPrimLong /* is_long */, &magic, &shift);
+  CalculateMagicAndShiftForDivRem(
+      imm, type == DataType::Type::kInt64 /* is_long */, &magic, &shift);
 
   UseScratchRegisterScope temps(GetVIXLAssembler());
   Register temp = temps.AcquireSameSizeAs(out);
 
   // temp = get_high(dividend * magic)
   __ Mov(temp, magic);
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ Smulh(temp, dividend, temp);
   } else {
     __ Smull(temp.X(), dividend, temp);
@@ -3434,9 +3440,9 @@
   }
 
   if (instruction->IsDiv()) {
-    __ Sub(out, temp, Operand(temp, ASR, type == Primitive::kPrimLong ? 63 : 31));
+    __ Sub(out, temp, Operand(temp, ASR, type == DataType::Type::kInt64 ? 63 : 31));
   } else {
-    __ Sub(temp, temp, Operand(temp, ASR, type == Primitive::kPrimLong ? 63 : 31));
+    __ Sub(temp, temp, Operand(temp, ASR, type == DataType::Type::kInt64 ? 63 : 31));
     // TODO: Strength reduction for msub.
     Register temp_imm = temps.AcquireSameSizeAs(out);
     __ Mov(temp_imm, imm);
@@ -3446,8 +3452,8 @@
 
 void InstructionCodeGeneratorARM64::GenerateDivRemIntegral(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  Primitive::Type type = instruction->GetResultType();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DataType::Type type = instruction->GetResultType();
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   LocationSummary* locations = instruction->GetLocations();
   Register out = OutputRegister(instruction);
@@ -3484,15 +3490,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(div, LocationSummary::kNoCall);
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(div->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3504,15 +3510,15 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitDiv(HDiv* div) {
-  Primitive::Type type = div->GetResultType();
+  DataType::Type type = div->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       GenerateDivRemIntegral(div);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Fdiv(OutputFPRegister(div), InputFPRegisterAt(div, 0), InputFPRegisterAt(div, 1));
       break;
 
@@ -3532,9 +3538,9 @@
   codegen_->AddSlowPath(slow_path);
   Location value = instruction->GetLocations()->InAt(0);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
-  if (!Primitive::IsIntegralType(type)) {
+  if (!DataType::IsIntegralType(type)) {
     LOG(FATAL) << "Unexpected type " << type << " for DivZeroCheck.";
     return;
   }
@@ -3665,8 +3671,8 @@
     // the comparison and its condition as the branch condition.
     HCondition* condition = cond->AsCondition();
 
-    Primitive::Type type = condition->InputAt(0)->GetType();
-    if (Primitive::IsFloatingPointType(type)) {
+    DataType::Type type = condition->InputAt(0)->GetType();
+    if (DataType::IsFloatingPointType(type)) {
       GenerateFcmp(condition);
       if (true_target == nullptr) {
         IfCondition opposite_condition = condition->GetOppositeCondition();
@@ -3780,7 +3786,7 @@
 
 static inline bool IsConditionOnFloatingPointValues(HInstruction* condition) {
   return condition->IsCondition() &&
-         Primitive::IsFloatingPointType(condition->InputAt(0)->GetType());
+         DataType::IsFloatingPointType(condition->InputAt(0)->GetType());
 }
 
 static inline Condition GetConditionForSelect(HCondition* condition) {
@@ -3791,7 +3797,7 @@
 
 void LocationsBuilderARM64::VisitSelect(HSelect* select) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
     locations->SetInAt(1, Location::RequiresFpuRegister());
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3845,7 +3851,7 @@
     csel_cond = GetConditionForSelect(cond->AsCondition());
   }
 
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     __ Fcsel(OutputFPRegister(select),
              InputFPRegisterAt(select, 1),
              InputFPRegisterAt(select, 0),
@@ -4913,8 +4919,8 @@
       InvokeRuntimeCallingConvention calling_convention;
       caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0).GetCode()));
       DCHECK_EQ(calling_convention.GetRegisterAt(0).GetCode(),
-                RegisterFrom(calling_convention.GetReturnLocation(Primitive::kPrimNot),
-                             Primitive::kPrimNot).GetCode());
+                RegisterFrom(calling_convention.GetReturnLocation(DataType::Type::kReference),
+                             DataType::Type::kReference).GetCode());
       locations->SetCustomSlowPathCallerSaves(caller_saves);
     } else {
       // For non-Baker read barrier we have a temp-clobbering call.
@@ -5108,8 +5114,8 @@
         InvokeRuntimeCallingConvention calling_convention;
         caller_saves.Add(Location::RegisterLocation(calling_convention.GetRegisterAt(0).GetCode()));
         DCHECK_EQ(calling_convention.GetRegisterAt(0).GetCode(),
-                  RegisterFrom(calling_convention.GetReturnLocation(Primitive::kPrimNot),
-                               Primitive::kPrimNot).GetCode());
+                  RegisterFrom(calling_convention.GetReturnLocation(DataType::Type::kReference),
+                               DataType::Type::kReference).GetCode());
         locations->SetCustomSlowPathCallerSaves(caller_saves);
       } else {
         // For non-Baker read barrier we have a temp-clobbering call.
@@ -5241,15 +5247,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -5262,13 +5268,13 @@
 
 void InstructionCodeGeneratorARM64::VisitMul(HMul* mul) {
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       __ Mul(OutputRegister(mul), InputRegisterAt(mul, 0), InputRegisterAt(mul, 1));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Fmul(OutputFPRegister(mul), InputFPRegisterAt(mul, 0), InputFPRegisterAt(mul, 1));
       break;
 
@@ -5281,14 +5287,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, ARM64EncodableConstantOrRegister(neg->InputAt(0), neg));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -5300,13 +5306,13 @@
 
 void InstructionCodeGeneratorARM64::VisitNeg(HNeg* neg) {
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       __ Neg(OutputRegister(neg), InputOperandAt(neg, 0));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Fneg(OutputFPRegister(neg), InputFPRegisterAt(neg, 0));
       break;
 
@@ -5343,7 +5349,7 @@
   } else {
     locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
   }
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void InstructionCodeGeneratorARM64::VisitNewInstance(HNewInstance* instruction) {
@@ -5379,8 +5385,8 @@
 
 void InstructionCodeGeneratorARM64::VisitNot(HNot* instruction) {
   switch (instruction->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       __ Mvn(OutputRegister(instruction), InputOperandAt(instruction, 0));
       break;
 
@@ -5487,22 +5493,22 @@
 }
 
 void LocationsBuilderARM64::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   LocationSummary::CallKind call_kind =
-      Primitive::IsFloatingPointType(type) ? LocationSummary::kCallOnMainOnly
+      DataType::IsFloatingPointType(type) ? LocationSummary::kCallOnMainOnly
                                            : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(rem, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(rem->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, LocationFrom(calling_convention.GetFpuRegisterAt(0)));
       locations->SetInAt(1, LocationFrom(calling_convention.GetFpuRegisterAt(1)));
@@ -5517,20 +5523,21 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GenerateDivRemIntegral(rem);
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
-      QuickEntrypointEnum entrypoint = (type == Primitive::kPrimFloat) ? kQuickFmodf : kQuickFmod;
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
+      QuickEntrypointEnum entrypoint =
+          (type == DataType::Type::kFloat32) ? kQuickFmodf : kQuickFmod;
       codegen_->InvokeRuntime(entrypoint, rem, rem->GetDexPc());
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         CheckEntrypointTypes<kQuickFmodf, float, float, float>();
       } else {
         CheckEntrypointTypes<kQuickFmod, double, double, double>();
@@ -5563,7 +5570,7 @@
 
 void LocationsBuilderARM64::VisitReturn(HReturn* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
-  Primitive::Type return_type = instruction->InputAt(0)->GetType();
+  DataType::Type return_type = instruction->InputAt(0)->GetType();
   locations->SetInAt(0, ARM64ReturnLocation(return_type));
 }
 
@@ -5735,21 +5742,21 @@
 void LocationsBuilderARM64::VisitTypeConversion(HTypeConversion* conversion) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(conversion, LocationSummary::kNoCall);
-  Primitive::Type input_type = conversion->GetInputType();
-  Primitive::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
   DCHECK_NE(input_type, result_type);
-  if ((input_type == Primitive::kPrimNot) || (input_type == Primitive::kPrimVoid) ||
-      (result_type == Primitive::kPrimNot) || (result_type == Primitive::kPrimVoid)) {
+  if ((input_type == DataType::Type::kReference) || (input_type == DataType::Type::kVoid) ||
+      (result_type == DataType::Type::kReference) || (result_type == DataType::Type::kVoid)) {
     LOG(FATAL) << "Unexpected type conversion from " << input_type << " to " << result_type;
   }
 
-  if (Primitive::IsFloatingPointType(input_type)) {
+  if (DataType::IsFloatingPointType(input_type)) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(0, Location::RequiresRegister());
   }
 
-  if (Primitive::IsFloatingPointType(result_type)) {
+  if (DataType::IsFloatingPointType(result_type)) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -5757,18 +5764,18 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitTypeConversion(HTypeConversion* conversion) {
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
 
   DCHECK_NE(input_type, result_type);
 
-  if (Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type)) {
-    int result_size = Primitive::ComponentSize(result_type);
-    int input_size = Primitive::ComponentSize(input_type);
+  if (DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type)) {
+    int result_size = DataType::Size(result_type);
+    int input_size = DataType::Size(input_type);
     int min_size = std::min(result_size, input_size);
     Register output = OutputRegister(conversion);
     Register source = InputRegisterAt(conversion, 0);
-    if (result_type == Primitive::kPrimInt && input_type == Primitive::kPrimLong) {
+    if (result_type == DataType::Type::kInt32 && input_type == DataType::Type::kInt64) {
       // 'int' values are used directly as W registers, discarding the top
       // bits, so we don't need to sign-extend and can just perform a move.
       // We do not pass the `kDiscardForSameWReg` argument to force clearing the
@@ -5777,21 +5784,21 @@
       // 32bit input value as a 64bit value assuming that the top 32 bits are
       // zero.
       __ Mov(output.W(), source.W());
-    } else if (result_type == Primitive::kPrimChar ||
-               (input_type == Primitive::kPrimChar && input_size < result_size)) {
+    } else if (result_type == DataType::Type::kUint16 ||
+               (input_type == DataType::Type::kUint16 && input_size < result_size)) {
       __ Ubfx(output,
               output.IsX() ? source.X() : source.W(),
-              0, Primitive::ComponentSize(Primitive::kPrimChar) * kBitsPerByte);
+              0, DataType::Size(DataType::Type::kUint16) * kBitsPerByte);
     } else {
       __ Sbfx(output, output.IsX() ? source.X() : source.W(), 0, min_size * kBitsPerByte);
     }
-  } else if (Primitive::IsFloatingPointType(result_type) && Primitive::IsIntegralType(input_type)) {
+  } else if (DataType::IsFloatingPointType(result_type) && DataType::IsIntegralType(input_type)) {
     __ Scvtf(OutputFPRegister(conversion), InputRegisterAt(conversion, 0));
-  } else if (Primitive::IsIntegralType(result_type) && Primitive::IsFloatingPointType(input_type)) {
-    CHECK(result_type == Primitive::kPrimInt || result_type == Primitive::kPrimLong);
+  } else if (DataType::IsIntegralType(result_type) && DataType::IsFloatingPointType(input_type)) {
+    CHECK(result_type == DataType::Type::kInt32 || result_type == DataType::Type::kInt64);
     __ Fcvtzs(OutputRegister(conversion), InputFPRegisterAt(conversion, 0));
-  } else if (Primitive::IsFloatingPointType(result_type) &&
-             Primitive::IsFloatingPointType(input_type)) {
+  } else if (DataType::IsFloatingPointType(result_type) &&
+             DataType::IsFloatingPointType(input_type)) {
     __ Fcvt(OutputFPRegister(conversion), InputFPRegisterAt(conversion, 0));
   } else {
     LOG(FATAL) << "Unexpected or unimplemented type conversion from " << input_type
@@ -5918,7 +5925,7 @@
     uint32_t offset,
     Location maybe_temp,
     ReadBarrierOption read_barrier_option) {
-  Primitive::Type type = Primitive::kPrimNot;
+  DataType::Type type = DataType::Type::kReference;
   Register out_reg = RegisterFrom(out, type);
   if (read_barrier_option == kWithReadBarrier) {
     CHECK(kEmitCompilerReadBarrier);
@@ -5958,7 +5965,7 @@
     uint32_t offset,
     Location maybe_temp,
     ReadBarrierOption read_barrier_option) {
-  Primitive::Type type = Primitive::kPrimNot;
+  DataType::Type type = DataType::Type::kReference;
   Register out_reg = RegisterFrom(out, type);
   Register obj_reg = RegisterFrom(obj, type);
   if (read_barrier_option == kWithReadBarrier) {
@@ -5995,7 +6002,7 @@
     vixl::aarch64::Label* fixup_label,
     ReadBarrierOption read_barrier_option) {
   DCHECK(fixup_label == nullptr || offset == 0u);
-  Register root_reg = RegisterFrom(root, Primitive::kPrimNot);
+  Register root_reg = RegisterFrom(root, DataType::Type::kReference);
   if (read_barrier_option == kWithReadBarrier) {
     DCHECK(kEmitCompilerReadBarrier);
     if (kUseBakerReadBarrier) {
@@ -6159,7 +6166,7 @@
       static_assert(BAKER_MARK_INTROSPECTION_FIELD_LDR_OFFSET == (kPoisonHeapReferences ? -8 : -4),
                     "Field LDR must be 1 instruction (4B) before the return address label; "
                     " 2 instructions (8B) for heap poisoning.");
-      Register ref_reg = RegisterFrom(ref, Primitive::kPrimNot);
+      Register ref_reg = RegisterFrom(ref, DataType::Type::kReference);
       __ ldr(ref_reg, MemOperand(base.X(), offset));
       if (needs_null_check) {
         MaybeRecordImplicitNullCheck(instruction);
@@ -6199,7 +6206,7 @@
   static_assert(
       sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
       "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
-  size_t scale_factor = Primitive::ComponentSizeShift(Primitive::kPrimNot);
+  size_t scale_factor = DataType::SizeShift(DataType::Type::kReference);
 
   if (kBakerReadBarrierLinkTimeThunksEnableForArrays &&
       !Runtime::Current()->UseJitCompilation()) {
@@ -6224,8 +6231,8 @@
     //   gray_return_address:
 
     DCHECK(index.IsValid());
-    Register index_reg = RegisterFrom(index, Primitive::kPrimInt);
-    Register ref_reg = RegisterFrom(ref, Primitive::kPrimNot);
+    Register index_reg = RegisterFrom(index, DataType::Type::kInt32);
+    Register ref_reg = RegisterFrom(ref, DataType::Type::kReference);
 
     UseScratchRegisterScope temps(GetVIXLAssembler());
     DCHECK(temps.IsAvailable(ip0));
@@ -6397,7 +6404,7 @@
                                                   bool needs_null_check,
                                                   bool use_load_acquire) {
   DCHECK(obj.IsW());
-  Primitive::Type type = Primitive::kPrimNot;
+  DataType::Type type = DataType::Type::kReference;
   Register ref_reg = RegisterFrom(ref, type);
 
   // If needed, vixl::EmissionCheckScope guards are used to ensure
diff --git a/compiler/optimizing/code_generator_arm64.h b/compiler/optimizing/code_generator_arm64.h
index cebdaa1..21da955 100644
--- a/compiler/optimizing/code_generator_arm64.h
+++ b/compiler/optimizing/code_generator_arm64.h
@@ -100,7 +100,7 @@
                                                           vixl::aarch64::kDRegSize,
                                                           vixl::aarch64::d8.GetCode(),
                                                           vixl::aarch64::d15.GetCode());
-Location ARM64ReturnLocation(Primitive::Type return_type);
+Location ARM64ReturnLocation(DataType::Type return_type);
 
 class SlowPathCodeARM64 : public SlowPathCode {
  public:
@@ -171,7 +171,7 @@
                           kRuntimeParameterFpuRegistersLength,
                           kArm64PointerSize) {}
 
-  Location GetReturnLocation(Primitive::Type return_type);
+  Location GetReturnLocation(DataType::Type return_type);
 
  private:
   DISALLOW_COPY_AND_ASSIGN(InvokeRuntimeCallingConvention);
@@ -187,7 +187,7 @@
                           kParameterFPRegistersLength,
                           kArm64PointerSize) {}
 
-  Location GetReturnLocation(Primitive::Type return_type) const {
+  Location GetReturnLocation(DataType::Type return_type) const {
     return ARM64ReturnLocation(return_type);
   }
 
@@ -201,8 +201,8 @@
   InvokeDexCallingConventionVisitorARM64() {}
   virtual ~InvokeDexCallingConventionVisitorARM64() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type return_type) const OVERRIDE {
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type return_type) const OVERRIDE {
     return calling_convention.GetReturnLocation(return_type);
   }
   Location GetMethodLocation() const OVERRIDE;
@@ -223,16 +223,16 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return helpers::LocationFrom(vixl::aarch64::x0);
   }
-  Location GetReturnLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetReturnLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return helpers::LocationFrom(vixl::aarch64::x0);
   }
-  Location GetSetValueLocation(Primitive::Type type ATTRIBUTE_UNUSED,
+  Location GetSetValueLocation(DataType::Type type ATTRIBUTE_UNUSED,
                                bool is_instance) const OVERRIDE {
     return is_instance
         ? helpers::LocationFrom(vixl::aarch64::x2)
         : helpers::LocationFrom(vixl::aarch64::x1);
   }
-  Location GetFpuLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetFpuLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return helpers::LocationFrom(vixl::aarch64::d0);
   }
 
@@ -498,13 +498,13 @@
   // Code generation helpers.
   void MoveConstant(vixl::aarch64::CPURegister destination, HConstant* constant);
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
   void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
 
-  void Load(Primitive::Type type,
+  void Load(DataType::Type type,
             vixl::aarch64::CPURegister dst,
             const vixl::aarch64::MemOperand& src);
-  void Store(Primitive::Type type,
+  void Store(DataType::Type type,
              vixl::aarch64::CPURegister src,
              const vixl::aarch64::MemOperand& dst);
   void LoadAcquire(HInstruction* instruction,
@@ -512,7 +512,7 @@
                    const vixl::aarch64::MemOperand& src,
                    bool needs_null_check);
   void StoreRelease(HInstruction* instruction,
-                    Primitive::Type type,
+                    DataType::Type type,
                     vixl::aarch64::CPURegister src,
                     const vixl::aarch64::MemOperand& dst,
                     bool needs_null_check);
@@ -531,7 +531,7 @@
 
   ParallelMoveResolverARM64* GetMoveResolver() OVERRIDE { return &move_resolver_; }
 
-  bool NeedsTwoRegisters(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  bool NeedsTwoRegisters(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return false;
   }
 
@@ -557,7 +557,7 @@
       HInvokeVirtual* invoke, Location temp, SlowPathCode* slow_path = nullptr) OVERRIDE;
 
   void MoveFromReturnRegister(Location trg ATTRIBUTE_UNUSED,
-                              Primitive::Type type ATTRIBUTE_UNUSED) OVERRIDE {
+                              DataType::Type type ATTRIBUTE_UNUSED) OVERRIDE {
     UNIMPLEMENTED(FATAL);
   }
 
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index e1ea080..2b9e0fe 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -450,10 +450,10 @@
     codegen->EmitParallelMoves(
         locations->InAt(0),
         LocationFrom(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         locations->InAt(1),
         LocationFrom(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt);
+        DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -641,10 +641,10 @@
 
     codegen->EmitParallelMoves(locations->InAt(0),
                                LocationFrom(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimNot,
+                               DataType::Type::kReference,
                                locations->InAt(1),
                                LocationFrom(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       arm_codegen->InvokeRuntime(kQuickInstanceofNonTrivial,
                                  instruction_,
@@ -715,17 +715,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         LocationFrom(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         LocationFrom(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         LocationFrom(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -1365,16 +1365,16 @@
     HParallelMove parallel_move(codegen->GetGraph()->GetArena());
     parallel_move.AddMove(ref_,
                           LocationFrom(calling_convention.GetRegisterAt(0)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     parallel_move.AddMove(obj_,
                           LocationFrom(calling_convention.GetRegisterAt(1)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             LocationFrom(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -1641,7 +1641,7 @@
 
 static void GenerateLongDataProc(HDataProcWithShifterOp* instruction,
                                  CodeGeneratorARMVIXL* codegen) {
-  DCHECK_EQ(instruction->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(instruction->GetType(), DataType::Type::kInt64);
   DCHECK(HDataProcWithShifterOp::IsShiftOp(instruction->GetOpKind()));
 
   const LocationSummary* const locations = instruction->GetLocations();
@@ -1776,12 +1776,12 @@
     // care here.
     DCHECK(rhs_loc.GetConstant()->IsArithmeticZero());
 
-    const Primitive::Type type = instruction->InputAt(0)->GetType();
+    const DataType::Type type = instruction->InputAt(0)->GetType();
 
-    if (type == Primitive::kPrimFloat) {
+    if (type == DataType::Type::kFloat32) {
       __ Vcmp(F32, InputSRegisterAt(instruction, 0), 0.0);
     } else {
-      DCHECK_EQ(type, Primitive::kPrimDouble);
+      DCHECK_EQ(type, DataType::Type::kFloat64);
       __ Vcmp(F64, InputDRegisterAt(instruction, 0), 0.0);
     }
   } else {
@@ -1821,7 +1821,7 @@
     HCondition* condition,
     bool invert,
     CodeGeneratorARMVIXL* codegen) {
-  DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(condition->GetLeft()->GetType(), DataType::Type::kInt64);
 
   const LocationSummary* const locations = condition->GetLocations();
   IfCondition cond = condition->GetCondition();
@@ -1942,7 +1942,7 @@
     HCondition* condition,
     bool invert,
     CodeGeneratorARMVIXL* codegen) {
-  DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(condition->GetLeft()->GetType(), DataType::Type::kInt64);
 
   const LocationSummary* const locations = condition->GetLocations();
   IfCondition cond = condition->GetCondition();
@@ -2012,7 +2012,7 @@
 static std::pair<vixl32::Condition, vixl32::Condition> GenerateTest(HCondition* condition,
                                                                     bool invert,
                                                                     CodeGeneratorARMVIXL* codegen) {
-  const Primitive::Type type = condition->GetLeft()->GetType();
+  const DataType::Type type = condition->GetLeft()->GetType();
   IfCondition cond = condition->GetCondition();
   IfCondition opposite = condition->GetOppositeCondition();
   std::pair<vixl32::Condition, vixl32::Condition> ret(eq, ne);
@@ -2021,17 +2021,17 @@
     std::swap(cond, opposite);
   }
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     ret = condition->GetLocations()->InAt(1).IsConstant()
         ? GenerateLongTestConstant(condition, invert, codegen)
         : GenerateLongTest(condition, invert, codegen);
-  } else if (Primitive::IsFloatingPointType(type)) {
+  } else if (DataType::IsFloatingPointType(type)) {
     GenerateVcmp(condition, codegen);
     __ Vmrs(RegisterOrAPSR_nzcv(kPcCode), FPSCR);
     ret = std::make_pair(ARMFPCondition(cond, condition->IsGtBias()),
                          ARMFPCondition(opposite, condition->IsGtBias()));
   } else {
-    DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+    DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
     __ Cmp(InputRegisterAt(condition, 0), InputOperandAt(condition, 1));
     ret = std::make_pair(ARMCondition(cond), ARMCondition(opposite));
   }
@@ -2067,7 +2067,7 @@
 }
 
 static void GenerateEqualLong(HCondition* cond, CodeGeneratorARMVIXL* codegen) {
-  DCHECK_EQ(cond->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(cond->GetLeft()->GetType(), DataType::Type::kInt64);
 
   const LocationSummary* const locations = cond->GetLocations();
   IfCondition condition = cond->GetCondition();
@@ -2123,7 +2123,7 @@
 }
 
 static void GenerateConditionLong(HCondition* cond, CodeGeneratorARMVIXL* codegen) {
-  DCHECK_EQ(cond->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(cond->GetLeft()->GetType(), DataType::Type::kInt64);
 
   const LocationSummary* const locations = cond->GetLocations();
   IfCondition condition = cond->GetCondition();
@@ -2188,11 +2188,11 @@
 
 static void GenerateConditionIntegralOrNonPrimitive(HCondition* cond,
                                                     CodeGeneratorARMVIXL* codegen) {
-  const Primitive::Type type = cond->GetLeft()->GetType();
+  const DataType::Type type = cond->GetLeft()->GetType();
 
-  DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+  DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     GenerateConditionLong(cond, codegen);
     return;
   }
@@ -2278,12 +2278,12 @@
 }
 
 static bool CanEncodeConstantAs8BitImmediate(HConstant* constant) {
-  const Primitive::Type type = constant->GetType();
+  const DataType::Type type = constant->GetType();
   bool ret = false;
 
-  DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+  DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     const uint64_t value = Uint64ConstantFrom(constant);
 
     ret = IsUint<8>(Low32Bits(value)) && IsUint<8>(High32Bits(value));
@@ -2295,7 +2295,7 @@
 }
 
 static Location Arm8BitEncodableConstantOrRegister(HInstruction* constant) {
-  DCHECK(!Primitive::IsFloatingPointType(constant->GetType()));
+  DCHECK(!DataType::IsFloatingPointType(constant->GetType()));
 
   if (constant->IsConstant() && CanEncodeConstantAs8BitImmediate(constant->AsConstant())) {
     return Location::ConstantLocation(constant->AsConstant());
@@ -2596,14 +2596,14 @@
   __ Bind(GetLabelOf(block));
 }
 
-Location InvokeDexCallingConventionVisitorARMVIXL::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorARMVIXL::GetNextLocation(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       uint32_t index = gp_index_++;
       uint32_t stack_index = stack_index_++;
       if (index < calling_convention.GetNumberOfRegisters()) {
@@ -2613,7 +2613,7 @@
       }
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t index = gp_index_;
       uint32_t stack_index = stack_index_;
       gp_index_ += 2;
@@ -2636,7 +2636,7 @@
       }
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t stack_index = stack_index_++;
       if (float_index_ % 2 == 0) {
         float_index_ = std::max(double_index_, float_index_);
@@ -2648,7 +2648,7 @@
       }
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       double_index_ = std::max(double_index_, RoundUp(float_index_, 2));
       uint32_t stack_index = stack_index_;
       stack_index_ += 2;
@@ -2665,37 +2665,37 @@
       }
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unexpected parameter type " << type;
       break;
   }
   return Location::NoLocation();
 }
 
-Location InvokeDexCallingConventionVisitorARMVIXL::GetReturnLocation(Primitive::Type type) const {
+Location InvokeDexCallingConventionVisitorARMVIXL::GetReturnLocation(DataType::Type type) const {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       return LocationFrom(r0);
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       return LocationFrom(s0);
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       return LocationFrom(r0, r1);
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       return LocationFrom(s0, s1);
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       return Location::NoLocation();
   }
 
@@ -2753,7 +2753,7 @@
   __ Mov(RegisterFrom(location), value);
 }
 
-void CodeGeneratorARMVIXL::MoveLocation(Location dst, Location src, Primitive::Type dst_type) {
+void CodeGeneratorARMVIXL::MoveLocation(Location dst, Location src, DataType::Type dst_type) {
   // TODO(VIXL): Maybe refactor to have the 'move' implementation here and use it in
   // `ParallelMoveResolverARMVIXL::EmitMove`, as is done in the `arm64` backend.
   HParallelMove move(GetGraph()->GetArena());
@@ -2936,8 +2936,8 @@
 
     // If this is a long or FP comparison that has been folded into
     // the HCondition, generate the comparison directly.
-    Primitive::Type type = condition->InputAt(0)->GetType();
-    if (type == Primitive::kPrimLong || Primitive::IsFloatingPointType(type)) {
+    DataType::Type type = condition->InputAt(0)->GetType();
+    if (type == DataType::Type::kInt64 || DataType::IsFloatingPointType(type)) {
       GenerateCompareTestAndBranch(condition, true_target, false_target, far_target);
       return;
     }
@@ -3028,7 +3028,7 @@
 
 void LocationsBuilderARMVIXL::VisitSelect(HSelect* select) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
-  const bool is_floating_point = Primitive::IsFloatingPointType(select->GetType());
+  const bool is_floating_point = DataType::IsFloatingPointType(select->GetType());
 
   if (is_floating_point) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
@@ -3056,7 +3056,7 @@
 void InstructionCodeGeneratorARMVIXL::VisitSelect(HSelect* select) {
   HInstruction* const condition = select->GetCondition();
   const LocationSummary* const locations = select->GetLocations();
-  const Primitive::Type type = select->GetType();
+  const DataType::Type type = select->GetType();
   const Location first = locations->InAt(0);
   const Location out = locations->Out();
   const Location second = locations->InAt(1);
@@ -3073,7 +3073,7 @@
     return;
   }
 
-  if (!Primitive::IsFloatingPointType(type)) {
+  if (!DataType::IsFloatingPointType(type)) {
     bool invert = false;
 
     if (out.Equals(second)) {
@@ -3261,7 +3261,7 @@
       new (GetGraph()->GetArena()) LocationSummary(cond, LocationSummary::kNoCall);
   // Handle the long/FP comparisons made in instruction simplification.
   switch (cond->InputAt(0)->GetType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(cond->InputAt(1)));
       if (!cond->IsEmittedAtUseSite()) {
@@ -3269,8 +3269,8 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, ArithmeticZeroOrFpuRegister(cond->InputAt(1)));
       if (!cond->IsEmittedAtUseSite()) {
@@ -3292,22 +3292,22 @@
     return;
   }
 
-  const Primitive::Type type = cond->GetLeft()->GetType();
+  const DataType::Type type = cond->GetLeft()->GetType();
 
-  if (Primitive::IsFloatingPointType(type)) {
+  if (DataType::IsFloatingPointType(type)) {
     GenerateConditionGeneric(cond, codegen_);
     return;
   }
 
-  DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+  DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
 
   const IfCondition condition = cond->GetCondition();
 
   // A condition with only one boolean input, or two boolean inputs without being equality or
   // inequality results from transformations done by the instruction simplifier, and is handled
   // as a regular condition with integral inputs.
-  if (type == Primitive::kPrimBoolean &&
-      cond->GetRight()->GetType() == Primitive::kPrimBoolean &&
+  if (type == DataType::Type::kBool &&
+      cond->GetRight()->GetType() == DataType::Type::kBool &&
       (condition == kCondEQ || condition == kCondNE)) {
     vixl32::Register left = InputRegisterAt(cond, 0);
     const vixl32::Register out = OutputRegister(cond);
@@ -3670,19 +3670,19 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -3697,11 +3697,11 @@
   Location out = locations->Out();
   Location in = locations->InAt(0);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ Rsb(OutputRegister(neg), InputRegisterAt(neg, 0), 0);
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // out.lo = 0 - in.lo (and update the carry/borrow (C) flag)
       __ Rsbs(LowRegisterFrom(out), LowRegisterFrom(in), 0);
       // We cannot emit an RSC (Reverse Subtract with Carry)
@@ -3715,8 +3715,8 @@
       __ Sub(HighRegisterFrom(out), HighRegisterFrom(out), HighRegisterFrom(in));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Vneg(OutputVRegister(neg), InputVRegister(neg));
       break;
 
@@ -3726,16 +3726,16 @@
 }
 
 void LocationsBuilderARMVIXL::VisitTypeConversion(HTypeConversion* conversion) {
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
 
   // The float-to-long, double-to-long and long-to-float type conversions
   // rely on a call to the runtime.
   LocationSummary::CallKind call_kind =
-      (((input_type == Primitive::kPrimFloat || input_type == Primitive::kPrimDouble)
-        && result_type == Primitive::kPrimLong)
-       || (input_type == Primitive::kPrimLong && result_type == Primitive::kPrimFloat))
+      (((input_type == DataType::Type::kFloat32 || input_type == DataType::Type::kFloat64)
+        && result_type == DataType::Type::kInt64)
+       || (input_type == DataType::Type::kInt64 && result_type == DataType::Type::kFloat32))
       ? LocationSummary::kCallOnMainOnly
       : LocationSummary::kNoCall;
   LocationSummary* locations =
@@ -3745,15 +3745,15 @@
   // our bit representation makes it safe.
 
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to byte is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -3765,15 +3765,15 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -3785,22 +3785,22 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
           locations->AddTemp(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
@@ -3813,20 +3813,20 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
           break;
 
-        case Primitive::kPrimFloat: {
+        case DataType::Type::kFloat32: {
           // Processing a Dex `float-to-long' instruction.
           InvokeRuntimeCallingConventionARMVIXL calling_convention;
           locations->SetInAt(0, LocationFrom(calling_convention.GetFpuRegisterAt(0)));
@@ -3834,7 +3834,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat64: {
           // Processing a Dex `double-to-long' instruction.
           InvokeRuntimeCallingConventionARMVIXL calling_convention;
           locations->SetInAt(0, LocationFrom(calling_convention.GetFpuRegisterAt(0),
@@ -3849,15 +3849,15 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to char is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `int-to-char' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -3869,20 +3869,20 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-float' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           // Processing a Dex `long-to-float' instruction.
           InvokeRuntimeCallingConventionARMVIXL calling_convention;
           locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0),
@@ -3891,7 +3891,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3903,20 +3903,20 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-double' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-double' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresFpuRegister());
@@ -3924,7 +3924,7 @@
           locations->AddTemp(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3946,21 +3946,21 @@
   LocationSummary* locations = conversion->GetLocations();
   Location out = locations->Out();
   Location in = locations->InAt(0);
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to byte is a result of code transformations.
           __ Sbfx(OutputRegister(conversion), LowRegisterFrom(in), 0, 8);
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           __ Sbfx(OutputRegister(conversion), InputRegisterAt(conversion, 0), 0, 8);
           break;
@@ -3971,17 +3971,17 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
           __ Sbfx(OutputRegister(conversion), LowRegisterFrom(in), 0, 16);
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           __ Sbfx(OutputRegister(conversion), InputRegisterAt(conversion, 0), 0, 16);
           break;
@@ -3992,9 +3992,9 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           DCHECK(out.IsRegister());
           if (in.IsRegisterPair()) {
@@ -4012,7 +4012,7 @@
           }
           break;
 
-        case Primitive::kPrimFloat: {
+        case DataType::Type::kFloat32: {
           // Processing a Dex `float-to-int' instruction.
           vixl32::SRegister temp = LowSRegisterFrom(locations->GetTemp(0));
           __ Vcvt(S32, F32, temp, InputSRegisterAt(conversion, 0));
@@ -4020,7 +4020,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat64: {
           // Processing a Dex `double-to-int' instruction.
           vixl32::SRegister temp_s = LowSRegisterFrom(locations->GetTemp(0));
           __ Vcvt(S32, F64, temp_s, DRegisterFrom(in));
@@ -4034,14 +4034,14 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           DCHECK(out.IsRegisterPair());
           DCHECK(in.IsRegister());
@@ -4050,13 +4050,13 @@
           __ Asr(HighRegisterFrom(out), LowRegisterFrom(out), 31);
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-long' instruction.
           codegen_->InvokeRuntime(kQuickF2l, conversion, conversion->GetDexPc());
           CheckEntrypointTypes<kQuickF2l, int64_t, float>();
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-long' instruction.
           codegen_->InvokeRuntime(kQuickD2l, conversion, conversion->GetDexPc());
           CheckEntrypointTypes<kQuickD2l, int64_t, double>();
@@ -4068,17 +4068,17 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to char is a result of code transformations.
           __ Ubfx(OutputRegister(conversion), LowRegisterFrom(in), 0, 16);
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `int-to-char' instruction.
           __ Ubfx(OutputRegister(conversion), InputRegisterAt(conversion, 0), 0, 16);
           break;
@@ -4089,27 +4089,27 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar: {
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16: {
           // Processing a Dex `int-to-float' instruction.
           __ Vmov(OutputSRegister(conversion), InputRegisterAt(conversion, 0));
           __ Vcvt(F32, S32, OutputSRegister(conversion), OutputSRegister(conversion));
           break;
         }
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-float' instruction.
           codegen_->InvokeRuntime(kQuickL2f, conversion, conversion->GetDexPc());
           CheckEntrypointTypes<kQuickL2f, float, int64_t>();
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           __ Vcvt(F32, F64, OutputSRegister(conversion), DRegisterFrom(in));
           break;
@@ -4120,21 +4120,21 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar: {
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16: {
           // Processing a Dex `int-to-double' instruction.
           __ Vmov(LowSRegisterFrom(out), InputRegisterAt(conversion, 0));
           __ Vcvt(F64, S32, DRegisterFrom(out), LowSRegisterFrom(out));
           break;
         }
 
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           // Processing a Dex `long-to-double' instruction.
           vixl32::Register low = LowRegisterFrom(in);
           vixl32::Register high = HighRegisterFrom(in);
@@ -4157,7 +4157,7 @@
           break;
         }
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           __ Vcvt(F64, F32, DRegisterFrom(out), InputSRegisterAt(conversion, 0));
           break;
@@ -4178,22 +4178,22 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(add, LocationSummary::kNoCall);
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(add->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, ArmEncodableConstantOrRegister(add->InputAt(1), ADD));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -4212,12 +4212,12 @@
   Location second = locations->InAt(1);
 
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       __ Add(OutputRegister(add), InputRegisterAt(add, 0), InputOperandAt(add, 1));
       }
       break;
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsConstant()) {
         uint64_t value = static_cast<uint64_t>(Int64FromConstant(second.GetConstant()));
         GenerateAddLongConst(out, first, value);
@@ -4229,8 +4229,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Vadd(OutputVRegister(add), InputVRegisterAt(add, 0), InputVRegisterAt(add, 1));
       break;
 
@@ -4243,21 +4243,21 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(sub, LocationSummary::kNoCall);
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(sub->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, ArmEncodableConstantOrRegister(sub->InputAt(1), SUB));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -4274,12 +4274,12 @@
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       __ Sub(OutputRegister(sub), InputRegisterAt(sub, 0), InputOperandAt(sub, 1));
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsConstant()) {
         uint64_t value = static_cast<uint64_t>(Int64FromConstant(second.GetConstant()));
         GenerateAddLongConst(out, first, -value);
@@ -4291,8 +4291,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Vsub(OutputVRegister(sub), InputVRegisterAt(sub, 0), InputVRegisterAt(sub, 1));
       break;
 
@@ -4305,16 +4305,16 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:  {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:  {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -4332,11 +4332,11 @@
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       __ Mul(OutputRegister(mul), InputRegisterAt(mul, 0), InputRegisterAt(mul, 1));
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       vixl32::Register out_hi = HighRegisterFrom(out);
       vixl32::Register out_lo = LowRegisterFrom(out);
       vixl32::Register in1_hi = HighRegisterFrom(first);
@@ -4369,8 +4369,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Vmul(OutputVRegister(mul), InputVRegisterAt(mul, 0), InputVRegisterAt(mul, 1));
       break;
 
@@ -4381,7 +4381,7 @@
 
 void InstructionCodeGeneratorARMVIXL::DivRemOneOrMinusOne(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32);
 
   Location second = instruction->GetLocations()->InAt(1);
   DCHECK(second.IsConstant());
@@ -4404,7 +4404,7 @@
 
 void InstructionCodeGeneratorARMVIXL::DivRemByPowerOfTwo(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -4438,7 +4438,7 @@
 
 void InstructionCodeGeneratorARMVIXL::GenerateDivRemWithAnyConstant(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -4481,7 +4481,7 @@
 void InstructionCodeGeneratorARMVIXL::GenerateDivRemConstantIntegral(
     HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32);
 
   Location second = instruction->GetLocations()->InAt(1);
   DCHECK(second.IsConstant());
@@ -4501,12 +4501,12 @@
 
 void LocationsBuilderARMVIXL::VisitDiv(HDiv* div) {
   LocationSummary::CallKind call_kind = LocationSummary::kNoCall;
-  if (div->GetResultType() == Primitive::kPrimLong) {
+  if (div->GetResultType() == DataType::Type::kInt64) {
     // pLdiv runtime call.
     call_kind = LocationSummary::kCallOnMainOnly;
-  } else if (div->GetResultType() == Primitive::kPrimInt && div->InputAt(1)->IsConstant()) {
+  } else if (div->GetResultType() == DataType::Type::kInt32 && div->InputAt(1)->IsConstant()) {
     // sdiv will be replaced by other instruction sequence.
-  } else if (div->GetResultType() == Primitive::kPrimInt &&
+  } else if (div->GetResultType() == DataType::Type::kInt32 &&
              !codegen_->GetInstructionSetFeatures().HasDivideInstruction()) {
     // pIdivmod runtime call.
     call_kind = LocationSummary::kCallOnMainOnly;
@@ -4515,7 +4515,7 @@
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(div, call_kind);
 
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (div->InputAt(1)->IsConstant()) {
         locations->SetInAt(0, Location::RequiresRegister());
         locations->SetInAt(1, Location::ConstantLocation(div->InputAt(1)->AsConstant()));
@@ -4543,7 +4543,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConventionARMVIXL calling_convention;
       locations->SetInAt(0, LocationFrom(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -4552,8 +4552,8 @@
       locations->SetOut(LocationFrom(r0, r1));
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -4570,7 +4570,7 @@
   Location rhs = div->GetLocations()->InAt(1);
 
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (rhs.IsConstant()) {
         GenerateDivRemConstantIntegral(div);
       } else if (codegen_->GetInstructionSetFeatures().HasDivideInstruction()) {
@@ -4587,7 +4587,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConventionARMVIXL calling_convention;
       DCHECK(calling_convention.GetRegisterAt(0).Is(LowRegisterFrom(lhs)));
       DCHECK(calling_convention.GetRegisterAt(1).Is(HighRegisterFrom(lhs)));
@@ -4601,8 +4601,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Vdiv(OutputVRegister(div), InputVRegisterAt(div, 0), InputVRegisterAt(div, 1));
       break;
 
@@ -4612,14 +4612,14 @@
 }
 
 void LocationsBuilderARMVIXL::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
 
   // Most remainders are implemented in the runtime.
   LocationSummary::CallKind call_kind = LocationSummary::kCallOnMainOnly;
-  if (rem->GetResultType() == Primitive::kPrimInt && rem->InputAt(1)->IsConstant()) {
+  if (rem->GetResultType() == DataType::Type::kInt32 && rem->InputAt(1)->IsConstant()) {
     // sdiv will be replaced by other instruction sequence.
     call_kind = LocationSummary::kNoCall;
-  } else if ((rem->GetResultType() == Primitive::kPrimInt)
+  } else if ((rem->GetResultType() == DataType::Type::kInt32)
              && codegen_->GetInstructionSetFeatures().HasDivideInstruction()) {
     // Have hardware divide instruction for int, do it with three instructions.
     call_kind = LocationSummary::kNoCall;
@@ -4628,7 +4628,7 @@
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(rem, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (rem->InputAt(1)->IsConstant()) {
         locations->SetInAt(0, Location::RequiresRegister());
         locations->SetInAt(1, Location::ConstantLocation(rem->InputAt(1)->AsConstant()));
@@ -4657,7 +4657,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConventionARMVIXL calling_convention;
       locations->SetInAt(0, LocationFrom(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -4667,7 +4667,7 @@
       locations->SetOut(LocationFrom(r2, r3));
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       InvokeRuntimeCallingConventionARMVIXL calling_convention;
       locations->SetInAt(0, LocationFrom(calling_convention.GetFpuRegisterAt(0)));
       locations->SetInAt(1, LocationFrom(calling_convention.GetFpuRegisterAt(1)));
@@ -4675,7 +4675,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       InvokeRuntimeCallingConventionARMVIXL calling_convention;
       locations->SetInAt(0, LocationFrom(
           calling_convention.GetFpuRegisterAt(0), calling_convention.GetFpuRegisterAt(1)));
@@ -4694,9 +4694,9 @@
   LocationSummary* locations = rem->GetLocations();
   Location second = locations->InAt(1);
 
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
         vixl32::Register reg1 = InputRegisterAt(rem, 0);
         vixl32::Register out_reg = OutputRegister(rem);
         if (second.IsConstant()) {
@@ -4721,19 +4721,19 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       codegen_->InvokeRuntime(kQuickLmod, rem, rem->GetDexPc());
         CheckEntrypointTypes<kQuickLmod, int64_t, int64_t, int64_t>();
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       codegen_->InvokeRuntime(kQuickFmodf, rem, rem->GetDexPc());
       CheckEntrypointTypes<kQuickFmodf, float, float, float>();
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       codegen_->InvokeRuntime(kQuickFmod, rem, rem->GetDexPc());
       CheckEntrypointTypes<kQuickFmod, double, double, double>();
       break;
@@ -4759,11 +4759,11 @@
   Location value = locations->InAt(0);
 
   switch (instruction->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32: {
       if (value.IsRegister()) {
         __ CompareAndBranchIfZero(InputRegisterAt(instruction, 0), slow_path->GetEntryLabel());
       } else {
@@ -4774,7 +4774,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (value.IsRegisterPair()) {
         UseScratchRegisterScope temps(GetVIXLAssembler());
         vixl32::Register temp = temps.Acquire();
@@ -4891,13 +4891,13 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(ror, LocationSummary::kNoCall);
   switch (ror->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(ror->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       if (ror->InputAt(1)->IsConstant()) {
         locations->SetInAt(1, Location::ConstantLocation(ror->InputAt(1)->AsConstant()));
@@ -4915,13 +4915,13 @@
 }
 
 void InstructionCodeGeneratorARMVIXL::VisitRor(HRor* ror) {
-  Primitive::Type type = ror->GetResultType();
+  DataType::Type type = ror->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       HandleIntegerRotate(ror);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       HandleLongRotate(ror);
       break;
     }
@@ -4938,7 +4938,7 @@
       new (GetGraph()->GetArena()) LocationSummary(op, LocationSummary::kNoCall);
 
   switch (op->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       if (op->InputAt(1)->IsConstant()) {
         locations->SetInAt(1, Location::ConstantLocation(op->InputAt(1)->AsConstant()));
@@ -4951,7 +4951,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       if (op->InputAt(1)->IsConstant()) {
         locations->SetInAt(1, Location::ConstantLocation(op->InputAt(1)->AsConstant()));
@@ -4978,9 +4978,9 @@
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
 
-  Primitive::Type type = op->GetResultType();
+  DataType::Type type = op->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       vixl32::Register out_reg = OutputRegister(op);
       vixl32::Register first_reg = InputRegisterAt(op, 0);
       if (second.IsRegister()) {
@@ -5009,7 +5009,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       vixl32::Register o_h = HighRegisterFrom(out);
       vixl32::Register o_l = LowRegisterFrom(out);
 
@@ -5258,11 +5258,11 @@
   Location out = locations->Out();
   Location in = locations->InAt(0);
   switch (not_->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ Mvn(OutputRegister(not_), InputRegisterAt(not_, 0));
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ Mvn(LowRegisterFrom(out), LowRegisterFrom(in));
       __ Mvn(HighRegisterFrom(out), HighRegisterFrom(in));
       break;
@@ -5287,20 +5287,20 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(compare, LocationSummary::kNoCall);
   switch (compare->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       // Output overlaps because it is written before doing the low comparison.
       locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, ArithmeticZeroOrFpuRegister(compare->InputAt(1)));
       locations->SetOut(Location::RequiresRegister());
@@ -5319,21 +5319,21 @@
 
   vixl32::Label less, greater, done;
   vixl32::Label* final_label = codegen_->GetFinalLabel(compare, &done);
-  Primitive::Type type = compare->InputAt(0)->GetType();
+  DataType::Type type = compare->InputAt(0)->GetType();
   vixl32::Condition less_cond = vixl32::Condition(kNone);
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       // Emit move to `out` before the `Cmp`, as `Mov` might affect the status flags.
       __ Mov(out, 0);
       __ Cmp(RegisterFrom(left), RegisterFrom(right));  // Signed compare.
       less_cond = lt;
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       __ Cmp(HighRegisterFrom(left), HighRegisterFrom(right));  // Signed compare.
       __ B(lt, &less, /* far_target */ false);
       __ B(gt, &greater, /* far_target */ false);
@@ -5343,8 +5343,8 @@
       less_cond = lo;
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       __ Mov(out, 0);
       GenerateVcmp(compare, codegen_);
       // To branch on the FP compare result we transfer FPSCR to APSR (encoded as PC in VMRS).
@@ -5455,14 +5455,14 @@
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
   locations->SetInAt(0, Location::RequiresRegister());
 
-  Primitive::Type field_type = field_info.GetFieldType();
-  if (Primitive::IsFloatingPointType(field_type)) {
+  DataType::Type field_type = field_info.GetFieldType();
+  if (DataType::IsFloatingPointType(field_type)) {
     locations->SetInAt(1, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(1, Location::RequiresRegister());
   }
 
-  bool is_wide = field_type == Primitive::kPrimLong || field_type == Primitive::kPrimDouble;
+  bool is_wide = field_type == DataType::Type::kInt64 || field_type == DataType::Type::kFloat64;
   bool generate_volatile = field_info.IsVolatile()
       && is_wide
       && !codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
@@ -5483,7 +5483,7 @@
 
     locations->AddTemp(Location::RequiresRegister());
     locations->AddTemp(Location::RequiresRegister());
-    if (field_type == Primitive::kPrimDouble) {
+    if (field_type == DataType::Type::kFloat64) {
       // For doubles we need two more registers to copy the value.
       locations->AddTemp(LocationFrom(r2));
       locations->AddTemp(LocationFrom(r3));
@@ -5502,7 +5502,7 @@
 
   bool is_volatile = field_info.IsVolatile();
   bool atomic_ldrd_strd = codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(field_type, instruction->InputAt(1));
@@ -5512,25 +5512,25 @@
   }
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       GetAssembler()->StoreToOffset(kStoreByte, RegisterFrom(value), base, offset);
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       GetAssembler()->StoreToOffset(kStoreHalfword, RegisterFrom(value), base, offset);
       break;
     }
 
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       if (kPoisonHeapReferences && needs_write_barrier) {
         // Note that in the case where `value` is a null reference,
         // we do not enter this block, as a null reference does not
         // need poisoning.
-        DCHECK_EQ(field_type, Primitive::kPrimNot);
+        DCHECK_EQ(field_type, DataType::Type::kReference);
         vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
         __ Mov(temp, RegisterFrom(value));
         GetAssembler()->PoisonHeapReference(temp);
@@ -5541,7 +5541,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (is_volatile && !atomic_ldrd_strd) {
         GenerateWideAtomicStore(base,
                                 offset,
@@ -5557,12 +5557,12 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       GetAssembler()->StoreSToOffset(SRegisterFrom(value), base, offset);
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       vixl32::DRegister value_reg = DRegisterFrom(value);
       if (is_volatile && !atomic_ldrd_strd) {
         vixl32::Register value_reg_lo = RegisterFrom(locations->GetTemp(0));
@@ -5584,13 +5584,13 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
 
   // Longs and doubles are handled in the switch.
-  if (field_type != Primitive::kPrimLong && field_type != Primitive::kPrimDouble) {
+  if (field_type != DataType::Type::kInt64 && field_type != DataType::Type::kFloat64) {
     // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, we
     // should use a scope and the assembler to emit the store instruction to guarantee that we
     // record the pc at the correct position. But the `Assembler` does not automatically handle
@@ -5615,7 +5615,7 @@
   DCHECK(instruction->IsInstanceFieldGet() || instruction->IsStaticFieldGet());
 
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (field_info.GetFieldType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (field_info.GetFieldType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_field_get_with_read_barrier ?
@@ -5627,17 +5627,18 @@
   locations->SetInAt(0, Location::RequiresRegister());
 
   bool volatile_for_double = field_info.IsVolatile()
-      && (field_info.GetFieldType() == Primitive::kPrimDouble)
+      && (field_info.GetFieldType() == DataType::Type::kFloat64)
       && !codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
   // The output overlaps in case of volatile long: we don't want the
   // code generated by GenerateWideAtomicLoad to overwrite the
   // object's location.  Likewise, in the case of an object field get
   // with read barriers enabled, we do not want the load to overwrite
   // the object's location, as we need it to emit the read barrier.
-  bool overlap = (field_info.IsVolatile() && (field_info.GetFieldType() == Primitive::kPrimLong)) ||
+  bool overlap =
+      (field_info.IsVolatile() && (field_info.GetFieldType() == DataType::Type::kInt64)) ||
       object_field_get_with_read_barrier;
 
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister());
   } else {
     locations->SetOut(Location::RequiresRegister(),
@@ -5671,7 +5672,7 @@
 }
 
 Location LocationsBuilderARMVIXL::ArithmeticZeroOrFpuRegister(HInstruction* input) {
-  DCHECK(Primitive::IsFloatingPointType(input->GetType())) << input->GetType();
+  DCHECK(DataType::IsFloatingPointType(input->GetType())) << input->GetType();
   if ((input->IsFloatConstant() && (input->AsFloatConstant()->IsArithmeticZero())) ||
       (input->IsDoubleConstant() && (input->AsDoubleConstant()->IsArithmeticZero()))) {
     return Location::ConstantLocation(input->AsConstant());
@@ -5682,7 +5683,7 @@
 
 Location LocationsBuilderARMVIXL::ArmEncodableConstantOrRegister(HInstruction* constant,
                                                                  Opcode opcode) {
-  DCHECK(!Primitive::IsFloatingPointType(constant->GetType()));
+  DCHECK(!DataType::IsFloatingPointType(constant->GetType()));
   if (constant->IsConstant() &&
       CanEncodeConstantAsImmediate(constant->AsConstant(), opcode)) {
     return Location::ConstantLocation(constant->AsConstant());
@@ -5693,7 +5694,7 @@
 bool LocationsBuilderARMVIXL::CanEncodeConstantAsImmediate(HConstant* input_cst,
                                                            Opcode opcode) {
   uint64_t value = static_cast<uint64_t>(Int64FromConstant(input_cst));
-  if (Primitive::Is64BitType(input_cst->GetType())) {
+  if (DataType::Is64BitType(input_cst->GetType())) {
     Opcode high_opcode = opcode;
     SetCc low_set_cc = kCcDontCare;
     switch (opcode) {
@@ -5758,31 +5759,31 @@
   Location out = locations->Out();
   bool is_volatile = field_info.IsVolatile();
   bool atomic_ldrd_strd = codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       GetAssembler()->LoadFromOffset(kLoadUnsignedByte, RegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       GetAssembler()->LoadFromOffset(kLoadSignedByte, RegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       GetAssembler()->LoadFromOffset(kLoadSignedHalfword, RegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       GetAssembler()->LoadFromOffset(kLoadUnsignedHalfword, RegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       // /* HeapReference<Object> */ out = *(base + offset)
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         Location temp_loc = locations->GetTemp(0);
@@ -5807,7 +5808,7 @@
       break;
     }
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (is_volatile && !atomic_ldrd_strd) {
         GenerateWideAtomicLoad(base, offset, LowRegisterFrom(out), HighRegisterFrom(out));
       } else {
@@ -5815,11 +5816,11 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       GetAssembler()->LoadSFromOffset(SRegisterFrom(out), base, offset);
       break;
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       vixl32::DRegister out_dreg = DRegisterFrom(out);
       if (is_volatile && !atomic_ldrd_strd) {
         vixl32::Register lo = RegisterFrom(locations->GetTemp(0));
@@ -5836,12 +5837,12 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
 
-  if (field_type == Primitive::kPrimNot || field_type == Primitive::kPrimDouble) {
+  if (field_type == DataType::Type::kReference || field_type == DataType::Type::kFloat64) {
     // Potential implicit null checks, in the case of reference or
     // double fields, are handled in the previous switch statement.
   } else {
@@ -5855,7 +5856,7 @@
   }
 
   if (is_volatile) {
-    if (field_type == Primitive::kPrimNot) {
+    if (field_type == DataType::Type::kReference) {
       // Memory barriers, in the case of references, are also handled
       // in the previous switch statement.
     } else {
@@ -5994,25 +5995,25 @@
   codegen_->GenerateNullCheck(instruction);
 }
 
-static LoadOperandType GetLoadOperandType(Primitive::Type type) {
+static LoadOperandType GetLoadOperandType(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       return kLoadWord;
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       return kLoadUnsignedByte;
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       return kLoadSignedByte;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       return kLoadUnsignedHalfword;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       return kLoadSignedHalfword;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       return kLoadWord;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       return kLoadWordPair;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       return kLoadSWord;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       return kLoadDWord;
     default:
       LOG(FATAL) << "Unreachable type " << type;
@@ -6020,23 +6021,23 @@
   }
 }
 
-static StoreOperandType GetStoreOperandType(Primitive::Type type) {
+static StoreOperandType GetStoreOperandType(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       return kStoreWord;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       return kStoreByte;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       return kStoreHalfword;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       return kStoreWord;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       return kStoreWordPair;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       return kStoreSWord;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       return kStoreDWord;
     default:
       LOG(FATAL) << "Unreachable type " << type;
@@ -6044,66 +6045,66 @@
   }
 }
 
-void CodeGeneratorARMVIXL::LoadFromShiftedRegOffset(Primitive::Type type,
+void CodeGeneratorARMVIXL::LoadFromShiftedRegOffset(DataType::Type type,
                                                     Location out_loc,
                                                     vixl32::Register base,
                                                     vixl32::Register reg_index,
                                                     vixl32::Condition cond) {
-  uint32_t shift_count = Primitive::ComponentSizeShift(type);
+  uint32_t shift_count = DataType::SizeShift(type);
   MemOperand mem_address(base, reg_index, vixl32::LSL, shift_count);
 
   switch (type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       __ Ldrsb(cond, RegisterFrom(out_loc), mem_address);
       break;
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       __ Ldrb(cond, RegisterFrom(out_loc), mem_address);
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ Ldrsh(cond, RegisterFrom(out_loc), mem_address);
       break;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       __ Ldrh(cond, RegisterFrom(out_loc), mem_address);
       break;
-    case Primitive::kPrimNot:
-    case Primitive::kPrimInt:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt32:
       __ Ldr(cond, RegisterFrom(out_loc), mem_address);
       break;
     // T32 doesn't support LoadFromShiftedRegOffset mem address mode for these types.
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
     default:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
 }
 
-void CodeGeneratorARMVIXL::StoreToShiftedRegOffset(Primitive::Type type,
+void CodeGeneratorARMVIXL::StoreToShiftedRegOffset(DataType::Type type,
                                                    Location loc,
                                                    vixl32::Register base,
                                                    vixl32::Register reg_index,
                                                    vixl32::Condition cond) {
-  uint32_t shift_count = Primitive::ComponentSizeShift(type);
+  uint32_t shift_count = DataType::SizeShift(type);
   MemOperand mem_address(base, reg_index, vixl32::LSL, shift_count);
 
   switch (type) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kInt8:
+    case DataType::Type::kBool:
       __ Strb(cond, RegisterFrom(loc), mem_address);
       break;
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
       __ Strh(cond, RegisterFrom(loc), mem_address);
       break;
-    case Primitive::kPrimNot:
-    case Primitive::kPrimInt:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt32:
       __ Str(cond, RegisterFrom(loc), mem_address);
       break;
     // T32 doesn't support StoreToShiftedRegOffset mem address mode for these types.
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
     default:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
@@ -6112,7 +6113,7 @@
 
 void LocationsBuilderARMVIXL::VisitArrayGet(HArrayGet* instruction) {
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier ?
@@ -6123,7 +6124,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps in the case of an object array get with
@@ -6144,7 +6145,7 @@
       // constant index loads we need a temporary only if the offset is too big.
       uint32_t offset = CodeGenerator::GetArrayDataOffset(instruction);
       uint32_t index = instruction->GetIndex()->AsIntConstant()->GetValue();
-      offset += index << Primitive::ComponentSizeShift(Primitive::kPrimNot);
+      offset += index << DataType::SizeShift(DataType::Type::kReference);
       if (offset >= kReferenceLoadMinFarOffset) {
         locations->AddTemp(Location::RequiresRegister());
       }
@@ -6173,18 +6174,18 @@
   Location index = locations->InAt(1);
   Location out_loc = locations->Out();
   uint32_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   const bool maybe_compressed_char_at = mirror::kUseStringCompression &&
                                         instruction->IsStringCharAt();
   HInstruction* array_instr = instruction->GetArray();
   bool has_intermediate_address = array_instr->IsIntermediateAddress();
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       vixl32::Register length;
       if (maybe_compressed_char_at) {
         length = RegisterFrom(locations->GetTemp(0));
@@ -6207,7 +6208,7 @@
                                          data_offset + const_index);
           __ B(final_label);
           __ Bind(&uncompressed_load);
-          GetAssembler()->LoadFromOffset(GetLoadOperandType(Primitive::kPrimChar),
+          GetAssembler()->LoadFromOffset(GetLoadOperandType(DataType::Type::kUint16),
                                          RegisterFrom(out_loc),
                                          obj,
                                          data_offset + (const_index << 1));
@@ -6215,7 +6216,7 @@
             __ Bind(&done);
           }
         } else {
-          uint32_t full_offset = data_offset + (const_index << Primitive::ComponentSizeShift(type));
+          uint32_t full_offset = data_offset + (const_index << DataType::SizeShift(type));
 
           LoadOperandType load_type = GetLoadOperandType(type);
           GetAssembler()->LoadFromOffset(load_type, RegisterFrom(out_loc), obj, full_offset);
@@ -6257,7 +6258,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       // The read barrier instrumentation of object ArrayGet
       // instructions does not support the HIntermediateAddress
       // instruction.
@@ -6275,7 +6276,7 @@
         DCHECK(!instruction->CanDoImplicitNullCheckOn(instruction->InputAt(0)));
         if (index.IsConstant()) {
           // Array load with a constant index can be treated as a field load.
-          data_offset += Int32ConstantFrom(index) << Primitive::ComponentSizeShift(type);
+          data_offset += Int32ConstantFrom(index) << DataType::SizeShift(type);
           codegen_->GenerateFieldLoadWithBakerReadBarrier(instruction,
                                                           out_loc,
                                                           obj,
@@ -6334,7 +6335,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (index.IsConstant()) {
         size_t offset =
             (Int32ConstantFrom(index) << TIMES_8) + data_offset;
@@ -6348,7 +6349,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       vixl32::SRegister out = SRegisterFrom(out_loc);
       if (index.IsConstant()) {
         size_t offset = (Int32ConstantFrom(index) << TIMES_4) + data_offset;
@@ -6362,7 +6363,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (index.IsConstant()) {
         size_t offset = (Int32ConstantFrom(index) << TIMES_8) + data_offset;
         GetAssembler()->LoadDFromOffset(DRegisterFrom(out_loc), obj, offset);
@@ -6375,12 +6376,12 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Potential implicit null checks, in the case of reference
     // arrays, are handled in the previous switch statement.
   } else if (!maybe_compressed_char_at) {
@@ -6391,7 +6392,7 @@
 }
 
 void LocationsBuilderARMVIXL::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -6405,7 +6406,7 @@
 
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(value_type)) {
+  if (DataType::IsFloatingPointType(value_type)) {
     locations->SetInAt(2, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(2, Location::RequiresRegister());
@@ -6421,26 +6422,26 @@
   LocationSummary* locations = instruction->GetLocations();
   vixl32::Register array = InputRegisterAt(instruction, 0);
   Location index = locations->InAt(1);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
   uint32_t data_offset =
-      mirror::Array::DataOffset(Primitive::ComponentSize(value_type)).Uint32Value();
+      mirror::Array::DataOffset(DataType::Size(value_type)).Uint32Value();
   Location value_loc = locations->InAt(2);
   HInstruction* array_instr = instruction->GetArray();
   bool has_intermediate_address = array_instr->IsIntermediateAddress();
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       if (index.IsConstant()) {
         int32_t const_index = Int32ConstantFrom(index);
         uint32_t full_offset =
-            data_offset + (const_index << Primitive::ComponentSizeShift(value_type));
+            data_offset + (const_index << DataType::SizeShift(value_type));
         StoreOperandType store_type = GetStoreOperandType(value_type);
         GetAssembler()->StoreToOffset(store_type, RegisterFrom(value_loc), array, full_offset);
       } else {
@@ -6464,7 +6465,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       vixl32::Register value = RegisterFrom(value_loc);
       // TryExtractArrayAccessAddress optimization is never applied for non-primitive ArraySet.
       // See the comment in instruction_simplifier_shared.cc.
@@ -6577,7 +6578,7 @@
         // Note that in the case where `value` is a null reference,
         // we do not enter this block, as a null reference does not
         // need poisoning.
-        DCHECK_EQ(value_type, Primitive::kPrimNot);
+        DCHECK_EQ(value_type, DataType::Type::kReference);
         __ Mov(temp1, value);
         GetAssembler()->PoisonHeapReference(temp1);
         source = temp1;
@@ -6618,7 +6619,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Location value = locations->InAt(2);
       if (index.IsConstant()) {
         size_t offset =
@@ -6633,7 +6634,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       Location value = locations->InAt(2);
       DCHECK(value.IsFpuRegister());
       if (index.IsConstant()) {
@@ -6648,7 +6649,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       Location value = locations->InAt(2);
       DCHECK(value.IsFpuRegisterPair());
       if (index.IsConstant()) {
@@ -6663,13 +6664,13 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << value_type;
       UNREACHABLE();
   }
 
   // Objects are handled in the switch.
-  if (value_type != Primitive::kPrimNot) {
+  if (value_type != DataType::Type::kReference) {
     // TODO(VIXL): Ensure we record the pc position immediately after the preceding store
     // instruction.
     codegen_->MaybeRecordImplicitNullCheck(instruction);
@@ -7966,7 +7967,7 @@
       // Otherwise,the object is indeed an array, jump to label `check_non_primitive_component_type`
       // to further check that this component type is not a primitive type.
       GetAssembler()->LoadFromOffset(kLoadUnsignedHalfword, temp, temp, primitive_offset);
-      static_assert(Primitive::kPrimNot == 0, "Expected 0 for art::Primitive::kPrimNot");
+      static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
       __ CompareAndBranchIfNonZero(temp, type_check_slow_path->GetEntryLabel());
       break;
     }
@@ -8061,8 +8062,8 @@
 void LocationsBuilderARMVIXL::HandleBitwiseOperation(HBinaryOperation* instruction, Opcode opcode) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt
-         || instruction->GetResultType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32
+         || instruction->GetResultType() == DataType::Type::kInt64);
   // Note: GVN reorders commutative operations to have the constant on the right hand side.
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, ArmEncodableConstantOrRegister(instruction->InputAt(1), opcode));
@@ -8084,8 +8085,8 @@
 void LocationsBuilderARMVIXL::VisitBitwiseNegatedRight(HBitwiseNegatedRight* instruction) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt
-         || instruction->GetResultType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32
+         || instruction->GetResultType() == DataType::Type::kInt64);
 
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RequiresRegister());
@@ -8098,7 +8099,7 @@
   Location second = locations->InAt(1);
   Location out = locations->Out();
 
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     vixl32::Register first_reg = RegisterFrom(first);
     vixl32::Register second_reg = RegisterFrom(second);
     vixl32::Register out_reg = RegisterFrom(out);
@@ -8119,7 +8120,7 @@
     return;
 
   } else {
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
     vixl32::Register first_low = LowRegisterFrom(first);
     vixl32::Register first_high = HighRegisterFrom(first);
     vixl32::Register second_low = LowRegisterFrom(second);
@@ -8147,11 +8148,11 @@
 
 void LocationsBuilderARMVIXL::VisitDataProcWithShifterOp(
     HDataProcWithShifterOp* instruction) {
-  DCHECK(instruction->GetType() == Primitive::kPrimInt ||
-         instruction->GetType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetType() == DataType::Type::kInt32 ||
+         instruction->GetType() == DataType::Type::kInt64);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  const bool overlap = instruction->GetType() == Primitive::kPrimLong &&
+  const bool overlap = instruction->GetType() == DataType::Type::kInt64 &&
                        HDataProcWithShifterOp::IsExtensionOp(instruction->GetOpKind());
 
   locations->SetInAt(0, Location::RequiresRegister());
@@ -8166,10 +8167,10 @@
   const HInstruction::InstructionKind kind = instruction->GetInstrKind();
   const HDataProcWithShifterOp::OpKind op_kind = instruction->GetOpKind();
 
-  if (instruction->GetType() == Primitive::kPrimInt) {
+  if (instruction->GetType() == DataType::Type::kInt32) {
     const vixl32::Register first = InputRegisterAt(instruction, 0);
     const vixl32::Register output = OutputRegister(instruction);
-    const vixl32::Register second = instruction->InputAt(1)->GetType() == Primitive::kPrimLong
+    const vixl32::Register second = instruction->InputAt(1)->GetType() == DataType::Type::kInt64
         ? LowRegisterFrom(locations->InAt(1))
         : InputRegisterAt(instruction, 1);
 
@@ -8203,7 +8204,7 @@
                                   codegen_);
     }
   } else {
-    DCHECK_EQ(instruction->GetType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetType(), DataType::Type::kInt64);
 
     if (HDataProcWithShifterOp::IsExtensionOp(op_kind)) {
       const vixl32::Register second = InputRegisterAt(instruction, 1);
@@ -8319,7 +8320,7 @@
   if (second.IsConstant()) {
     uint64_t value = static_cast<uint64_t>(Int64FromConstant(second.GetConstant()));
     uint32_t value_low = Low32Bits(value);
-    if (instruction->GetResultType() == Primitive::kPrimInt) {
+    if (instruction->GetResultType() == DataType::Type::kInt32) {
       vixl32::Register first_reg = InputRegisterAt(instruction, 0);
       vixl32::Register out_reg = OutputRegister(instruction);
       if (instruction->IsAnd()) {
@@ -8331,7 +8332,7 @@
         GenerateEorConst(out_reg, first_reg, value_low);
       }
     } else {
-      DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+      DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
       uint32_t value_high = High32Bits(value);
       vixl32::Register first_low = LowRegisterFrom(first);
       vixl32::Register first_high = HighRegisterFrom(first);
@@ -8352,7 +8353,7 @@
     return;
   }
 
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     vixl32::Register first_reg = InputRegisterAt(instruction, 0);
     vixl32::Register second_reg = InputRegisterAt(instruction, 1);
     vixl32::Register out_reg = OutputRegister(instruction);
@@ -8365,7 +8366,7 @@
       __ Eor(out_reg, first_reg, second_reg);
     }
   } else {
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
     vixl32::Register first_low = LowRegisterFrom(first);
     vixl32::Register first_high = HighRegisterFrom(first);
     vixl32::Register second_low = LowRegisterFrom(second);
@@ -8590,7 +8591,7 @@
     //   gray_return_address:
 
     DCHECK_ALIGNED(offset, sizeof(mirror::HeapReference<mirror::Object>));
-    vixl32::Register ref_reg = RegisterFrom(ref, Primitive::kPrimNot);
+    vixl32::Register ref_reg = RegisterFrom(ref, DataType::Type::kReference);
     bool narrow = CanEmitNarrowLdr(ref_reg, obj, offset);
     vixl32::Register base = obj;
     if (offset >= kReferenceLoadMinFarOffset) {
@@ -8686,9 +8687,9 @@
     //   gray_return_address:
 
     DCHECK(index.IsValid());
-    vixl32::Register index_reg = RegisterFrom(index, Primitive::kPrimInt);
-    vixl32::Register ref_reg = RegisterFrom(ref, Primitive::kPrimNot);
-    vixl32::Register data_reg = RegisterFrom(temp, Primitive::kPrimInt);  // Raw pointer.
+    vixl32::Register index_reg = RegisterFrom(index, DataType::Type::kInt32);
+    vixl32::Register ref_reg = RegisterFrom(ref, DataType::Type::kReference);
+    vixl32::Register data_reg = RegisterFrom(temp, DataType::Type::kInt32);  // Raw pointer.
     DCHECK(!data_reg.Is(kBakerCcEntrypointRegister));
 
     UseScratchRegisterScope temps(GetVIXLAssembler());
@@ -8836,7 +8837,7 @@
                                                     Location index,
                                                     ScaleFactor scale_factor,
                                                     bool needs_null_check) {
-  Primitive::Type type = Primitive::kPrimNot;
+  DataType::Type type = DataType::Type::kReference;
   vixl32::Register ref_reg = RegisterFrom(ref, type);
 
   // If needed, vixl::EmissionCheckScope guards are used to ensure
@@ -9392,13 +9393,13 @@
 }
 
 // Copy the result of a call into the given target.
-void CodeGeneratorARMVIXL::MoveFromReturnRegister(Location trg, Primitive::Type type) {
+void CodeGeneratorARMVIXL::MoveFromReturnRegister(Location trg, DataType::Type type) {
   if (!trg.IsValid()) {
-    DCHECK_EQ(type, Primitive::kPrimVoid);
+    DCHECK_EQ(type, DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
   Location return_loc = InvokeDexCallingConventionVisitorARMVIXL().GetReturnLocation(type);
   if (return_loc.Equals(trg)) {
@@ -9407,9 +9408,9 @@
 
   // TODO: Consider pairs in the parallel move resolver, then this could be nicely merged
   //       with the last branch.
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     TODO_VIXL32(FATAL);
-  } else if (type == Primitive::kPrimDouble) {
+  } else if (type == DataType::Type::kFloat64) {
     TODO_VIXL32(FATAL);
   } else {
     // Let the parallel move resolver take care of all of this.
diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h
index 337ecf1..58b8525 100644
--- a/compiler/optimizing/code_generator_arm_vixl.h
+++ b/compiler/optimizing/code_generator_arm_vixl.h
@@ -173,8 +173,8 @@
   InvokeDexCallingConventionVisitorARMVIXL() {}
   virtual ~InvokeDexCallingConventionVisitorARMVIXL() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE;
   Location GetMethodLocation() const OVERRIDE;
 
  private:
@@ -194,20 +194,20 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return helpers::LocationFrom(vixl::aarch32::r0);
   }
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? helpers::LocationFrom(vixl::aarch32::r0, vixl::aarch32::r1)
         : helpers::LocationFrom(vixl::aarch32::r0);
   }
-  Location GetSetValueLocation(Primitive::Type type, bool is_instance) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetSetValueLocation(DataType::Type type, bool is_instance) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? helpers::LocationFrom(vixl::aarch32::r2, vixl::aarch32::r3)
         : (is_instance
             ? helpers::LocationFrom(vixl::aarch32::r2)
             : helpers::LocationFrom(vixl::aarch32::r1));
   }
-  Location GetFpuLocation(Primitive::Type type) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetFpuLocation(DataType::Type type) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? helpers::LocationFrom(vixl::aarch32::s0, vixl::aarch32::s1)
         : helpers::LocationFrom(vixl::aarch32::s0);
   }
@@ -434,7 +434,7 @@
   void GenerateFrameExit() OVERRIDE;
   void Bind(HBasicBlock* block) OVERRIDE;
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
   void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
 
   size_t SaveCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
@@ -475,12 +475,12 @@
   // Helper method to move a 32-bit value between two locations.
   void Move32(Location destination, Location source);
 
-  void LoadFromShiftedRegOffset(Primitive::Type type,
+  void LoadFromShiftedRegOffset(DataType::Type type,
                                 Location out_loc,
                                 vixl::aarch32::Register base,
                                 vixl::aarch32::Register reg_index,
                                 vixl::aarch32::Condition cond = vixl::aarch32::al);
-  void StoreToShiftedRegOffset(Primitive::Type type,
+  void StoreToShiftedRegOffset(DataType::Type type,
                                Location out_loc,
                                vixl::aarch32::Register base,
                                vixl::aarch32::Register reg_index,
@@ -522,8 +522,8 @@
 
   const ArmInstructionSetFeatures& GetInstructionSetFeatures() const { return isa_features_; }
 
-  bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE {
-    return type == Primitive::kPrimDouble || type == Primitive::kPrimLong;
+  bool NeedsTwoRegisters(DataType::Type type) const OVERRIDE {
+    return type == DataType::Type::kFloat64 || type == DataType::Type::kInt64;
   }
 
   void ComputeSpillMask() OVERRIDE;
@@ -551,7 +551,7 @@
   void GenerateVirtualCall(
       HInvokeVirtual* invoke, Location temp, SlowPathCode* slow_path = nullptr) OVERRIDE;
 
-  void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
+  void MoveFromReturnRegister(Location trg, DataType::Type type) OVERRIDE;
 
   // The PcRelativePatchInfo is used for PC-relative addressing of dex cache arrays
   // and boot image strings/types. The only difference is the interpretation of the
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index 0e6d210..a7c8557 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -49,30 +49,30 @@
 constexpr bool kBakerReadBarrierThunksEnableForArrays = true;
 constexpr bool kBakerReadBarrierThunksEnableForGcRoots = true;
 
-Location MipsReturnLocation(Primitive::Type return_type) {
+Location MipsReturnLocation(DataType::Type return_type) {
   switch (return_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
       return Location::RegisterLocation(V0);
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       return Location::RegisterPairLocation(V0, V1);
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       return Location::FpuRegisterLocation(F0);
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       return Location();
   }
   UNREACHABLE();
 }
 
-Location InvokeDexCallingConventionVisitorMIPS::GetReturnLocation(Primitive::Type type) const {
+Location InvokeDexCallingConventionVisitorMIPS::GetReturnLocation(DataType::Type type) const {
   return MipsReturnLocation(type);
 }
 
@@ -80,16 +80,16 @@
   return Location::RegisterLocation(kMethodRegisterArgument);
 }
 
-Location InvokeDexCallingConventionVisitorMIPS::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorMIPS::GetNextLocation(DataType::Type type) {
   Location next_location;
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       uint32_t gp_index = gp_index_++;
       if (gp_index < calling_convention.GetNumberOfRegisters()) {
         next_location = Location::RegisterLocation(calling_convention.GetRegisterAt(gp_index));
@@ -100,7 +100,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t gp_index = gp_index_;
       gp_index_ += 2;
       if (gp_index + 1 < calling_convention.GetNumberOfRegisters()) {
@@ -123,32 +123,32 @@
     // Note: both float and double types are stored in even FPU registers. On 32 bit FPU, double
     // will take up the even/odd pair, while floats are stored in even regs only.
     // On 64 bit FPU, both double and float are stored in even registers only.
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       uint32_t float_index = float_index_++;
       if (float_index < calling_convention.GetNumberOfFpuRegisters()) {
         next_location = Location::FpuRegisterLocation(
             calling_convention.GetFpuRegisterAt(float_index));
       } else {
         size_t stack_offset = calling_convention.GetStackOffsetOf(stack_index_);
-        next_location = Primitive::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
-                                                     : Location::StackSlot(stack_offset);
+        next_location = DataType::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
+                                                    : Location::StackSlot(stack_offset);
       }
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unexpected parameter type " << type;
       break;
   }
 
   // Space on the stack is reserved for all arguments.
-  stack_index_ += Primitive::Is64BitType(type) ? 2 : 1;
+  stack_index_ += DataType::Is64BitType(type) ? 2 : 1;
 
   return next_location;
 }
 
-Location InvokeRuntimeCallingConvention::GetReturnLocation(Primitive::Type type) {
+Location InvokeRuntimeCallingConvention::GetReturnLocation(DataType::Type type) {
   return MipsReturnLocation(type);
 }
 
@@ -173,10 +173,10 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimInt,
+                               DataType::Type::kInt32,
                                locations->InAt(1),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimInt);
+                               DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -279,7 +279,7 @@
     // Move the class to the desired location.
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = instruction_->GetType();
+      DataType::Type type = instruction_->GetType();
       mips_codegen->MoveLocation(out,
                                  Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                  type);
@@ -372,7 +372,7 @@
             &info_low->label);
     }
 
-    Primitive::Type type = instruction_->GetType();
+    DataType::Type type = instruction_->GetType();
     mips_codegen->MoveLocation(locations->Out(),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                type);
@@ -490,14 +490,14 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimNot,
+                               DataType::Type::kReference,
                                locations->InAt(1),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       mips_codegen->InvokeRuntime(kQuickInstanceofNonTrivial, instruction_, dex_pc, this);
       CheckEntrypointTypes<kQuickInstanceofNonTrivial, size_t, mirror::Object*, mirror::Class*>();
-      Primitive::Type ret_type = instruction_->GetType();
+      DataType::Type ret_type = instruction_->GetType();
       Location ret_loc = calling_convention.GetReturnLocation(ret_type);
       mips_codegen->MoveLocation(locations->Out(), ret_loc, ret_type);
     } else {
@@ -559,17 +559,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -969,16 +969,16 @@
     HParallelMove parallel_move(codegen->GetGraph()->GetArena());
     parallel_move.AddMove(ref_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     parallel_move.AddMove(obj_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -992,8 +992,8 @@
     CheckEntrypointTypes<
         kQuickReadBarrierSlow, mirror::Object*, mirror::Object*, mirror::Object*, uint32_t>();
     mips_codegen->MoveLocation(out_,
-                               calling_convention.GetReturnLocation(Primitive::kPrimNot),
-                               Primitive::kPrimNot);
+                               calling_convention.GetReturnLocation(DataType::Type::kReference),
+                               DataType::Type::kReference);
 
     RestoreLiveRegisters(codegen, locations);
     __ B(GetExitLabel());
@@ -1058,15 +1058,15 @@
     CodeGeneratorMIPS* mips_codegen = down_cast<CodeGeneratorMIPS*>(codegen);
     mips_codegen->MoveLocation(Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                root_,
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     mips_codegen->InvokeRuntime(kQuickReadBarrierForRootSlow,
                                 instruction_,
                                 instruction_->GetDexPc(),
                                 this);
     CheckEntrypointTypes<kQuickReadBarrierForRootSlow, mirror::Object*, GcRoot<mirror::Object>*>();
     mips_codegen->MoveLocation(out_,
-                               calling_convention.GetReturnLocation(Primitive::kPrimNot),
-                               Primitive::kPrimNot);
+                               calling_convention.GetReturnLocation(DataType::Type::kReference),
+                               DataType::Type::kReference);
 
     RestoreLiveRegisters(codegen, locations);
     __ B(GetExitLabel());
@@ -1165,7 +1165,7 @@
 void ParallelMoveResolverMIPS::EmitSwap(size_t index) {
   DCHECK_LT(index, moves_.size());
   MoveOperands* move = moves_[index];
-  Primitive::Type type = move->GetType();
+  DataType::Type type = move->GetType();
   Location loc1 = move->GetDestination();
   Location loc2 = move->GetSource();
 
@@ -1186,12 +1186,12 @@
   } else if (loc1.IsFpuRegister() && loc2.IsFpuRegister()) {
     FRegister f1 = loc1.AsFpuRegister<FRegister>();
     FRegister f2 = loc2.AsFpuRegister<FRegister>();
-    if (type == Primitive::kPrimFloat) {
+    if (type == DataType::Type::kFloat32) {
       __ MovS(FTMP, f2);
       __ MovS(f2, f1);
       __ MovS(f1, FTMP);
     } else {
-      DCHECK_EQ(type, Primitive::kPrimDouble);
+      DCHECK_EQ(type, DataType::Type::kFloat64);
       __ MovD(FTMP, f2);
       __ MovD(f2, f1);
       __ MovD(f1, FTMP);
@@ -1199,7 +1199,7 @@
   } else if ((loc1.IsRegister() && loc2.IsFpuRegister()) ||
              (loc1.IsFpuRegister() && loc2.IsRegister())) {
     // Swap FPR and GPR.
-    DCHECK_EQ(type, Primitive::kPrimFloat);  // Can only swap a float.
+    DCHECK_EQ(type, DataType::Type::kFloat32);  // Can only swap a float.
     FRegister f1 = loc1.IsFpuRegister() ? loc1.AsFpuRegister<FRegister>()
                                         : loc2.AsFpuRegister<FRegister>();
     Register r2 = loc1.IsRegister() ? loc1.AsRegister<Register>() : loc2.AsRegister<Register>();
@@ -1221,7 +1221,7 @@
   } else if ((loc1.IsRegisterPair() && loc2.IsFpuRegister()) ||
              (loc1.IsFpuRegister() && loc2.IsRegisterPair())) {
     // Swap FPR and GPR register pair.
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     FRegister f1 = loc1.IsFpuRegister() ? loc1.AsFpuRegister<FRegister>()
                                         : loc2.AsFpuRegister<FRegister>();
     Register r2_l = loc1.IsRegisterPair() ? loc1.AsRegisterPairLow<Register>()
@@ -1267,12 +1267,12 @@
     FRegister reg = loc1.IsFpuRegister() ? loc1.AsFpuRegister<FRegister>()
                                          : loc2.AsFpuRegister<FRegister>();
     intptr_t offset = loc1.IsFpuRegister() ? loc2.GetStackIndex() : loc1.GetStackIndex();
-    if (type == Primitive::kPrimFloat) {
+    if (type == DataType::Type::kFloat32) {
       __ MovS(FTMP, reg);
       __ LoadSFromOffset(reg, SP, offset);
       __ StoreSToOffset(FTMP, SP, offset);
     } else {
-      DCHECK_EQ(type, Primitive::kPrimDouble);
+      DCHECK_EQ(type, DataType::Type::kFloat64);
       __ MovD(FTMP, reg);
       __ LoadDFromOffset(reg, SP, offset);
       __ StoreDToOffset(FTMP, SP, offset);
@@ -1462,7 +1462,7 @@
 
 void CodeGeneratorMIPS::MoveLocation(Location destination,
                                      Location source,
-                                     Primitive::Type dst_type) {
+                                     DataType::Type dst_type) {
   if (source.Equals(destination)) {
     return;
   }
@@ -1498,10 +1498,10 @@
       }
     } else if (destination.IsFpuRegister()) {
       if (source.IsRegister()) {
-        DCHECK(!Primitive::Is64BitType(dst_type));
+        DCHECK(!DataType::Is64BitType(dst_type));
         __ Mtc1(source.AsRegister<Register>(), destination.AsFpuRegister<FRegister>());
       } else if (source.IsRegisterPair()) {
-        DCHECK(Primitive::Is64BitType(dst_type));
+        DCHECK(DataType::Is64BitType(dst_type));
         FRegister dst = destination.AsFpuRegister<FRegister>();
         Register src_high = source.AsRegisterPairHigh<Register>();
         Register src_low = source.AsRegisterPairLow<Register>();
@@ -1512,20 +1512,20 @@
           __ MoveV(VectorRegisterFrom(destination),
                    VectorRegisterFrom(source));
         } else {
-          if (Primitive::Is64BitType(dst_type)) {
+          if (DataType::Is64BitType(dst_type)) {
             __ MovD(destination.AsFpuRegister<FRegister>(), source.AsFpuRegister<FRegister>());
           } else {
-            DCHECK_EQ(dst_type, Primitive::kPrimFloat);
+            DCHECK_EQ(dst_type, DataType::Type::kFloat32);
             __ MovS(destination.AsFpuRegister<FRegister>(), source.AsFpuRegister<FRegister>());
           }
         }
       } else if (source.IsSIMDStackSlot()) {
         __ LoadQFromOffset(destination.AsFpuRegister<FRegister>(), SP, source.GetStackIndex());
       } else if (source.IsDoubleStackSlot()) {
-        DCHECK(Primitive::Is64BitType(dst_type));
+        DCHECK(DataType::Is64BitType(dst_type));
         __ LoadDFromOffset(destination.AsFpuRegister<FRegister>(), SP, source.GetStackIndex());
       } else {
-        DCHECK(!Primitive::Is64BitType(dst_type));
+        DCHECK(!DataType::Is64BitType(dst_type));
         DCHECK(source.IsStackSlot()) << "Cannot move from " << source << " to " << destination;
         __ LoadSFromOffset(destination.AsFpuRegister<FRegister>(), SP, source.GetStackIndex());
       }
@@ -2022,9 +2022,9 @@
 void LocationsBuilderMIPS::HandleBinaryOp(HBinaryOperation* instruction) {
   DCHECK_EQ(instruction->InputCount(), 2U);
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       HInstruction* right = instruction->InputAt(1);
       bool can_use_imm = false;
@@ -2047,15 +2047,15 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK(instruction->IsAdd() || instruction->IsSub());
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
@@ -2068,11 +2068,11 @@
 }
 
 void InstructionCodeGeneratorMIPS::HandleBinaryOp(HBinaryOperation* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register dst = locations->Out().AsRegister<Register>();
       Register lhs = locations->InAt(0).AsRegister<Register>();
       Location rhs_location = locations->InAt(1);
@@ -2116,7 +2116,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
       Register dst_low = locations->Out().AsRegisterPairLow<Register>();
       Register lhs_high = locations->InAt(0).AsRegisterPairHigh<Register>();
@@ -2257,20 +2257,20 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FRegister dst = locations->Out().AsFpuRegister<FRegister>();
       FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
       FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
       if (instruction->IsAdd()) {
-        if (type == Primitive::kPrimFloat) {
+        if (type == DataType::Type::kFloat32) {
           __ AddS(dst, lhs, rhs);
         } else {
           __ AddD(dst, lhs, rhs);
         }
       } else {
         DCHECK(instruction->IsSub());
-        if (type == Primitive::kPrimFloat) {
+        if (type == DataType::Type::kFloat32) {
           __ SubS(dst, lhs, rhs);
         } else {
           __ SubD(dst, lhs, rhs);
@@ -2288,14 +2288,14 @@
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr() || instr->IsRor());
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instr);
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instr->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instr->InputAt(1)));
       locations->SetOut(Location::RequiresRegister());
@@ -2310,20 +2310,20 @@
 void InstructionCodeGeneratorMIPS::HandleShift(HBinaryOperation* instr) {
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr() || instr->IsRor());
   LocationSummary* locations = instr->GetLocations();
-  Primitive::Type type = instr->GetType();
+  DataType::Type type = instr->GetType();
 
   Location rhs_location = locations->InAt(1);
   bool use_imm = rhs_location.IsConstant();
   Register rhs_reg = use_imm ? ZERO : rhs_location.AsRegister<Register>();
   int64_t rhs_imm = use_imm ? CodeGenerator::GetInt64ValueOf(rhs_location.GetConstant()) : 0;
   const uint32_t shift_mask =
-      (type == Primitive::kPrimInt) ? kMaxIntShiftDistance : kMaxLongShiftDistance;
+      (type == DataType::Type::kInt32) ? kMaxIntShiftDistance : kMaxLongShiftDistance;
   const uint32_t shift_value = rhs_imm & shift_mask;
   // Are the INS (Insert Bit Field) and ROTR instructions supported?
   bool has_ins_rotr = codegen_->GetInstructionSetFeatures().IsMipsIsaRevGreaterThanEqual2();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register dst = locations->Out().AsRegister<Register>();
       Register lhs = locations->InAt(0).AsRegister<Register>();
       if (use_imm) {
@@ -2372,7 +2372,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
       Register dst_low = locations->Out().AsRegisterPairLow<Register>();
       Register lhs_high = locations->InAt(0).AsRegisterPairHigh<Register>();
@@ -2536,9 +2536,9 @@
 }
 
 void LocationsBuilderMIPS::VisitArrayGet(HArrayGet* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (type == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (type == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier
@@ -2549,7 +2549,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(type)) {
+  if (DataType::IsFloatingPointType(type)) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps in the case of an object array get with
@@ -2588,11 +2588,11 @@
   uint32_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   const bool maybe_compressed_char_at = mirror::kUseStringCompression &&
                                         instruction->IsStringCharAt();
   switch (type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       Register out = out_loc.AsRegister<Register>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2605,7 +2605,7 @@
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       Register out = out_loc.AsRegister<Register>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2618,7 +2618,7 @@
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       Register out = out_loc.AsRegister<Register>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2631,7 +2631,7 @@
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       Register out = out_loc.AsRegister<Register>();
       if (maybe_compressed_char_at) {
         uint32_t count_offset = mirror::String::CountOffset().Uint32Value();
@@ -2683,7 +2683,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK_EQ(sizeof(mirror::HeapReference<mirror::Object>), sizeof(int32_t));
       Register out = out_loc.AsRegister<Register>();
       if (index.IsConstant()) {
@@ -2697,7 +2697,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       static_assert(
           sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
           "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -2757,7 +2757,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register out = out_loc.AsRegisterPairLow<Register>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2770,7 +2770,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       FRegister out = out_loc.AsFpuRegister<FRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2783,7 +2783,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       FRegister out = out_loc.AsFpuRegister<FRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2796,7 +2796,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -2841,7 +2841,7 @@
 }
 
 void LocationsBuilderMIPS::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -2855,7 +2855,7 @@
 
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->InputAt(2)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(2)->GetType())) {
     locations->SetInAt(2, FpuRegisterOrConstantForStore(instruction->InputAt(2)));
   } else {
     locations->SetInAt(2, RegisterOrZeroConstant(instruction->InputAt(2)));
@@ -2871,7 +2871,7 @@
   Register obj = locations->InAt(0).AsRegister<Register>();
   Location index = locations->InAt(1);
   Location value_location = locations->InAt(2);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -2879,8 +2879,8 @@
   Register base_reg = index.IsConstant() ? obj : TMP;
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1;
@@ -2897,8 +2897,8 @@
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2;
@@ -2915,7 +2915,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
@@ -2932,7 +2932,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       if (value_location.IsConstant()) {
         // Just setting null.
         uint32_t data_offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
@@ -3047,7 +3047,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
@@ -3064,7 +3064,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
@@ -3081,7 +3081,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
@@ -3098,7 +3098,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -3383,31 +3383,31 @@
 }
 
 void LocationsBuilderMIPS::VisitCompare(HCompare* compare) {
-  Primitive::Type in_type = compare->InputAt(0)->GetType();
+  DataType::Type in_type = compare->InputAt(0)->GetType();
 
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(compare, LocationSummary::kNoCall);
 
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       // Output overlaps because it is written before doing the low comparison.
       locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -3421,18 +3421,18 @@
 void InstructionCodeGeneratorMIPS::VisitCompare(HCompare* instruction) {
   LocationSummary* locations = instruction->GetLocations();
   Register res = locations->Out().AsRegister<Register>();
-  Primitive::Type in_type = instruction->InputAt(0)->GetType();
+  DataType::Type in_type = instruction->InputAt(0)->GetType();
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
 
   //  0 if: left == right
   //  1 if: left  > right
   // -1 if: left  < right
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       Register lhs = locations->InAt(0).AsRegister<Register>();
       Register rhs = locations->InAt(1).AsRegister<Register>();
       __ Slt(TMP, lhs, rhs);
@@ -3440,7 +3440,7 @@
       __ Subu(res, res, TMP);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       MipsLabel done;
       Register lhs_high = locations->InAt(0).AsRegisterPairHigh<Register>();
       Register lhs_low  = locations->InAt(0).AsRegisterPairLow<Register>();
@@ -3458,7 +3458,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       bool gt_bias = instruction->IsGtBias();
       FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
       FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
@@ -3498,7 +3498,7 @@
       __ Bind(&done);
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       bool gt_bias = instruction->IsGtBias();
       FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
       FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
@@ -3548,13 +3548,13 @@
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->InputAt(0)->GetType()) {
     default:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       break;
@@ -3569,7 +3569,7 @@
     return;
   }
 
-  Primitive::Type type = instruction->InputAt(0)->GetType();
+  DataType::Type type = instruction->InputAt(0)->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
@@ -3578,12 +3578,12 @@
       GenerateIntCompare(instruction->GetCondition(), locations);
       return;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       GenerateLongCompare(instruction->GetCondition(), locations);
       return;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       GenerateFpCompare(instruction->GetCondition(), instruction->IsGtBias(), type, locations);
       return;
   }
@@ -3591,7 +3591,7 @@
 
 void InstructionCodeGeneratorMIPS::DivRemOneOrMinusOne(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimInt);
+  DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -3615,7 +3615,7 @@
 
 void InstructionCodeGeneratorMIPS::DivRemByPowerOfTwo(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimInt);
+  DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -3664,7 +3664,7 @@
 
 void InstructionCodeGeneratorMIPS::GenerateDivRemWithAnyConstant(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimInt);
+  DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -3715,7 +3715,7 @@
 
 void InstructionCodeGeneratorMIPS::GenerateDivRemIntegral(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimInt);
+  DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt32);
 
   LocationSummary* locations = instruction->GetLocations();
   Register out = locations->Out().AsRegister<Register>();
@@ -3754,21 +3754,21 @@
 }
 
 void LocationsBuilderMIPS::VisitDiv(HDiv* div) {
-  Primitive::Type type = div->GetResultType();
-  LocationSummary::CallKind call_kind = (type == Primitive::kPrimLong)
+  DataType::Type type = div->GetResultType();
+  LocationSummary::CallKind call_kind = (type == DataType::Type::kInt64)
       ? LocationSummary::kCallOnMainOnly
       : LocationSummary::kNoCall;
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(div, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(div->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::RegisterPairLocation(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -3778,8 +3778,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3791,24 +3791,24 @@
 }
 
 void InstructionCodeGeneratorMIPS::VisitDiv(HDiv* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       GenerateDivRemIntegral(instruction);
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       codegen_->InvokeRuntime(kQuickLdiv, instruction, instruction->GetDexPc());
       CheckEntrypointTypes<kQuickLdiv, int64_t, int64_t, int64_t>();
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FRegister dst = locations->Out().AsFpuRegister<FRegister>();
       FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
       FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ DivS(dst, lhs, rhs);
       } else {
         __ DivD(dst, lhs, rhs);
@@ -3829,14 +3829,14 @@
   SlowPathCodeMIPS* slow_path = new (GetGraph()->GetArena()) DivZeroCheckSlowPathMIPS(instruction);
   codegen_->AddSlowPath(slow_path);
   Location value = instruction->GetLocations()->InAt(0);
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32: {
       if (value.IsConstant()) {
         if (value.GetConstant()->AsIntConstant()->GetValue() == 0) {
           __ B(slow_path->GetEntryLabel());
@@ -3850,7 +3850,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (value.IsConstant()) {
         if (value.GetConstant()->AsLongConstant()->GetValue() == 0) {
           __ B(slow_path->GetEntryLabel());
@@ -4786,13 +4786,13 @@
 
 void InstructionCodeGeneratorMIPS::GenerateFpCompare(IfCondition cond,
                                                      bool gt_bias,
-                                                     Primitive::Type type,
+                                                     DataType::Type type,
                                                      LocationSummary* locations) {
   Register dst = locations->Out().AsRegister<Register>();
   FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
   FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     if (isR6) {
       switch (cond) {
         case kCondEQ:
@@ -4899,7 +4899,7 @@
       }
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     if (isR6) {
       switch (cond) {
         case kCondEQ:
@@ -5010,13 +5010,13 @@
 
 bool InstructionCodeGeneratorMIPS::MaterializeFpCompareR2(IfCondition cond,
                                                           bool gt_bias,
-                                                          Primitive::Type type,
+                                                          DataType::Type type,
                                                           LocationSummary* input_locations,
                                                           int cc) {
   FRegister lhs = input_locations->InAt(0).AsFpuRegister<FRegister>();
   FRegister rhs = input_locations->InAt(1).AsFpuRegister<FRegister>();
   CHECK(!codegen_->GetInstructionSetFeatures().IsR6());
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     switch (cond) {
       case kCondEQ:
         __ CeqS(cc, lhs, rhs);
@@ -5057,7 +5057,7 @@
         UNREACHABLE();
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     switch (cond) {
       case kCondEQ:
         __ CeqD(cc, lhs, rhs);
@@ -5102,13 +5102,13 @@
 
 bool InstructionCodeGeneratorMIPS::MaterializeFpCompareR6(IfCondition cond,
                                                           bool gt_bias,
-                                                          Primitive::Type type,
+                                                          DataType::Type type,
                                                           LocationSummary* input_locations,
                                                           FRegister dst) {
   FRegister lhs = input_locations->InAt(0).AsFpuRegister<FRegister>();
   FRegister rhs = input_locations->InAt(1).AsFpuRegister<FRegister>();
   CHECK(codegen_->GetInstructionSetFeatures().IsR6());
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     switch (cond) {
       case kCondEQ:
         __ CmpEqS(dst, lhs, rhs);
@@ -5149,7 +5149,7 @@
         UNREACHABLE();
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     switch (cond) {
       case kCondEQ:
         __ CmpEqD(dst, lhs, rhs);
@@ -5194,13 +5194,13 @@
 
 void InstructionCodeGeneratorMIPS::GenerateFpCompareAndBranch(IfCondition cond,
                                                               bool gt_bias,
-                                                              Primitive::Type type,
+                                                              DataType::Type type,
                                                               LocationSummary* locations,
                                                               MipsLabel* label) {
   FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
   FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     if (isR6) {
       switch (cond) {
         case kCondEQ:
@@ -5295,7 +5295,7 @@
       }
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     if (isR6) {
       switch (cond) {
         case kCondEQ:
@@ -5437,7 +5437,7 @@
     // The condition instruction has not been materialized, use its inputs as
     // the comparison and its condition as the branch condition.
     HCondition* condition = cond->AsCondition();
-    Primitive::Type type = condition->InputAt(0)->GetType();
+    DataType::Type type = condition->InputAt(0)->GetType();
     LocationSummary* locations = cond->GetLocations();
     IfCondition if_cond = condition->GetCondition();
     MipsLabel* branch_target = true_target;
@@ -5451,11 +5451,11 @@
       default:
         GenerateIntCompareAndBranch(if_cond, locations, branch_target);
         break;
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         GenerateLongCompareAndBranch(if_cond, locations, branch_target);
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         GenerateFpCompareAndBranch(if_cond, condition->IsGtBias(), type, locations, branch_target);
         break;
     }
@@ -5520,8 +5520,9 @@
   HInstruction* cond = select->InputAt(/* condition_input_index */ 2);
   HCondition* condition = cond->AsCondition();
 
-  Primitive::Type cond_type = materialized ? Primitive::kPrimInt : condition->InputAt(0)->GetType();
-  Primitive::Type dst_type = select->GetType();
+  DataType::Type cond_type =
+      materialized ? DataType::Type::kInt32 : condition->InputAt(0)->GetType();
+  DataType::Type dst_type = select->GetType();
 
   HConstant* cst_true_value = select->GetTrueValue()->AsConstant();
   HConstant* cst_false_value = select->GetFalseValue()->AsConstant();
@@ -5563,7 +5564,7 @@
               use_const_for_true_in = is_true_value_zero_constant;
             }
             break;
-          case Primitive::kPrimLong:
+          case DataType::Type::kInt64:
             // Moving long on int condition.
             if (is_r6) {
               if (is_true_value_zero_constant) {
@@ -5586,8 +5587,8 @@
               use_const_for_true_in = is_true_value_zero_constant;
             }
             break;
-          case Primitive::kPrimFloat:
-          case Primitive::kPrimDouble:
+          case DataType::Type::kFloat32:
+          case DataType::Type::kFloat64:
             // Moving float/double on int condition.
             if (is_r6) {
               if (materialized) {
@@ -5618,12 +5619,12 @@
             break;
         }
         break;
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         // We don't materialize long comparison now
         // and use conditional branches instead.
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         switch (dst_type) {
           default:
             // Moving int on float/double condition.
@@ -5651,7 +5652,7 @@
               use_const_for_true_in = is_true_value_zero_constant;
             }
             break;
-          case Primitive::kPrimLong:
+          case DataType::Type::kInt64:
             // Moving long on float/double condition.
             if (is_r6) {
               if (is_true_value_zero_constant) {
@@ -5676,8 +5677,8 @@
               use_const_for_true_in = is_true_value_zero_constant;
             }
             break;
-          case Primitive::kPrimFloat:
-          case Primitive::kPrimDouble:
+          case DataType::Type::kFloat32:
+          case DataType::Type::kFloat64:
             // Moving float/double on float/double condition.
             if (is_r6) {
               can_move_conditionally = true;
@@ -5713,7 +5714,7 @@
       locations_to_set->SetInAt(0, Location::ConstantLocation(cst_false_value));
     } else {
       locations_to_set->SetInAt(0,
-                                Primitive::IsFloatingPointType(dst_type)
+                                DataType::IsFloatingPointType(dst_type)
                                     ? Location::RequiresFpuRegister()
                                     : Location::RequiresRegister());
     }
@@ -5721,7 +5722,7 @@
       locations_to_set->SetInAt(1, Location::ConstantLocation(cst_true_value));
     } else {
       locations_to_set->SetInAt(1,
-                                Primitive::IsFloatingPointType(dst_type)
+                                DataType::IsFloatingPointType(dst_type)
                                     ? Location::RequiresFpuRegister()
                                     : Location::RequiresRegister());
     }
@@ -5734,7 +5735,7 @@
     if (is_out_same_as_first_in) {
       locations_to_set->SetOut(Location::SameAsFirstInput());
     } else {
-      locations_to_set->SetOut(Primitive::IsFloatingPointType(dst_type)
+      locations_to_set->SetOut(DataType::IsFloatingPointType(dst_type)
                                    ? Location::RequiresFpuRegister()
                                    : Location::RequiresRegister());
     }
@@ -5752,9 +5753,9 @@
   HInstruction* cond = select->InputAt(/* condition_input_index */ 2);
   Register cond_reg = TMP;
   int cond_cc = 0;
-  Primitive::Type cond_type = Primitive::kPrimInt;
+  DataType::Type cond_type = DataType::Type::kInt32;
   bool cond_inverted = false;
-  Primitive::Type dst_type = select->GetType();
+  DataType::Type dst_type = select->GetType();
 
   if (IsBooleanValueOrMaterializedCondition(cond)) {
     cond_reg = locations->InAt(/* condition_input_index */ 2).AsRegister<Register>();
@@ -5765,11 +5766,11 @@
     cond_type = condition->InputAt(0)->GetType();
     switch (cond_type) {
       default:
-        DCHECK_NE(cond_type, Primitive::kPrimLong);
+        DCHECK_NE(cond_type, DataType::Type::kInt64);
         cond_inverted = MaterializeIntCompare(if_cond, cond_locations, cond_reg);
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         cond_inverted = MaterializeFpCompareR2(if_cond,
                                                condition->IsGtBias(),
                                                cond_type,
@@ -5799,7 +5800,7 @@
             __ Movn(dst.AsRegister<Register>(), src_reg, cond_reg);
           }
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           if (cond_inverted) {
             __ Movz(dst.AsRegisterPairLow<Register>(), src_reg, cond_reg);
             __ Movz(dst.AsRegisterPairHigh<Register>(), src_reg_high, cond_reg);
@@ -5808,14 +5809,14 @@
             __ Movn(dst.AsRegisterPairHigh<Register>(), src_reg_high, cond_reg);
           }
           break;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           if (cond_inverted) {
             __ MovzS(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_reg);
           } else {
             __ MovnS(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_reg);
           }
           break;
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           if (cond_inverted) {
             __ MovzD(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_reg);
           } else {
@@ -5824,11 +5825,11 @@
           break;
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       LOG(FATAL) << "Unreachable";
       UNREACHABLE();
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       switch (dst_type) {
         default:
           if (cond_inverted) {
@@ -5837,7 +5838,7 @@
             __ Movt(dst.AsRegister<Register>(), src_reg, cond_cc);
           }
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           if (cond_inverted) {
             __ Movf(dst.AsRegisterPairLow<Register>(), src_reg, cond_cc);
             __ Movf(dst.AsRegisterPairHigh<Register>(), src_reg_high, cond_cc);
@@ -5846,14 +5847,14 @@
             __ Movt(dst.AsRegisterPairHigh<Register>(), src_reg_high, cond_cc);
           }
           break;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           if (cond_inverted) {
             __ MovfS(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_cc);
           } else {
             __ MovtS(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_cc);
           }
           break;
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           if (cond_inverted) {
             __ MovfD(dst.AsFpuRegister<FRegister>(), src.AsFpuRegister<FRegister>(), cond_cc);
           } else {
@@ -5873,9 +5874,9 @@
   HInstruction* cond = select->InputAt(/* condition_input_index */ 2);
   Register cond_reg = TMP;
   FRegister fcond_reg = FTMP;
-  Primitive::Type cond_type = Primitive::kPrimInt;
+  DataType::Type cond_type = DataType::Type::kInt32;
   bool cond_inverted = false;
-  Primitive::Type dst_type = select->GetType();
+  DataType::Type dst_type = select->GetType();
 
   if (IsBooleanValueOrMaterializedCondition(cond)) {
     cond_reg = locations->InAt(/* condition_input_index */ 2).AsRegister<Register>();
@@ -5886,11 +5887,11 @@
     cond_type = condition->InputAt(0)->GetType();
     switch (cond_type) {
       default:
-        DCHECK_NE(cond_type, Primitive::kPrimLong);
+        DCHECK_NE(cond_type, DataType::Type::kInt64);
         cond_inverted = MaterializeIntCompare(if_cond, cond_locations, cond_reg);
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         cond_inverted = MaterializeFpCompareR6(if_cond,
                                                condition->IsGtBias(),
                                                cond_type,
@@ -5909,7 +5910,7 @@
 
   switch (dst_type) {
     default:
-      if (Primitive::IsFloatingPointType(cond_type)) {
+      if (DataType::IsFloatingPointType(cond_type)) {
         __ Mfc1(cond_reg, fcond_reg);
       }
       if (true_src.IsConstant()) {
@@ -5936,8 +5937,8 @@
         __ Or(dst.AsRegister<Register>(), AT, TMP);
       }
       break;
-    case Primitive::kPrimLong: {
-      if (Primitive::IsFloatingPointType(cond_type)) {
+    case DataType::Type::kInt64: {
+      if (DataType::IsFloatingPointType(cond_type)) {
         __ Mfc1(cond_reg, fcond_reg);
       }
       Register dst_lo = dst.AsRegisterPairLow<Register>();
@@ -5966,8 +5967,8 @@
       }
       break;
     }
-    case Primitive::kPrimFloat: {
-      if (!Primitive::IsFloatingPointType(cond_type)) {
+    case DataType::Type::kFloat32: {
+      if (!DataType::IsFloatingPointType(cond_type)) {
         // sel*.fmt tests bit 0 of the condition register, account for that.
         __ Sltu(TMP, ZERO, cond_reg);
         __ Mtc1(TMP, fcond_reg);
@@ -6001,8 +6002,8 @@
       }
       break;
     }
-    case Primitive::kPrimDouble: {
-      if (!Primitive::IsFloatingPointType(cond_type)) {
+    case DataType::Type::kFloat64: {
+      if (!DataType::IsFloatingPointType(cond_type)) {
         // sel*.fmt tests bit 0 of the condition register, account for that.
         __ Sltu(TMP, ZERO, cond_reg);
         __ Mtc1(TMP, fcond_reg);
@@ -6090,11 +6091,11 @@
 }
 
 void LocationsBuilderMIPS::HandleFieldGet(HInstruction* instruction, const FieldInfo& field_info) {
-  Primitive::Type field_type = field_info.GetFieldType();
-  bool is_wide = (field_type == Primitive::kPrimLong) || (field_type == Primitive::kPrimDouble);
+  DataType::Type field_type = field_info.GetFieldType();
+  bool is_wide = (field_type == DataType::Type::kInt64) || (field_type == DataType::Type::kFloat64);
   bool generate_volatile = field_info.IsVolatile() && is_wide;
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (field_type == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (field_type == DataType::Type::kReference);
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(
       instruction,
       generate_volatile
@@ -6111,18 +6112,18 @@
     InvokeRuntimeCallingConvention calling_convention;
     // need A0 to hold base + offset
     locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-    if (field_type == Primitive::kPrimLong) {
-      locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimLong));
+    if (field_type == DataType::Type::kInt64) {
+      locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kInt64));
     } else {
       // Use Location::Any() to prevent situations when running out of available fp registers.
       locations->SetOut(Location::Any());
       // Need some temp core regs since FP results are returned in core registers
-      Location reg = calling_convention.GetReturnLocation(Primitive::kPrimLong);
+      Location reg = calling_convention.GetReturnLocation(DataType::Type::kInt64);
       locations->AddTemp(Location::RegisterLocation(reg.AsRegisterPairLow<Register>()));
       locations->AddTemp(Location::RegisterLocation(reg.AsRegisterPairHigh<Register>()));
     }
   } else {
-    if (Primitive::IsFloatingPointType(instruction->GetType())) {
+    if (DataType::IsFloatingPointType(instruction->GetType())) {
       locations->SetOut(Location::RequiresFpuRegister());
     } else {
       // The output overlaps in the case of an object field get with
@@ -6146,7 +6147,7 @@
 void InstructionCodeGeneratorMIPS::HandleFieldGet(HInstruction* instruction,
                                                   const FieldInfo& field_info,
                                                   uint32_t dex_pc) {
-  Primitive::Type type = field_info.GetFieldType();
+  DataType::Type type = field_info.GetFieldType();
   LocationSummary* locations = instruction->GetLocations();
   Location obj_loc = locations->InAt(0);
   Register obj = obj_loc.AsRegister<Register>();
@@ -6157,28 +6158,28 @@
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
   switch (type) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       load_type = kLoadUnsignedByte;
       break;
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       load_type = kLoadSignedByte;
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       load_type = kLoadSignedHalfword;
       break;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       load_type = kLoadUnsignedHalfword;
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimNot:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kReference:
       load_type = kLoadWord;
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       load_type = kLoadDoubleword;
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
@@ -6191,7 +6192,7 @@
     codegen_->RecordPcInfo(instruction, instruction->GetDexPc());
     codegen_->InvokeRuntime(kQuickA64Load, instruction, dex_pc);
     CheckEntrypointTypes<kQuickA64Load, int64_t, volatile const int64_t*>();
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       // FP results are returned in core registers. Need to move them.
       if (dst_loc.IsFpuRegister()) {
         __ Mtc1(locations->GetTemp(1).AsRegister<Register>(), dst_loc.AsFpuRegister<FRegister>());
@@ -6210,7 +6211,7 @@
       }
     }
   } else {
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       // /* HeapReference<Object> */ dst = *(obj + offset)
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         Location temp_loc =
@@ -6236,9 +6237,9 @@
         // reference, if heap poisoning is enabled).
         codegen_->MaybeGenerateReadBarrierSlow(instruction, dst_loc, dst_loc, obj_loc, offset);
       }
-    } else if (!Primitive::IsFloatingPointType(type)) {
+    } else if (!DataType::IsFloatingPointType(type)) {
       Register dst;
-      if (type == Primitive::kPrimLong) {
+      if (type == DataType::Type::kInt64) {
         DCHECK(dst_loc.IsRegisterPair());
         dst = dst_loc.AsRegisterPairLow<Register>();
       } else {
@@ -6249,7 +6250,7 @@
     } else {
       DCHECK(dst_loc.IsFpuRegister());
       FRegister dst = dst_loc.AsFpuRegister<FRegister>();
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ LoadSFromOffset(dst, obj, offset, null_checker);
       } else {
         __ LoadDFromOffset(dst, obj, offset, null_checker);
@@ -6259,14 +6260,14 @@
 
   // Memory barriers, in the case of references, are handled in the
   // previous switch statement.
-  if (is_volatile && (type != Primitive::kPrimNot)) {
+  if (is_volatile && (type != DataType::Type::kReference)) {
     GenerateMemoryBarrier(MemBarrierKind::kLoadAny);
   }
 }
 
 void LocationsBuilderMIPS::HandleFieldSet(HInstruction* instruction, const FieldInfo& field_info) {
-  Primitive::Type field_type = field_info.GetFieldType();
-  bool is_wide = (field_type == Primitive::kPrimLong) || (field_type == Primitive::kPrimDouble);
+  DataType::Type field_type = field_info.GetFieldType();
+  bool is_wide = (field_type == DataType::Type::kInt64) || (field_type == DataType::Type::kFloat64);
   bool generate_volatile = field_info.IsVolatile() && is_wide;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(
       instruction, generate_volatile ? LocationSummary::kCallOnMainOnly : LocationSummary::kNoCall);
@@ -6276,7 +6277,7 @@
     InvokeRuntimeCallingConvention calling_convention;
     // need A0 to hold base + offset
     locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-    if (field_type == Primitive::kPrimLong) {
+    if (field_type == DataType::Type::kInt64) {
       locations->SetInAt(1, Location::RegisterPairLocation(
           calling_convention.GetRegisterAt(2), calling_convention.GetRegisterAt(3)));
     } else {
@@ -6287,7 +6288,7 @@
       locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(3)));
     }
   } else {
-    if (Primitive::IsFloatingPointType(field_type)) {
+    if (DataType::IsFloatingPointType(field_type)) {
       locations->SetInAt(1, FpuRegisterOrConstantForStore(instruction->InputAt(1)));
     } else {
       locations->SetInAt(1, RegisterOrZeroConstant(instruction->InputAt(1)));
@@ -6299,7 +6300,7 @@
                                                   const FieldInfo& field_info,
                                                   uint32_t dex_pc,
                                                   bool value_can_be_null) {
-  Primitive::Type type = field_info.GetFieldType();
+  DataType::Type type = field_info.GetFieldType();
   LocationSummary* locations = instruction->GetLocations();
   Register obj = locations->InAt(0).AsRegister<Register>();
   Location value_location = locations->InAt(1);
@@ -6310,24 +6311,24 @@
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       store_type = kStoreByte;
       break;
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
       store_type = kStoreHalfword;
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimNot:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kReference:
       store_type = kStoreWord;
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       store_type = kStoreDoubleword;
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
@@ -6342,7 +6343,7 @@
     // Do implicit Null check.
     __ Lw(ZERO, locations->GetTemp(0).AsRegister<Register>(), 0);
     codegen_->RecordPcInfo(instruction, instruction->GetDexPc());
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       // Pass FP parameters in core registers.
       if (value_location.IsFpuRegister()) {
         __ Mfc1(locations->GetTemp(1).AsRegister<Register>(),
@@ -6373,9 +6374,9 @@
     if (value_location.IsConstant()) {
       int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
       __ StoreConstToOffset(store_type, value, obj, offset, TMP, null_checker);
-    } else if (!Primitive::IsFloatingPointType(type)) {
+    } else if (!DataType::IsFloatingPointType(type)) {
       Register src;
-      if (type == Primitive::kPrimLong) {
+      if (type == DataType::Type::kInt64) {
         src = value_location.AsRegisterPairLow<Register>();
       } else {
         src = value_location.AsRegister<Register>();
@@ -6384,7 +6385,7 @@
         // Note that in the case where `value` is a null reference,
         // we do not enter this block, as a null reference does not
         // need poisoning.
-        DCHECK_EQ(type, Primitive::kPrimNot);
+        DCHECK_EQ(type, DataType::Type::kReference);
         __ PoisonHeapReference(TMP, src);
         __ StoreToOffset(store_type, TMP, obj, offset, null_checker);
       } else {
@@ -6392,7 +6393,7 @@
       }
     } else {
       FRegister src = value_location.AsFpuRegister<FRegister>();
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ StoreSToOffset(src, obj, offset, null_checker);
       } else {
         __ StoreDToOffset(src, obj, offset, null_checker);
@@ -8010,15 +8011,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -8030,12 +8031,12 @@
 }
 
 void InstructionCodeGeneratorMIPS::VisitMul(HMul* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register dst = locations->Out().AsRegister<Register>();
       Register lhs = locations->InAt(0).AsRegister<Register>();
       Register rhs = locations->InAt(1).AsRegister<Register>();
@@ -8047,7 +8048,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
       Register dst_low = locations->Out().AsRegisterPairLow<Register>();
       Register lhs_high = locations->InAt(0).AsRegisterPairHigh<Register>();
@@ -8084,12 +8085,12 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FRegister dst = locations->Out().AsFpuRegister<FRegister>();
       FRegister lhs = locations->InAt(0).AsFpuRegister<FRegister>();
       FRegister rhs = locations->InAt(1).AsFpuRegister<FRegister>();
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ MulS(dst, lhs, rhs);
       } else {
         __ MulD(dst, lhs, rhs);
@@ -8105,14 +8106,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -8123,17 +8124,17 @@
 }
 
 void InstructionCodeGeneratorMIPS::VisitNeg(HNeg* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register dst = locations->Out().AsRegister<Register>();
       Register src = locations->InAt(0).AsRegister<Register>();
       __ Subu(dst, ZERO, src);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
       Register dst_low = locations->Out().AsRegisterPairLow<Register>();
       Register src_high = locations->InAt(0).AsRegisterPairHigh<Register>();
@@ -8144,11 +8145,11 @@
       __ Subu(dst_high, dst_high, TMP);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FRegister dst = locations->Out().AsFpuRegister<FRegister>();
       FRegister src = locations->InAt(0).AsFpuRegister<FRegister>();
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ NegS(dst, src);
       } else {
         __ NegD(dst, src);
@@ -8164,7 +8165,7 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
@@ -8188,7 +8189,7 @@
   } else {
     locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   }
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void InstructionCodeGeneratorMIPS::VisitNewInstance(HNewInstance* instruction) {
@@ -8216,18 +8217,18 @@
 }
 
 void InstructionCodeGeneratorMIPS::VisitNot(HNot* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register dst = locations->Out().AsRegister<Register>();
       Register src = locations->InAt(0).AsRegister<Register>();
       __ Nor(dst, src, ZERO);
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
       Register dst_low = locations->Out().AsRegisterPairLow<Register>();
       Register src_high = locations->InAt(0).AsRegisterPairHigh<Register>();
@@ -8339,19 +8340,20 @@
 }
 
 void LocationsBuilderMIPS::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
-  LocationSummary::CallKind call_kind =
-      (type == Primitive::kPrimInt) ? LocationSummary::kNoCall : LocationSummary::kCallOnMainOnly;
+  DataType::Type type = rem->GetResultType();
+  LocationSummary::CallKind call_kind = (type == DataType::Type::kInt32)
+      ? LocationSummary::kNoCall
+      : LocationSummary::kCallOnMainOnly;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(rem, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(rem->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::RegisterPairLocation(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -8361,8 +8363,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
       locations->SetInAt(1, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(1)));
@@ -8376,23 +8378,23 @@
 }
 
 void InstructionCodeGeneratorMIPS::VisitRem(HRem* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       GenerateDivRemIntegral(instruction);
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       codegen_->InvokeRuntime(kQuickLmod, instruction, instruction->GetDexPc());
       CheckEntrypointTypes<kQuickLmod, int64_t, int64_t, int64_t>();
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       codegen_->InvokeRuntime(kQuickFmodf, instruction, instruction->GetDexPc());
       CheckEntrypointTypes<kQuickFmodf, float, float, float>();
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       codegen_->InvokeRuntime(kQuickFmod, instruction, instruction->GetDexPc());
       CheckEntrypointTypes<kQuickFmod, double, double, double>();
       break;
@@ -8421,7 +8423,7 @@
 
 void LocationsBuilderMIPS::VisitReturn(HReturn* ret) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(ret);
-  Primitive::Type return_type = ret->InputAt(0)->GetType();
+  DataType::Type return_type = ret->InputAt(0)->GetType();
   locations->SetInAt(0, MipsReturnLocation(return_type));
 }
 
@@ -8597,33 +8599,33 @@
 }
 
 void LocationsBuilderMIPS::VisitTypeConversion(HTypeConversion* conversion) {
-  Primitive::Type input_type = conversion->GetInputType();
-  Primitive::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
   DCHECK_NE(input_type, result_type);
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
 
-  if ((input_type == Primitive::kPrimNot) || (input_type == Primitive::kPrimVoid) ||
-      (result_type == Primitive::kPrimNot) || (result_type == Primitive::kPrimVoid)) {
+  if ((input_type == DataType::Type::kReference) || (input_type == DataType::Type::kVoid) ||
+      (result_type == DataType::Type::kReference) || (result_type == DataType::Type::kVoid)) {
     LOG(FATAL) << "Unexpected type conversion from " << input_type << " to " << result_type;
   }
 
   LocationSummary::CallKind call_kind = LocationSummary::kNoCall;
   if (!isR6 &&
-      ((Primitive::IsFloatingPointType(result_type) && input_type == Primitive::kPrimLong) ||
-       (result_type == Primitive::kPrimLong && Primitive::IsFloatingPointType(input_type)))) {
+      ((DataType::IsFloatingPointType(result_type) && input_type == DataType::Type::kInt64) ||
+       (result_type == DataType::Type::kInt64 && DataType::IsFloatingPointType(input_type)))) {
     call_kind = LocationSummary::kCallOnMainOnly;
   }
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(conversion, call_kind);
 
   if (call_kind == LocationSummary::kNoCall) {
-    if (Primitive::IsFloatingPointType(input_type)) {
+    if (DataType::IsFloatingPointType(input_type)) {
       locations->SetInAt(0, Location::RequiresFpuRegister());
     } else {
       locations->SetInAt(0, Location::RequiresRegister());
     }
 
-    if (Primitive::IsFloatingPointType(result_type)) {
+    if (DataType::IsFloatingPointType(result_type)) {
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
     } else {
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -8631,10 +8633,10 @@
   } else {
     InvokeRuntimeCallingConvention calling_convention;
 
-    if (Primitive::IsFloatingPointType(input_type)) {
+    if (DataType::IsFloatingPointType(input_type)) {
       locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
     } else {
-      DCHECK_EQ(input_type, Primitive::kPrimLong);
+      DCHECK_EQ(input_type, DataType::Type::kInt64);
       locations->SetInAt(0, Location::RegisterPairLocation(
                  calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
     }
@@ -8645,14 +8647,14 @@
 
 void InstructionCodeGeneratorMIPS::VisitTypeConversion(HTypeConversion* conversion) {
   LocationSummary* locations = conversion->GetLocations();
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   bool has_sign_extension = codegen_->GetInstructionSetFeatures().IsMipsIsaRevGreaterThanEqual2();
   bool isR6 = codegen_->GetInstructionSetFeatures().IsR6();
 
   DCHECK_NE(input_type, result_type);
 
-  if (result_type == Primitive::kPrimLong && Primitive::IsIntegralType(input_type)) {
+  if (result_type == DataType::Type::kInt64 && DataType::IsIntegralType(input_type)) {
     Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
     Register dst_low = locations->Out().AsRegisterPairLow<Register>();
     Register src = locations->InAt(0).AsRegister<Register>();
@@ -8661,17 +8663,17 @@
       __ Move(dst_low, src);
     }
     __ Sra(dst_high, src, 31);
-  } else if (Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type)) {
+  } else if (DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type)) {
     Register dst = locations->Out().AsRegister<Register>();
-    Register src = (input_type == Primitive::kPrimLong)
+    Register src = (input_type == DataType::Type::kInt64)
         ? locations->InAt(0).AsRegisterPairLow<Register>()
         : locations->InAt(0).AsRegister<Register>();
 
     switch (result_type) {
-      case Primitive::kPrimChar:
+      case DataType::Type::kUint16:
         __ Andi(dst, src, 0xFFFF);
         break;
-      case Primitive::kPrimByte:
+      case DataType::Type::kInt8:
         if (has_sign_extension) {
           __ Seb(dst, src);
         } else {
@@ -8679,7 +8681,7 @@
           __ Sra(dst, dst, 24);
         }
         break;
-      case Primitive::kPrimShort:
+      case DataType::Type::kInt16:
         if (has_sign_extension) {
           __ Seh(dst, src);
         } else {
@@ -8687,7 +8689,7 @@
           __ Sra(dst, dst, 16);
         }
         break;
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         if (dst != src) {
           __ Move(dst, src);
         }
@@ -8697,8 +8699,8 @@
         LOG(FATAL) << "Unexpected type conversion from " << input_type
                    << " to " << result_type;
     }
-  } else if (Primitive::IsFloatingPointType(result_type) && Primitive::IsIntegralType(input_type)) {
-    if (input_type == Primitive::kPrimLong) {
+  } else if (DataType::IsFloatingPointType(result_type) && DataType::IsIntegralType(input_type)) {
+    if (input_type == DataType::Type::kInt64) {
       if (isR6) {
         // cvt.s.l/cvt.d.l requires MIPSR2+ with FR=1. MIPS32R6 is implemented as a secondary
         // architecture on top of MIPS64R6, which has FR=1, and therefore can use the instruction.
@@ -8707,16 +8709,16 @@
         FRegister dst = locations->Out().AsFpuRegister<FRegister>();
         __ Mtc1(src_low, FTMP);
         __ Mthc1(src_high, FTMP);
-        if (result_type == Primitive::kPrimFloat) {
+        if (result_type == DataType::Type::kFloat32) {
           __ Cvtsl(dst, FTMP);
         } else {
           __ Cvtdl(dst, FTMP);
         }
       } else {
-        QuickEntrypointEnum entrypoint = (result_type == Primitive::kPrimFloat) ? kQuickL2f
-                                                                                : kQuickL2d;
+        QuickEntrypointEnum entrypoint =
+            (result_type == DataType::Type::kFloat32) ? kQuickL2f : kQuickL2d;
         codegen_->InvokeRuntime(entrypoint, conversion, conversion->GetDexPc());
-        if (result_type == Primitive::kPrimFloat) {
+        if (result_type == DataType::Type::kFloat32) {
           CheckEntrypointTypes<kQuickL2f, float, int64_t>();
         } else {
           CheckEntrypointTypes<kQuickL2d, double, int64_t>();
@@ -8726,14 +8728,14 @@
       Register src = locations->InAt(0).AsRegister<Register>();
       FRegister dst = locations->Out().AsFpuRegister<FRegister>();
       __ Mtc1(src, FTMP);
-      if (result_type == Primitive::kPrimFloat) {
+      if (result_type == DataType::Type::kFloat32) {
         __ Cvtsw(dst, FTMP);
       } else {
         __ Cvtdw(dst, FTMP);
       }
     }
-  } else if (Primitive::IsIntegralType(result_type) && Primitive::IsFloatingPointType(input_type)) {
-    CHECK(result_type == Primitive::kPrimInt || result_type == Primitive::kPrimLong);
+  } else if (DataType::IsIntegralType(result_type) && DataType::IsFloatingPointType(input_type)) {
+    CHECK(result_type == DataType::Type::kInt32 || result_type == DataType::Type::kInt64);
 
     // When NAN2008=1 (R6), the truncate instruction caps the output at the minimum/maximum
     // value of the output type if the input is outside of the range after the truncation or
@@ -8751,7 +8753,7 @@
     // instruction, which will handle such an input the same way irrespective of NAN2008.
     // Otherwise the input is compared to itself to determine whether it is a NaN or not
     // in order to return either zero or the minimum value.
-    if (result_type == Primitive::kPrimLong) {
+    if (result_type == DataType::Type::kInt64) {
       if (isR6) {
         // trunc.l.s/trunc.l.d requires MIPSR2+ with FR=1. MIPS32R6 is implemented as a secondary
         // architecture on top of MIPS64R6, which has FR=1, and therefore can use the instruction.
@@ -8759,7 +8761,7 @@
         Register dst_high = locations->Out().AsRegisterPairHigh<Register>();
         Register dst_low = locations->Out().AsRegisterPairLow<Register>();
 
-        if (input_type == Primitive::kPrimFloat) {
+        if (input_type == DataType::Type::kFloat32) {
           __ TruncLS(FTMP, src);
         } else {
           __ TruncLD(FTMP, src);
@@ -8767,10 +8769,10 @@
         __ Mfc1(dst_low, FTMP);
         __ Mfhc1(dst_high, FTMP);
       } else {
-        QuickEntrypointEnum entrypoint = (input_type == Primitive::kPrimFloat) ? kQuickF2l
-                                                                               : kQuickD2l;
+        QuickEntrypointEnum entrypoint =
+            (input_type == DataType::Type::kFloat32) ? kQuickF2l : kQuickD2l;
         codegen_->InvokeRuntime(entrypoint, conversion, conversion->GetDexPc());
-        if (input_type == Primitive::kPrimFloat) {
+        if (input_type == DataType::Type::kFloat32) {
           CheckEntrypointTypes<kQuickF2l, int64_t, float>();
         } else {
           CheckEntrypointTypes<kQuickD2l, int64_t, double>();
@@ -8783,7 +8785,7 @@
       MipsLabel done;
 
       if (!isR6) {
-        if (input_type == Primitive::kPrimFloat) {
+        if (input_type == DataType::Type::kFloat32) {
           uint32_t min_val = bit_cast<uint32_t, float>(std::numeric_limits<int32_t>::min());
           __ LoadConst32(TMP, min_val);
           __ Mtc1(TMP, FTMP);
@@ -8794,14 +8796,14 @@
           __ MoveToFpuHigh(TMP, FTMP);
         }
 
-        if (input_type == Primitive::kPrimFloat) {
+        if (input_type == DataType::Type::kFloat32) {
           __ ColeS(0, FTMP, src);
         } else {
           __ ColeD(0, FTMP, src);
         }
         __ Bc1t(0, &truncate);
 
-        if (input_type == Primitive::kPrimFloat) {
+        if (input_type == DataType::Type::kFloat32) {
           __ CeqS(0, src, src);
         } else {
           __ CeqD(0, src, src);
@@ -8814,7 +8816,7 @@
         __ Bind(&truncate);
       }
 
-      if (input_type == Primitive::kPrimFloat) {
+      if (input_type == DataType::Type::kFloat32) {
         __ TruncWS(FTMP, src);
       } else {
         __ TruncWD(FTMP, src);
@@ -8825,11 +8827,11 @@
         __ Bind(&done);
       }
     }
-  } else if (Primitive::IsFloatingPointType(result_type) &&
-             Primitive::IsFloatingPointType(input_type)) {
+  } else if (DataType::IsFloatingPointType(result_type) &&
+             DataType::IsFloatingPointType(input_type)) {
     FRegister dst = locations->Out().AsFpuRegister<FRegister>();
     FRegister src = locations->InAt(0).AsFpuRegister<FRegister>();
-    if (result_type == Primitive::kPrimFloat) {
+    if (result_type == DataType::Type::kFloat32) {
       __ Cvtsd(dst, src);
     } else {
       __ Cvtds(dst, src);
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index 2b1075d..5f2f900 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -81,8 +81,8 @@
   InvokeDexCallingConventionVisitorMIPS() {}
   virtual ~InvokeDexCallingConventionVisitorMIPS() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE;
   Location GetMethodLocation() const OVERRIDE;
 
  private:
@@ -100,7 +100,7 @@
                           kRuntimeParameterFpuRegistersLength,
                           kMipsPointerSize) {}
 
-  Location GetReturnLocation(Primitive::Type return_type);
+  Location GetReturnLocation(DataType::Type return_type);
 
  private:
   DISALLOW_COPY_AND_ASSIGN(InvokeRuntimeCallingConvention);
@@ -116,17 +116,17 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return Location::RegisterLocation(A0);
   }
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? Location::RegisterPairLocation(V0, V1)
         : Location::RegisterLocation(V0);
   }
-  Location GetSetValueLocation(Primitive::Type type, bool is_instance) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetSetValueLocation(DataType::Type type, bool is_instance) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? Location::RegisterPairLocation(A2, A3)
         : (is_instance ? Location::RegisterLocation(A2) : Location::RegisterLocation(A1));
   }
-  Location GetFpuLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetFpuLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::FpuRegisterLocation(F0);
   }
 
@@ -304,14 +304,14 @@
                                     MipsLabel* label);
   void GenerateFpCompare(IfCondition cond,
                          bool gt_bias,
-                         Primitive::Type type,
+                         DataType::Type type,
                          LocationSummary* locations);
   // When the function returns `false` it means that the condition holds if the condition
   // code flag `cc` is non-zero and doesn't hold if `cc` is zero. If it returns `true`,
   // the roles of zero and non-zero values of the `cc` flag are exchanged.
   bool MaterializeFpCompareR2(IfCondition cond,
                               bool gt_bias,
-                              Primitive::Type type,
+                              DataType::Type type,
                               LocationSummary* input_locations,
                               int cc);
   // When the function returns `false` it means that the condition holds if `dst` is non-zero
@@ -319,12 +319,12 @@
   // `dst` are exchanged.
   bool MaterializeFpCompareR6(IfCondition cond,
                               bool gt_bias,
-                              Primitive::Type type,
+                              DataType::Type type,
                               LocationSummary* input_locations,
                               FRegister dst);
   void GenerateFpCompareAndBranch(IfCondition cond,
                                   bool gt_bias,
-                                  Primitive::Type type,
+                                  DataType::Type type,
                                   LocationSummary* locations,
                                   MipsLabel* label);
   void GenerateTestAndBranch(HInstruction* instruction,
@@ -518,7 +518,7 @@
 
   // Code generation helpers.
 
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
 
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
 
@@ -541,8 +541,8 @@
 
   ParallelMoveResolver* GetMoveResolver() OVERRIDE { return &move_resolver_; }
 
-  bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE {
-    return type == Primitive::kPrimLong;
+  bool NeedsTwoRegisters(DataType::Type type) const OVERRIDE {
+    return type == DataType::Type::kInt64;
   }
 
   // Check if the desired_string_load_kind is supported. If it is, return it,
@@ -567,7 +567,7 @@
       HInvokeVirtual* invoke, Location temp, SlowPathCode* slow_path = nullptr) OVERRIDE;
 
   void MoveFromReturnRegister(Location trg ATTRIBUTE_UNUSED,
-                              Primitive::Type type ATTRIBUTE_UNUSED) OVERRIDE {
+                              DataType::Type type ATTRIBUTE_UNUSED) OVERRIDE {
     UNIMPLEMENTED(FATAL) << "Not implemented on MIPS";
   }
 
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 119e0f6..7051cce 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -47,28 +47,28 @@
 constexpr bool kBakerReadBarrierThunksEnableForArrays = true;
 constexpr bool kBakerReadBarrierThunksEnableForGcRoots = true;
 
-Location Mips64ReturnLocation(Primitive::Type return_type) {
+Location Mips64ReturnLocation(DataType::Type return_type) {
   switch (return_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
       return Location::RegisterLocation(V0);
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       return Location::FpuRegisterLocation(F0);
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       return Location();
   }
   UNREACHABLE();
 }
 
-Location InvokeDexCallingConventionVisitorMIPS64::GetReturnLocation(Primitive::Type type) const {
+Location InvokeDexCallingConventionVisitorMIPS64::GetReturnLocation(DataType::Type type) const {
   return Mips64ReturnLocation(type);
 }
 
@@ -76,34 +76,34 @@
   return Location::RegisterLocation(kMethodRegisterArgument);
 }
 
-Location InvokeDexCallingConventionVisitorMIPS64::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorMIPS64::GetNextLocation(DataType::Type type) {
   Location next_location;
-  if (type == Primitive::kPrimVoid) {
+  if (type == DataType::Type::kVoid) {
     LOG(FATAL) << "Unexpected parameter type " << type;
   }
 
-  if (Primitive::IsFloatingPointType(type) &&
+  if (DataType::IsFloatingPointType(type) &&
       (float_index_ < calling_convention.GetNumberOfFpuRegisters())) {
     next_location = Location::FpuRegisterLocation(
         calling_convention.GetFpuRegisterAt(float_index_++));
     gp_index_++;
-  } else if (!Primitive::IsFloatingPointType(type) &&
+  } else if (!DataType::IsFloatingPointType(type) &&
              (gp_index_ < calling_convention.GetNumberOfRegisters())) {
     next_location = Location::RegisterLocation(calling_convention.GetRegisterAt(gp_index_++));
     float_index_++;
   } else {
     size_t stack_offset = calling_convention.GetStackOffsetOf(stack_index_);
-    next_location = Primitive::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
-                                                 : Location::StackSlot(stack_offset);
+    next_location = DataType::Is64BitType(type) ? Location::DoubleStackSlot(stack_offset)
+                                                : Location::StackSlot(stack_offset);
   }
 
   // Space on the stack is reserved for all arguments.
-  stack_index_ += Primitive::Is64BitType(type) ? 2 : 1;
+  stack_index_ += DataType::Is64BitType(type) ? 2 : 1;
 
   return next_location;
 }
 
-Location InvokeRuntimeCallingConvention::GetReturnLocation(Primitive::Type type) {
+Location InvokeRuntimeCallingConvention::GetReturnLocation(DataType::Type type) {
   return Mips64ReturnLocation(type);
 }
 
@@ -128,10 +128,10 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimInt,
+                               DataType::Type::kInt32,
                                locations->InAt(1),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimInt);
+                               DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -236,7 +236,7 @@
     // Move the class to the desired location.
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = instruction_->GetType();
+      DataType::Type type = instruction_->GetType();
       mips64_codegen->MoveLocation(out,
                                    Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                    type);
@@ -331,7 +331,7 @@
                        /* placeholder */ 0x5678);
     }
 
-    Primitive::Type type = instruction_->GetType();
+    DataType::Type type = instruction_->GetType();
     mips64_codegen->MoveLocation(locations->Out(),
                                  Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                  type);
@@ -446,14 +446,14 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimNot,
+                               DataType::Type::kReference,
                                locations->InAt(1),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       mips64_codegen->InvokeRuntime(kQuickInstanceofNonTrivial, instruction_, dex_pc, this);
       CheckEntrypointTypes<kQuickInstanceofNonTrivial, size_t, mirror::Object*, mirror::Class*>();
-      Primitive::Type ret_type = instruction_->GetType();
+      DataType::Type ret_type = instruction_->GetType();
       Location ret_loc = calling_convention.GetReturnLocation(ret_type);
       mips64_codegen->MoveLocation(locations->Out(), ret_loc, ret_type);
     } else {
@@ -515,17 +515,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -823,7 +823,7 @@
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
     CodeGeneratorMIPS64* mips64_codegen = down_cast<CodeGeneratorMIPS64*>(codegen);
     LocationSummary* locations = instruction_->GetLocations();
-    Primitive::Type type = Primitive::kPrimNot;
+    DataType::Type type = DataType::Type::kReference;
     GpuRegister reg_out = out_.AsRegister<GpuRegister>();
     DCHECK(locations->CanCall());
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(reg_out));
@@ -912,16 +912,16 @@
     HParallelMove parallel_move(codegen->GetGraph()->GetArena());
     parallel_move.AddMove(ref_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     parallel_move.AddMove(obj_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -987,7 +987,7 @@
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
     LocationSummary* locations = instruction_->GetLocations();
-    Primitive::Type type = Primitive::kPrimNot;
+    DataType::Type type = DataType::Type::kReference;
     GpuRegister reg_out = out_.AsRegister<GpuRegister>();
     DCHECK(locations->CanCall());
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(reg_out));
@@ -1002,7 +1002,7 @@
     CodeGeneratorMIPS64* mips64_codegen = down_cast<CodeGeneratorMIPS64*>(codegen);
     mips64_codegen->MoveLocation(Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
                                  root_,
-                                 Primitive::kPrimNot);
+                                 DataType::Type::kReference);
     mips64_codegen->InvokeRuntime(kQuickReadBarrierForRootSlow,
                                   instruction_,
                                   instruction_->GetDexPc(),
@@ -1254,7 +1254,7 @@
 
 void CodeGeneratorMIPS64::MoveLocation(Location destination,
                                        Location source,
-                                       Primitive::Type dst_type) {
+                                       DataType::Type dst_type) {
   if (source.Equals(destination)) {
     return;
   }
@@ -1262,7 +1262,7 @@
   // A valid move can always be inferred from the destination and source
   // locations. When moving from and to a register, the argument type can be
   // used to generate 32bit instead of 64bit moves.
-  bool unspecified_type = (dst_type == Primitive::kPrimVoid);
+  bool unspecified_type = (dst_type == DataType::Type::kVoid);
   DCHECK_EQ(unspecified_type, false);
 
   if (destination.IsRegister() || destination.IsFpuRegister()) {
@@ -1273,27 +1273,27 @@
                                   || src_cst->IsFloatConstant()
                                   || src_cst->IsNullConstant()))) {
         // For stack slots and 32bit constants, a 64bit type is appropriate.
-        dst_type = destination.IsRegister() ? Primitive::kPrimInt : Primitive::kPrimFloat;
+        dst_type = destination.IsRegister() ? DataType::Type::kInt32 : DataType::Type::kFloat32;
       } else {
         // If the source is a double stack slot or a 64bit constant, a 64bit
         // type is appropriate. Else the source is a register, and since the
         // type has not been specified, we chose a 64bit type to force a 64bit
         // move.
-        dst_type = destination.IsRegister() ? Primitive::kPrimLong : Primitive::kPrimDouble;
+        dst_type = destination.IsRegister() ? DataType::Type::kInt64 : DataType::Type::kFloat64;
       }
     }
-    DCHECK((destination.IsFpuRegister() && Primitive::IsFloatingPointType(dst_type)) ||
-           (destination.IsRegister() && !Primitive::IsFloatingPointType(dst_type)));
+    DCHECK((destination.IsFpuRegister() && DataType::IsFloatingPointType(dst_type)) ||
+           (destination.IsRegister() && !DataType::IsFloatingPointType(dst_type)));
     if (source.IsStackSlot() || source.IsDoubleStackSlot()) {
       // Move to GPR/FPR from stack
       LoadOperandType load_type = source.IsStackSlot() ? kLoadWord : kLoadDoubleword;
-      if (Primitive::IsFloatingPointType(dst_type)) {
+      if (DataType::IsFloatingPointType(dst_type)) {
         __ LoadFpuFromOffset(load_type,
                              destination.AsFpuRegister<FpuRegister>(),
                              SP,
                              source.GetStackIndex());
       } else {
-        // TODO: use load_type = kLoadUnsignedWord when type == Primitive::kPrimNot.
+        // TODO: use load_type = kLoadUnsignedWord when type == DataType::Type::kReference.
         __ LoadFromOffset(load_type,
                           destination.AsRegister<GpuRegister>(),
                           SP,
@@ -1307,27 +1307,27 @@
     } else if (source.IsConstant()) {
       // Move to GPR/FPR from constant
       GpuRegister gpr = AT;
-      if (!Primitive::IsFloatingPointType(dst_type)) {
+      if (!DataType::IsFloatingPointType(dst_type)) {
         gpr = destination.AsRegister<GpuRegister>();
       }
-      if (dst_type == Primitive::kPrimInt || dst_type == Primitive::kPrimFloat) {
+      if (dst_type == DataType::Type::kInt32 || dst_type == DataType::Type::kFloat32) {
         int32_t value = GetInt32ValueOf(source.GetConstant()->AsConstant());
-        if (Primitive::IsFloatingPointType(dst_type) && value == 0) {
+        if (DataType::IsFloatingPointType(dst_type) && value == 0) {
           gpr = ZERO;
         } else {
           __ LoadConst32(gpr, value);
         }
       } else {
         int64_t value = GetInt64ValueOf(source.GetConstant()->AsConstant());
-        if (Primitive::IsFloatingPointType(dst_type) && value == 0) {
+        if (DataType::IsFloatingPointType(dst_type) && value == 0) {
           gpr = ZERO;
         } else {
           __ LoadConst64(gpr, value);
         }
       }
-      if (dst_type == Primitive::kPrimFloat) {
+      if (dst_type == DataType::Type::kFloat32) {
         __ Mtc1(gpr, destination.AsFpuRegister<FpuRegister>());
-      } else if (dst_type == Primitive::kPrimDouble) {
+      } else if (dst_type == DataType::Type::kFloat64) {
         __ Dmtc1(gpr, destination.AsFpuRegister<FpuRegister>());
       }
     } else if (source.IsRegister()) {
@@ -1336,7 +1336,7 @@
         __ Move(destination.AsRegister<GpuRegister>(), source.AsRegister<GpuRegister>());
       } else {
         DCHECK(destination.IsFpuRegister());
-        if (Primitive::Is64BitType(dst_type)) {
+        if (DataType::Is64BitType(dst_type)) {
           __ Dmtc1(source.AsRegister<GpuRegister>(), destination.AsFpuRegister<FpuRegister>());
         } else {
           __ Mtc1(source.AsRegister<GpuRegister>(), destination.AsFpuRegister<FpuRegister>());
@@ -1349,16 +1349,16 @@
                    VectorRegisterFrom(source));
         } else {
           // Move to FPR from FPR
-          if (dst_type == Primitive::kPrimFloat) {
+          if (dst_type == DataType::Type::kFloat32) {
             __ MovS(destination.AsFpuRegister<FpuRegister>(), source.AsFpuRegister<FpuRegister>());
           } else {
-            DCHECK_EQ(dst_type, Primitive::kPrimDouble);
+            DCHECK_EQ(dst_type, DataType::Type::kFloat64);
             __ MovD(destination.AsFpuRegister<FpuRegister>(), source.AsFpuRegister<FpuRegister>());
           }
         }
       } else {
         DCHECK(destination.IsRegister());
-        if (Primitive::Is64BitType(dst_type)) {
+        if (DataType::Is64BitType(dst_type)) {
           __ Dmfc1(destination.AsRegister<GpuRegister>(), source.AsFpuRegister<FpuRegister>());
         } else {
           __ Mfc1(destination.AsRegister<GpuRegister>(), source.AsFpuRegister<FpuRegister>());
@@ -1387,13 +1387,14 @@
     if (source.IsRegister() || source.IsFpuRegister()) {
       if (unspecified_type) {
         if (source.IsRegister()) {
-          dst_type = destination.IsStackSlot() ? Primitive::kPrimInt : Primitive::kPrimLong;
+          dst_type = destination.IsStackSlot() ? DataType::Type::kInt32 : DataType::Type::kInt64;
         } else {
-          dst_type = destination.IsStackSlot() ? Primitive::kPrimFloat : Primitive::kPrimDouble;
+          dst_type =
+              destination.IsStackSlot() ? DataType::Type::kFloat32 : DataType::Type::kFloat64;
         }
       }
-      DCHECK((destination.IsDoubleStackSlot() == Primitive::Is64BitType(dst_type)) &&
-             (source.IsFpuRegister() == Primitive::IsFloatingPointType(dst_type)));
+      DCHECK((destination.IsDoubleStackSlot() == DataType::Is64BitType(dst_type)) &&
+             (source.IsFpuRegister() == DataType::IsFloatingPointType(dst_type)));
       // Move to stack from GPR/FPR
       StoreOperandType store_type = destination.IsStackSlot() ? kStoreWord : kStoreDoubleword;
       if (source.IsRegister()) {
@@ -1442,7 +1443,7 @@
   }
 }
 
-void CodeGeneratorMIPS64::SwapLocations(Location loc1, Location loc2, Primitive::Type type) {
+void CodeGeneratorMIPS64::SwapLocations(Location loc1, Location loc2, DataType::Type type) {
   DCHECK(!loc1.IsConstant());
   DCHECK(!loc2.IsConstant());
 
@@ -1466,12 +1467,12 @@
     // Swap 2 FPRs
     FpuRegister r1 = loc1.AsFpuRegister<FpuRegister>();
     FpuRegister r2 = loc2.AsFpuRegister<FpuRegister>();
-    if (type == Primitive::kPrimFloat) {
+    if (type == DataType::Type::kFloat32) {
       __ MovS(FTMP, r1);
       __ MovS(r1, r2);
       __ MovS(r2, FTMP);
     } else {
-      DCHECK_EQ(type, Primitive::kPrimDouble);
+      DCHECK_EQ(type, DataType::Type::kFloat64);
       __ MovD(FTMP, r1);
       __ MovD(r1, r2);
       __ MovD(r2, FTMP);
@@ -1482,7 +1483,7 @@
     Location mem_loc = is_slot1 ? loc1 : loc2;
     LoadOperandType load_type = mem_loc.IsStackSlot() ? kLoadWord : kLoadDoubleword;
     StoreOperandType store_type = mem_loc.IsStackSlot() ? kStoreWord : kStoreDoubleword;
-    // TODO: use load_type = kLoadUnsignedWord when type == Primitive::kPrimNot.
+    // TODO: use load_type = kLoadUnsignedWord when type == DataType::Type::kReference.
     __ LoadFromOffset(load_type, TMP, SP, mem_loc.GetStackIndex());
     if (reg_loc.IsFpuRegister()) {
       __ StoreFpuToOffset(store_type,
@@ -1859,10 +1860,10 @@
 void LocationsBuilderMIPS64::HandleBinaryOp(HBinaryOperation* instruction) {
   DCHECK_EQ(instruction->InputCount(), 2U);
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       HInstruction* right = instruction->InputAt(1);
       bool can_use_imm = false;
@@ -1885,8 +1886,8 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -1898,12 +1899,12 @@
 }
 
 void InstructionCodeGeneratorMIPS64::HandleBinaryOp(HBinaryOperation* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
       GpuRegister lhs = locations->InAt(0).AsRegister<GpuRegister>();
       Location rhs_location = locations->InAt(1);
@@ -1933,7 +1934,7 @@
         else
           __ Xor(dst, lhs, rhs_reg);
       } else if (instruction->IsAdd()) {
-        if (type == Primitive::kPrimInt) {
+        if (type == DataType::Type::kInt32) {
           if (use_imm)
             __ Addiu(dst, lhs, rhs_imm);
           else
@@ -1946,7 +1947,7 @@
         }
       } else {
         DCHECK(instruction->IsSub());
-        if (type == Primitive::kPrimInt) {
+        if (type == DataType::Type::kInt32) {
           if (use_imm)
             __ Addiu(dst, lhs, -rhs_imm);
           else
@@ -1960,18 +1961,18 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
       FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
       FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
       if (instruction->IsAdd()) {
-        if (type == Primitive::kPrimFloat)
+        if (type == DataType::Type::kFloat32)
           __ AddS(dst, lhs, rhs);
         else
           __ AddD(dst, lhs, rhs);
       } else if (instruction->IsSub()) {
-        if (type == Primitive::kPrimFloat)
+        if (type == DataType::Type::kFloat32)
           __ SubS(dst, lhs, rhs);
         else
           __ SubD(dst, lhs, rhs);
@@ -1989,10 +1990,10 @@
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr() || instr->IsRor());
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instr);
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instr->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2006,11 +2007,11 @@
 void InstructionCodeGeneratorMIPS64::HandleShift(HBinaryOperation* instr) {
   DCHECK(instr->IsShl() || instr->IsShr() || instr->IsUShr() || instr->IsRor());
   LocationSummary* locations = instr->GetLocations();
-  Primitive::Type type = instr->GetType();
+  DataType::Type type = instr->GetType();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
       GpuRegister lhs = locations->InAt(0).AsRegister<GpuRegister>();
       Location rhs_location = locations->InAt(1);
@@ -2026,13 +2027,13 @@
 
       if (use_imm) {
         uint32_t shift_value = rhs_imm &
-            (type == Primitive::kPrimInt ? kMaxIntShiftDistance : kMaxLongShiftDistance);
+            (type == DataType::Type::kInt32 ? kMaxIntShiftDistance : kMaxLongShiftDistance);
 
         if (shift_value == 0) {
           if (dst != lhs) {
             __ Move(dst, lhs);
           }
-        } else if (type == Primitive::kPrimInt) {
+        } else if (type == DataType::Type::kInt32) {
           if (instr->IsShl()) {
             __ Sll(dst, lhs, shift_value);
           } else if (instr->IsShr()) {
@@ -2067,7 +2068,7 @@
           }
         }
       } else {
-        if (type == Primitive::kPrimInt) {
+        if (type == DataType::Type::kInt32) {
           if (instr->IsShl()) {
             __ Sllv(dst, lhs, rhs_reg);
           } else if (instr->IsShr()) {
@@ -2113,9 +2114,9 @@
 }
 
 void LocationsBuilderMIPS64::VisitArrayGet(HArrayGet* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (type == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (type == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier
@@ -2126,7 +2127,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(type)) {
+  if (DataType::IsFloatingPointType(type)) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps in the case of an object array get with
@@ -2165,11 +2166,11 @@
   uint32_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   const bool maybe_compressed_char_at = mirror::kUseStringCompression &&
                                         instruction->IsStringCharAt();
   switch (type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2182,7 +2183,7 @@
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2195,7 +2196,7 @@
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2208,7 +2209,7 @@
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
       if (maybe_compressed_char_at) {
         uint32_t count_offset = mirror::String::CountOffset().Uint32Value();
@@ -2260,10 +2261,11 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK_EQ(sizeof(mirror::HeapReference<mirror::Object>), sizeof(int32_t));
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
-      LoadOperandType load_type = (type == Primitive::kPrimNot) ? kLoadUnsignedWord : kLoadWord;
+      LoadOperandType load_type =
+          (type == DataType::Type::kReference) ? kLoadUnsignedWord : kLoadWord;
       if (index.IsConstant()) {
         size_t offset =
             (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
@@ -2275,7 +2277,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       static_assert(
           sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
           "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -2335,7 +2337,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       GpuRegister out = out_loc.AsRegister<GpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2348,7 +2350,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       FpuRegister out = out_loc.AsFpuRegister<FpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2361,7 +2363,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       FpuRegister out = out_loc.AsFpuRegister<FpuRegister>();
       if (index.IsConstant()) {
         size_t offset =
@@ -2374,7 +2376,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -2419,7 +2421,7 @@
 }
 
 void LocationsBuilderMIPS64::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -2433,7 +2435,7 @@
 
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->InputAt(2)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(2)->GetType())) {
     locations->SetInAt(2, FpuRegisterOrConstantForStore(instruction->InputAt(2)));
   } else {
     locations->SetInAt(2, RegisterOrZeroConstant(instruction->InputAt(2)));
@@ -2449,7 +2451,7 @@
   GpuRegister obj = locations->InAt(0).AsRegister<GpuRegister>();
   Location index = locations->InAt(1);
   Location value_location = locations->InAt(2);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -2457,8 +2459,8 @@
   GpuRegister base_reg = index.IsConstant() ? obj : TMP;
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_1;
@@ -2475,8 +2477,8 @@
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_2;
@@ -2493,7 +2495,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
@@ -2510,7 +2512,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       if (value_location.IsConstant()) {
         // Just setting null.
         uint32_t data_offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
@@ -2625,7 +2627,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
@@ -2642,7 +2644,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4;
@@ -2659,7 +2661,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
       if (index.IsConstant()) {
         data_offset += index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8;
@@ -2676,7 +2678,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -2961,24 +2963,24 @@
 }
 
 void LocationsBuilderMIPS64::VisitCompare(HCompare* compare) {
-  Primitive::Type in_type = compare->InputAt(0)->GetType();
+  DataType::Type in_type = compare->InputAt(0)->GetType();
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(compare);
 
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(compare->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2992,24 +2994,24 @@
 void InstructionCodeGeneratorMIPS64::VisitCompare(HCompare* instruction) {
   LocationSummary* locations = instruction->GetLocations();
   GpuRegister res = locations->Out().AsRegister<GpuRegister>();
-  Primitive::Type in_type = instruction->InputAt(0)->GetType();
+  DataType::Type in_type = instruction->InputAt(0)->GetType();
 
   //  0 if: left == right
   //  1 if: left  > right
   // -1 if: left  < right
   switch (in_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister lhs = locations->InAt(0).AsRegister<GpuRegister>();
       Location rhs_location = locations->InAt(1);
       bool use_imm = rhs_location.IsConstant();
       GpuRegister rhs = ZERO;
       if (use_imm) {
-        if (in_type == Primitive::kPrimLong) {
+        if (in_type == DataType::Type::kInt64) {
           int64_t value = CodeGenerator::GetInt64ValueOf(rhs_location.GetConstant()->AsConstant());
           if (value != 0) {
             rhs = AT;
@@ -3031,7 +3033,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
       FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
       Mips64Label done;
@@ -3053,7 +3055,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
       FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
       Mips64Label done;
@@ -3084,13 +3086,13 @@
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->InputAt(0)->GetType()) {
     default:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       break;
@@ -3105,18 +3107,18 @@
     return;
   }
 
-  Primitive::Type type = instruction->InputAt(0)->GetType();
+  DataType::Type type = instruction->InputAt(0)->GetType();
   LocationSummary* locations = instruction->GetLocations();
   switch (type) {
     default:
       // Integer case.
       GenerateIntLongCompare(instruction->GetCondition(), /* is64bit */ false, locations);
       return;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       GenerateIntLongCompare(instruction->GetCondition(), /* is64bit */ true, locations);
       return;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       GenerateFpCompare(instruction->GetCondition(), instruction->IsGtBias(), type, locations);
      return;
   }
@@ -3124,7 +3126,7 @@
 
 void InstructionCodeGeneratorMIPS64::DivRemOneOrMinusOne(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -3139,10 +3141,10 @@
     __ Move(out, ZERO);
   } else {
     if (imm == -1) {
-      if (type == Primitive::kPrimInt) {
+      if (type == DataType::Type::kInt32) {
         __ Subu(out, ZERO, dividend);
       } else {
-        DCHECK_EQ(type, Primitive::kPrimLong);
+        DCHECK_EQ(type, DataType::Type::kInt64);
         __ Dsubu(out, ZERO, dividend);
       }
     } else if (out != dividend) {
@@ -3153,7 +3155,7 @@
 
 void InstructionCodeGeneratorMIPS64::DivRemByPowerOfTwo(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
 
   LocationSummary* locations = instruction->GetLocations();
   Location second = locations->InAt(1);
@@ -3166,7 +3168,7 @@
   int ctz_imm = CTZ(abs_imm);
 
   if (instruction->IsDiv()) {
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       if (ctz_imm == 1) {
         // Fast path for division by +/-2, which is very common.
         __ Srl(TMP, dividend, 31);
@@ -3180,7 +3182,7 @@
         __ Subu(out, ZERO, out);
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimLong);
+      DCHECK_EQ(type, DataType::Type::kInt64);
       if (ctz_imm == 1) {
         // Fast path for division by +/-2, which is very common.
         __ Dsrl32(TMP, dividend, 31);
@@ -3203,7 +3205,7 @@
       }
     }
   } else {
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       if (ctz_imm == 1) {
         // Fast path for modulo +/-2, which is very common.
         __ Sra(TMP, dividend, 31);
@@ -3223,7 +3225,7 @@
         __ Subu(out, out, TMP);
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimLong);
+      DCHECK_EQ(type, DataType::Type::kInt64);
       if (ctz_imm == 1) {
         // Fast path for modulo +/-2, which is very common.
         __ Dsra32(TMP, dividend, 31);
@@ -3266,17 +3268,17 @@
   GpuRegister dividend = locations->InAt(0).AsRegister<GpuRegister>();
   int64_t imm = Int64FromConstant(second.GetConstant());
 
-  Primitive::Type type = instruction->GetResultType();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong) << type;
+  DataType::Type type = instruction->GetResultType();
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64) << type;
 
   int64_t magic;
   int shift;
   CalculateMagicAndShiftForDivRem(imm,
-                                  (type == Primitive::kPrimLong),
+                                  (type == DataType::Type::kInt64),
                                   &magic,
                                   &shift);
 
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     __ LoadConst32(TMP, magic);
     __ MuhR6(TMP, dividend, TMP);
 
@@ -3331,8 +3333,8 @@
 
 void InstructionCodeGeneratorMIPS64::GenerateDivRemIntegral(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  Primitive::Type type = instruction->GetResultType();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong) << type;
+  DataType::Type type = instruction->GetResultType();
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64) << type;
 
   LocationSummary* locations = instruction->GetLocations();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
@@ -3354,12 +3356,12 @@
     GpuRegister dividend = locations->InAt(0).AsRegister<GpuRegister>();
     GpuRegister divisor = second.AsRegister<GpuRegister>();
     if (instruction->IsDiv()) {
-      if (type == Primitive::kPrimInt)
+      if (type == DataType::Type::kInt32)
         __ DivR6(out, dividend, divisor);
       else
         __ Ddiv(out, dividend, divisor);
     } else {
-      if (type == Primitive::kPrimInt)
+      if (type == DataType::Type::kInt32)
         __ ModR6(out, dividend, divisor);
       else
         __ Dmod(out, dividend, divisor);
@@ -3371,15 +3373,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(div, LocationSummary::kNoCall);
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(div->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -3391,20 +3393,20 @@
 }
 
 void InstructionCodeGeneratorMIPS64::VisitDiv(HDiv* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       GenerateDivRemIntegral(instruction);
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
       FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
       FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
-      if (type == Primitive::kPrimFloat)
+      if (type == DataType::Type::kFloat32)
         __ DivS(dst, lhs, rhs);
       else
         __ DivD(dst, lhs, rhs);
@@ -3426,9 +3428,9 @@
   codegen_->AddSlowPath(slow_path);
   Location value = instruction->GetLocations()->InAt(0);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
-  if (!Primitive::IsIntegralType(type)) {
+  if (!DataType::IsIntegralType(type)) {
     LOG(FATAL) << "Unexpected type " << type << " for DivZeroCheck.";
     return;
   }
@@ -3864,12 +3866,12 @@
 
 void InstructionCodeGeneratorMIPS64::GenerateFpCompare(IfCondition cond,
                                                        bool gt_bias,
-                                                       Primitive::Type type,
+                                                       DataType::Type type,
                                                        LocationSummary* locations) {
   GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
   FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
   FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     switch (cond) {
       case kCondEQ:
         __ CmpEqS(FTMP, lhs, rhs);
@@ -3922,7 +3924,7 @@
         UNREACHABLE();
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     switch (cond) {
       case kCondEQ:
         __ CmpEqD(FTMP, lhs, rhs);
@@ -3979,12 +3981,12 @@
 
 bool InstructionCodeGeneratorMIPS64::MaterializeFpCompare(IfCondition cond,
                                                           bool gt_bias,
-                                                          Primitive::Type type,
+                                                          DataType::Type type,
                                                           LocationSummary* input_locations,
                                                           FpuRegister dst) {
   FpuRegister lhs = input_locations->InAt(0).AsFpuRegister<FpuRegister>();
   FpuRegister rhs = input_locations->InAt(1).AsFpuRegister<FpuRegister>();
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     switch (cond) {
       case kCondEQ:
         __ CmpEqS(dst, lhs, rhs);
@@ -4025,7 +4027,7 @@
         UNREACHABLE();
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     switch (cond) {
       case kCondEQ:
         __ CmpEqD(dst, lhs, rhs);
@@ -4070,12 +4072,12 @@
 
 void InstructionCodeGeneratorMIPS64::GenerateFpCompareAndBranch(IfCondition cond,
                                                                 bool gt_bias,
-                                                                Primitive::Type type,
+                                                                DataType::Type type,
                                                                 LocationSummary* locations,
                                                                 Mips64Label* label) {
   FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
   FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
-  if (type == Primitive::kPrimFloat) {
+  if (type == DataType::Type::kFloat32) {
     switch (cond) {
       case kCondEQ:
         __ CmpEqS(FTMP, lhs, rhs);
@@ -4122,7 +4124,7 @@
         UNREACHABLE();
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     switch (cond) {
       case kCondEQ:
         __ CmpEqD(FTMP, lhs, rhs);
@@ -4216,7 +4218,7 @@
     // The condition instruction has not been materialized, use its inputs as
     // the comparison and its condition as the branch condition.
     HCondition* condition = cond->AsCondition();
-    Primitive::Type type = condition->InputAt(0)->GetType();
+    DataType::Type type = condition->InputAt(0)->GetType();
     LocationSummary* locations = cond->GetLocations();
     IfCondition if_cond = condition->GetCondition();
     Mips64Label* branch_target = true_target;
@@ -4230,11 +4232,11 @@
       default:
         GenerateIntLongCompareAndBranch(if_cond, /* is64bit */ false, locations, branch_target);
         break;
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         GenerateIntLongCompareAndBranch(if_cond, /* is64bit */ true, locations, branch_target);
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         GenerateFpCompareAndBranch(if_cond, condition->IsGtBias(), type, locations, branch_target);
         break;
     }
@@ -4299,8 +4301,9 @@
   HInstruction* cond = select->InputAt(/* condition_input_index */ 2);
   HCondition* condition = cond->AsCondition();
 
-  Primitive::Type cond_type = materialized ? Primitive::kPrimInt : condition->InputAt(0)->GetType();
-  Primitive::Type dst_type = select->GetType();
+  DataType::Type cond_type =
+      materialized ? DataType::Type::kInt32 : condition->InputAt(0)->GetType();
+  DataType::Type dst_type = select->GetType();
 
   HConstant* cst_true_value = select->GetTrueValue()->AsConstant();
   HConstant* cst_false_value = select->GetFalseValue()->AsConstant();
@@ -4314,8 +4317,8 @@
   bool use_const_for_true_in = false;
 
   if (!cond->IsConstant()) {
-    if (!Primitive::IsFloatingPointType(cond_type)) {
-      if (!Primitive::IsFloatingPointType(dst_type)) {
+    if (!DataType::IsFloatingPointType(cond_type)) {
+      if (!DataType::IsFloatingPointType(dst_type)) {
         // Moving int/long on int/long condition.
         if (is_true_value_zero_constant) {
           // seleqz out_reg, false_reg, cond_reg
@@ -4358,7 +4361,7 @@
         }
       }
     } else {
-      if (!Primitive::IsFloatingPointType(dst_type)) {
+      if (!DataType::IsFloatingPointType(dst_type)) {
         // Moving int/long on float/double condition.
         can_move_conditionally = true;
         if (is_true_value_zero_constant) {
@@ -4404,7 +4407,7 @@
       locations_to_set->SetInAt(0, Location::ConstantLocation(cst_false_value));
     } else {
       locations_to_set->SetInAt(0,
-                                Primitive::IsFloatingPointType(dst_type)
+                                DataType::IsFloatingPointType(dst_type)
                                     ? Location::RequiresFpuRegister()
                                     : Location::RequiresRegister());
     }
@@ -4412,7 +4415,7 @@
       locations_to_set->SetInAt(1, Location::ConstantLocation(cst_true_value));
     } else {
       locations_to_set->SetInAt(1,
-                                Primitive::IsFloatingPointType(dst_type)
+                                DataType::IsFloatingPointType(dst_type)
                                     ? Location::RequiresFpuRegister()
                                     : Location::RequiresRegister());
     }
@@ -4421,7 +4424,7 @@
     }
 
     if (can_move_conditionally) {
-      locations_to_set->SetOut(Primitive::IsFloatingPointType(dst_type)
+      locations_to_set->SetOut(DataType::IsFloatingPointType(dst_type)
                                    ? Location::RequiresFpuRegister()
                                    : Location::RequiresRegister());
     } else {
@@ -4441,9 +4444,9 @@
   HInstruction* cond = select->InputAt(/* condition_input_index */ 2);
   GpuRegister cond_reg = TMP;
   FpuRegister fcond_reg = FTMP;
-  Primitive::Type cond_type = Primitive::kPrimInt;
+  DataType::Type cond_type = DataType::Type::kInt32;
   bool cond_inverted = false;
-  Primitive::Type dst_type = select->GetType();
+  DataType::Type dst_type = select->GetType();
 
   if (IsBooleanValueOrMaterializedCondition(cond)) {
     cond_reg = locations->InAt(/* condition_input_index */ 2).AsRegister<GpuRegister>();
@@ -4459,14 +4462,14 @@
                                                   cond_locations,
                                                   cond_reg);
         break;
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         cond_inverted = MaterializeIntLongCompare(if_cond,
                                                   /* is64bit */ true,
                                                   cond_locations,
                                                   cond_reg);
         break;
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         cond_inverted = MaterializeFpCompare(if_cond,
                                              condition->IsGtBias(),
                                              cond_type,
@@ -4485,7 +4488,7 @@
 
   switch (dst_type) {
     default:
-      if (Primitive::IsFloatingPointType(cond_type)) {
+      if (DataType::IsFloatingPointType(cond_type)) {
         __ Mfc1(cond_reg, fcond_reg);
       }
       if (true_src.IsConstant()) {
@@ -4512,8 +4515,8 @@
         __ Or(dst.AsRegister<GpuRegister>(), AT, TMP);
       }
       break;
-    case Primitive::kPrimFloat: {
-      if (!Primitive::IsFloatingPointType(cond_type)) {
+    case DataType::Type::kFloat32: {
+      if (!DataType::IsFloatingPointType(cond_type)) {
         // sel*.fmt tests bit 0 of the condition register, account for that.
         __ Sltu(TMP, ZERO, cond_reg);
         __ Mtc1(TMP, fcond_reg);
@@ -4547,8 +4550,8 @@
       }
       break;
     }
-    case Primitive::kPrimDouble: {
-      if (!Primitive::IsFloatingPointType(cond_type)) {
+    case DataType::Type::kFloat64: {
+      if (!DataType::IsFloatingPointType(cond_type)) {
         // sel*.fmt tests bit 0 of the condition register, account for that.
         __ Sltu(TMP, ZERO, cond_reg);
         __ Mtc1(TMP, fcond_reg);
@@ -4632,9 +4635,9 @@
 
 void LocationsBuilderMIPS64::HandleFieldGet(HInstruction* instruction,
                                             const FieldInfo& field_info) {
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (field_type == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (field_type == DataType::Type::kReference);
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(
       instruction,
       object_field_get_with_read_barrier
@@ -4644,7 +4647,7 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
   locations->SetInAt(0, Location::RequiresRegister());
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister());
   } else {
     // The output overlaps in the case of an object field get with
@@ -4666,7 +4669,7 @@
 
 void InstructionCodeGeneratorMIPS64::HandleFieldGet(HInstruction* instruction,
                                                     const FieldInfo& field_info) {
-  Primitive::Type type = field_info.GetFieldType();
+  DataType::Type type = field_info.GetFieldType();
   LocationSummary* locations = instruction->GetLocations();
   Location obj_loc = locations->InAt(0);
   GpuRegister obj = obj_loc.AsRegister<GpuRegister>();
@@ -4677,37 +4680,37 @@
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
   switch (type) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       load_type = kLoadUnsignedByte;
       break;
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       load_type = kLoadSignedByte;
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       load_type = kLoadSignedHalfword;
       break;
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       load_type = kLoadUnsignedHalfword;
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       load_type = kLoadWord;
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       load_type = kLoadDoubleword;
       break;
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       load_type = kLoadUnsignedWord;
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
-  if (!Primitive::IsFloatingPointType(type)) {
+  if (!DataType::IsFloatingPointType(type)) {
     DCHECK(dst_loc.IsRegister());
     GpuRegister dst = dst_loc.AsRegister<GpuRegister>();
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       // /* HeapReference<Object> */ dst = *(obj + offset)
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         Location temp_loc =
@@ -4744,7 +4747,7 @@
 
   // Memory barriers, in the case of references, are handled in the
   // previous switch statement.
-  if (is_volatile && (type != Primitive::kPrimNot)) {
+  if (is_volatile && (type != DataType::Type::kReference)) {
     GenerateMemoryBarrier(MemBarrierKind::kLoadAny);
   }
 }
@@ -4754,7 +4757,7 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
   locations->SetInAt(0, Location::RequiresRegister());
-  if (Primitive::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
     locations->SetInAt(1, FpuRegisterOrConstantForStore(instruction->InputAt(1)));
   } else {
     locations->SetInAt(1, RegisterOrZeroConstant(instruction->InputAt(1)));
@@ -4764,7 +4767,7 @@
 void InstructionCodeGeneratorMIPS64::HandleFieldSet(HInstruction* instruction,
                                                     const FieldInfo& field_info,
                                                     bool value_can_be_null) {
-  Primitive::Type type = field_info.GetFieldType();
+  DataType::Type type = field_info.GetFieldType();
   LocationSummary* locations = instruction->GetLocations();
   GpuRegister obj = locations->InAt(0).AsRegister<GpuRegister>();
   Location value_location = locations->InAt(1);
@@ -4775,24 +4778,24 @@
   auto null_checker = GetImplicitNullChecker(instruction, codegen_);
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       store_type = kStoreByte;
       break;
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
       store_type = kStoreHalfword;
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimNot:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kReference:
       store_type = kStoreWord;
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       store_type = kStoreDoubleword;
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
@@ -4805,14 +4808,14 @@
     int64_t value = CodeGenerator::GetInt64ValueOf(value_location.GetConstant());
     __ StoreConstToOffset(store_type, value, obj, offset, TMP, null_checker);
   } else {
-    if (!Primitive::IsFloatingPointType(type)) {
+    if (!DataType::IsFloatingPointType(type)) {
       DCHECK(value_location.IsRegister());
       GpuRegister src = value_location.AsRegister<GpuRegister>();
       if (kPoisonHeapReferences && needs_write_barrier) {
         // Note that in the case where `value` is a null reference,
         // we do not enter this block, as a null reference does not
         // need poisoning.
-        DCHECK_EQ(type, Primitive::kPrimNot);
+        DCHECK_EQ(type, DataType::Type::kReference);
         __ PoisonHeapReference(TMP, src);
         __ StoreToOffset(store_type, TMP, obj, offset, null_checker);
       } else {
@@ -6247,15 +6250,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -6267,27 +6270,27 @@
 }
 
 void InstructionCodeGeneratorMIPS64::VisitMul(HMul* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
       GpuRegister lhs = locations->InAt(0).AsRegister<GpuRegister>();
       GpuRegister rhs = locations->InAt(1).AsRegister<GpuRegister>();
-      if (type == Primitive::kPrimInt)
+      if (type == DataType::Type::kInt32)
         __ MulR6(dst, lhs, rhs);
       else
         __ Dmul(dst, lhs, rhs);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
       FpuRegister lhs = locations->InAt(0).AsFpuRegister<FpuRegister>();
       FpuRegister rhs = locations->InAt(1).AsFpuRegister<FpuRegister>();
-      if (type == Primitive::kPrimFloat)
+      if (type == DataType::Type::kFloat32)
         __ MulS(dst, lhs, rhs);
       else
         __ MulD(dst, lhs, rhs);
@@ -6302,14 +6305,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -6320,25 +6323,25 @@
 }
 
 void InstructionCodeGeneratorMIPS64::VisitNeg(HNeg* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
       GpuRegister src = locations->InAt(0).AsRegister<GpuRegister>();
-      if (type == Primitive::kPrimInt)
+      if (type == DataType::Type::kInt32)
         __ Subu(dst, ZERO, src);
       else
         __ Dsubu(dst, ZERO, src);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
       FpuRegister src = locations->InAt(0).AsFpuRegister<FpuRegister>();
-      if (type == Primitive::kPrimFloat)
+      if (type == DataType::Type::kFloat32)
         __ NegS(dst, src);
       else
         __ NegD(dst, src);
@@ -6353,7 +6356,7 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
@@ -6377,7 +6380,7 @@
   } else {
     locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   }
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void InstructionCodeGeneratorMIPS64::VisitNewInstance(HNewInstance* instruction) {
@@ -6406,12 +6409,12 @@
 }
 
 void InstructionCodeGeneratorMIPS64::VisitNot(HNot* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   LocationSummary* locations = instruction->GetLocations();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
       GpuRegister src = locations->InAt(0).AsRegister<GpuRegister>();
       __ Nor(dst, src, ZERO);
@@ -6520,22 +6523,22 @@
 }
 
 void LocationsBuilderMIPS64::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   LocationSummary::CallKind call_kind =
-      Primitive::IsFloatingPointType(type) ? LocationSummary::kCallOnMainOnly
-                                           : LocationSummary::kNoCall;
+      DataType::IsFloatingPointType(type) ? LocationSummary::kCallOnMainOnly
+                                          : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(rem, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(rem->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
       locations->SetInAt(1, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(1)));
@@ -6549,19 +6552,20 @@
 }
 
 void InstructionCodeGeneratorMIPS64::VisitRem(HRem* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       GenerateDivRemIntegral(instruction);
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
-      QuickEntrypointEnum entrypoint = (type == Primitive::kPrimFloat) ? kQuickFmodf : kQuickFmod;
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
+      QuickEntrypointEnum entrypoint =
+          (type == DataType::Type::kFloat32) ? kQuickFmodf : kQuickFmod;
       codegen_->InvokeRuntime(entrypoint, instruction, instruction->GetDexPc());
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         CheckEntrypointTypes<kQuickFmodf, float, float, float>();
       } else {
         CheckEntrypointTypes<kQuickFmod, double, double, double>();
@@ -6592,7 +6596,7 @@
 
 void LocationsBuilderMIPS64::VisitReturn(HReturn* ret) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(ret);
-  Primitive::Type return_type = ret->InputAt(0)->GetType();
+  DataType::Type return_type = ret->InputAt(0)->GetType();
   locations->SetInAt(0, Mips64ReturnLocation(return_type));
 }
 
@@ -6761,24 +6765,24 @@
 }
 
 void LocationsBuilderMIPS64::VisitTypeConversion(HTypeConversion* conversion) {
-  Primitive::Type input_type = conversion->GetInputType();
-  Primitive::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
   DCHECK_NE(input_type, result_type);
 
-  if ((input_type == Primitive::kPrimNot) || (input_type == Primitive::kPrimVoid) ||
-      (result_type == Primitive::kPrimNot) || (result_type == Primitive::kPrimVoid)) {
+  if ((input_type == DataType::Type::kReference) || (input_type == DataType::Type::kVoid) ||
+      (result_type == DataType::Type::kReference) || (result_type == DataType::Type::kVoid)) {
     LOG(FATAL) << "Unexpected type conversion from " << input_type << " to " << result_type;
   }
 
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(conversion);
 
-  if (Primitive::IsFloatingPointType(input_type)) {
+  if (DataType::IsFloatingPointType(input_type)) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
   } else {
     locations->SetInAt(0, Location::RequiresRegister());
   }
 
-  if (Primitive::IsFloatingPointType(result_type)) {
+  if (DataType::IsFloatingPointType(result_type)) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -6787,21 +6791,21 @@
 
 void InstructionCodeGeneratorMIPS64::VisitTypeConversion(HTypeConversion* conversion) {
   LocationSummary* locations = conversion->GetLocations();
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
 
   DCHECK_NE(input_type, result_type);
 
-  if (Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type)) {
+  if (DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type)) {
     GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
     GpuRegister src = locations->InAt(0).AsRegister<GpuRegister>();
 
     switch (result_type) {
-      case Primitive::kPrimChar:
+      case DataType::Type::kUint16:
         __ Andi(dst, src, 0xFFFF);
         break;
-      case Primitive::kPrimByte:
-        if (input_type == Primitive::kPrimLong) {
+      case DataType::Type::kInt8:
+        if (input_type == DataType::Type::kInt64) {
           // Type conversion from long to types narrower than int is a result of code
           // transformations. To avoid unpredictable results for SEB and SEH, we first
           // need to sign-extend the low 32-bit value into bits 32 through 63.
@@ -6811,8 +6815,8 @@
           __ Seb(dst, src);
         }
         break;
-      case Primitive::kPrimShort:
-        if (input_type == Primitive::kPrimLong) {
+      case DataType::Type::kInt16:
+        if (input_type == DataType::Type::kInt64) {
           // Type conversion from long to types narrower than int is a result of code
           // transformations. To avoid unpredictable results for SEB and SEH, we first
           // need to sign-extend the low 32-bit value into bits 32 through 63.
@@ -6822,12 +6826,12 @@
           __ Seh(dst, src);
         }
         break;
-      case Primitive::kPrimInt:
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt32:
+      case DataType::Type::kInt64:
         // Sign-extend 32-bit int into bits 32 through 63 for int-to-long and long-to-int
         // conversions, except when the input and output registers are the same and we are not
         // converting longs to shorter types. In these cases, do nothing.
-        if ((input_type == Primitive::kPrimLong) || (dst != src)) {
+        if ((input_type == DataType::Type::kInt64) || (dst != src)) {
           __ Sll(dst, src, 0);
         }
         break;
@@ -6836,49 +6840,49 @@
         LOG(FATAL) << "Unexpected type conversion from " << input_type
                    << " to " << result_type;
     }
-  } else if (Primitive::IsFloatingPointType(result_type) && Primitive::IsIntegralType(input_type)) {
+  } else if (DataType::IsFloatingPointType(result_type) && DataType::IsIntegralType(input_type)) {
     FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
     GpuRegister src = locations->InAt(0).AsRegister<GpuRegister>();
-    if (input_type == Primitive::kPrimLong) {
+    if (input_type == DataType::Type::kInt64) {
       __ Dmtc1(src, FTMP);
-      if (result_type == Primitive::kPrimFloat) {
+      if (result_type == DataType::Type::kFloat32) {
         __ Cvtsl(dst, FTMP);
       } else {
         __ Cvtdl(dst, FTMP);
       }
     } else {
       __ Mtc1(src, FTMP);
-      if (result_type == Primitive::kPrimFloat) {
+      if (result_type == DataType::Type::kFloat32) {
         __ Cvtsw(dst, FTMP);
       } else {
         __ Cvtdw(dst, FTMP);
       }
     }
-  } else if (Primitive::IsIntegralType(result_type) && Primitive::IsFloatingPointType(input_type)) {
-    CHECK(result_type == Primitive::kPrimInt || result_type == Primitive::kPrimLong);
+  } else if (DataType::IsIntegralType(result_type) && DataType::IsFloatingPointType(input_type)) {
+    CHECK(result_type == DataType::Type::kInt32 || result_type == DataType::Type::kInt64);
     GpuRegister dst = locations->Out().AsRegister<GpuRegister>();
     FpuRegister src = locations->InAt(0).AsFpuRegister<FpuRegister>();
 
-    if (result_type == Primitive::kPrimLong) {
-      if (input_type == Primitive::kPrimFloat) {
+    if (result_type == DataType::Type::kInt64) {
+      if (input_type == DataType::Type::kFloat32) {
         __ TruncLS(FTMP, src);
       } else {
         __ TruncLD(FTMP, src);
       }
       __ Dmfc1(dst, FTMP);
     } else {
-      if (input_type == Primitive::kPrimFloat) {
+      if (input_type == DataType::Type::kFloat32) {
         __ TruncWS(FTMP, src);
       } else {
         __ TruncWD(FTMP, src);
       }
       __ Mfc1(dst, FTMP);
     }
-  } else if (Primitive::IsFloatingPointType(result_type) &&
-             Primitive::IsFloatingPointType(input_type)) {
+  } else if (DataType::IsFloatingPointType(result_type) &&
+             DataType::IsFloatingPointType(input_type)) {
     FpuRegister dst = locations->Out().AsFpuRegister<FpuRegister>();
     FpuRegister src = locations->InAt(0).AsFpuRegister<FpuRegister>();
-    if (result_type == Primitive::kPrimFloat) {
+    if (result_type == DataType::Type::kFloat32) {
       __ Cvtsd(dst, src);
     } else {
       __ Cvtds(dst, src);
diff --git a/compiler/optimizing/code_generator_mips64.h b/compiler/optimizing/code_generator_mips64.h
index 9fe47ee..2a95b37 100644
--- a/compiler/optimizing/code_generator_mips64.h
+++ b/compiler/optimizing/code_generator_mips64.h
@@ -79,8 +79,8 @@
   InvokeDexCallingConventionVisitorMIPS64() {}
   virtual ~InvokeDexCallingConventionVisitorMIPS64() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE;
   Location GetMethodLocation() const OVERRIDE;
 
  private:
@@ -98,7 +98,7 @@
                           kRuntimeParameterFpuRegistersLength,
                           kMips64PointerSize) {}
 
-  Location GetReturnLocation(Primitive::Type return_type);
+  Location GetReturnLocation(DataType::Type return_type);
 
  private:
   DISALLOW_COPY_AND_ASSIGN(InvokeRuntimeCallingConvention);
@@ -114,16 +114,16 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return Location::RegisterLocation(A0);
   }
-  Location GetReturnLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetReturnLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::RegisterLocation(V0);
   }
-  Location GetSetValueLocation(Primitive::Type type ATTRIBUTE_UNUSED,
+  Location GetSetValueLocation(DataType::Type type ATTRIBUTE_UNUSED,
                                bool is_instance) const OVERRIDE {
     return is_instance
         ? Location::RegisterLocation(A2)
         : Location::RegisterLocation(A1);
   }
-  Location GetFpuLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetFpuLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::FpuRegisterLocation(F0);
   }
 
@@ -306,19 +306,19 @@
                                        Mips64Label* label);
   void GenerateFpCompare(IfCondition cond,
                          bool gt_bias,
-                         Primitive::Type type,
+                         DataType::Type type,
                          LocationSummary* locations);
   // When the function returns `false` it means that the condition holds if `dst` is non-zero
   // and doesn't hold if `dst` is zero. If it returns `true`, the roles of zero and non-zero
   // `dst` are exchanged.
   bool MaterializeFpCompare(IfCondition cond,
                             bool gt_bias,
-                            Primitive::Type type,
+                            DataType::Type type,
                             LocationSummary* input_locations,
                             FpuRegister dst);
   void GenerateFpCompareAndBranch(IfCondition cond,
                                   bool gt_bias,
-                                  Primitive::Type type,
+                                  DataType::Type type,
                                   LocationSummary* locations,
                                   Mips64Label* label);
   void HandleGoto(HInstruction* got, HBasicBlock* successor);
@@ -497,14 +497,14 @@
   void Finalize(CodeAllocator* allocator) OVERRIDE;
 
   // Code generation helpers.
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
 
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
 
   void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
 
 
-  void SwapLocations(Location loc1, Location loc2, Primitive::Type type);
+  void SwapLocations(Location loc1, Location loc2, DataType::Type type);
 
   // Generate code to invoke a runtime entry point.
   void InvokeRuntime(QuickEntrypointEnum entrypoint,
@@ -522,7 +522,7 @@
 
   ParallelMoveResolver* GetMoveResolver() OVERRIDE { return &move_resolver_; }
 
-  bool NeedsTwoRegisters(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE { return false; }
+  bool NeedsTwoRegisters(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE { return false; }
 
   // Check if the desired_string_load_kind is supported. If it is, return it,
   // otherwise return a fall-back kind that should be used instead.
@@ -546,7 +546,7 @@
       HInvokeVirtual* invoke, Location temp, SlowPathCode* slow_path = nullptr) OVERRIDE;
 
   void MoveFromReturnRegister(Location trg ATTRIBUTE_UNUSED,
-                              Primitive::Type type ATTRIBUTE_UNUSED) OVERRIDE {
+                              DataType::Type type ATTRIBUTE_UNUSED) OVERRIDE {
     UNIMPLEMENTED(FATAL) << "Not implemented on MIPS64";
   }
 
diff --git a/compiler/optimizing/code_generator_vector_arm64.cc b/compiler/optimizing/code_generator_vector_arm64.cc
index 3f576c8..5d5623b 100644
--- a/compiler/optimizing/code_generator_vector_arm64.cc
+++ b/compiler/optimizing/code_generator_vector_arm64.cc
@@ -41,17 +41,17 @@
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   HInstruction* input = instruction->InputAt(0);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, ARM64EncodableConstantOrRegister(input, instruction));
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       if (input->IsConstant() &&
           Arm64CanEncodeConstantAsImmediate(input->AsConstant(), instruction)) {
         locations->SetInAt(0, Location::ConstantLocation(input->AsConstant()));
@@ -72,8 +72,8 @@
   Location src_loc = locations->InAt(0);
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Movi(dst.V16B(), Int64ConstantFrom(src_loc));
@@ -81,8 +81,8 @@
         __ Dup(dst.V16B(), InputRegisterAt(instruction, 0));
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Movi(dst.V8H(), Int64ConstantFrom(src_loc));
@@ -90,7 +90,7 @@
         __ Dup(dst.V8H(), InputRegisterAt(instruction, 0));
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Movi(dst.V4S(), Int64ConstantFrom(src_loc));
@@ -98,7 +98,7 @@
         __ Dup(dst.V4S(), InputRegisterAt(instruction, 0));
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Movi(dst.V2D(), Int64ConstantFrom(src_loc));
@@ -106,7 +106,7 @@
         __ Dup(dst.V2D(), XRegisterFrom(src_loc));
       }
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Fmov(dst.V4S(), src_loc.GetConstant()->AsFloatConstant()->GetValue());
@@ -114,7 +114,7 @@
         __ Dup(dst.V4S(), VRegisterFrom(src_loc).V4S(), 0);
       }
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (src_loc.IsConstant()) {
         __ Fmov(dst.V2D(), src_loc.GetConstant()->AsDoubleConstant()->GetValue());
@@ -131,17 +131,17 @@
 void LocationsBuilderARM64::VisitVecExtractScalar(HVecExtractScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       break;
@@ -155,16 +155,16 @@
   LocationSummary* locations = instruction->GetLocations();
   VRegister src = VRegisterFrom(locations->InAt(0));
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Umov(OutputRegister(instruction), src.V4S(), 0);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Umov(OutputRegister(instruction), src.V2D(), 0);
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 4u);
       DCHECK(locations->InAt(0).Equals(locations->Out()));  // no code required
@@ -179,19 +179,19 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         instruction->IsVecNot() ? Location::kOutputOverlap
                                                 : Location::kNoOutputOverlap);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -210,7 +210,7 @@
   VRegister src = VRegisterFrom(locations->InAt(0));
   VRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       switch (instruction->GetKind()) {
         case HVecReduce::kSum:
@@ -224,7 +224,7 @@
           break;
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       switch (instruction->GetKind()) {
         case HVecReduce::kSum:
@@ -249,9 +249,9 @@
   LocationSummary* locations = instruction->GetLocations();
   VRegister src = VRegisterFrom(locations->InAt(0));
   VRegister dst = VRegisterFrom(locations->Out());
-  Primitive::Type from = instruction->GetInputType();
-  Primitive::Type to = instruction->GetResultType();
-  if (from == Primitive::kPrimInt && to == Primitive::kPrimFloat) {
+  DataType::Type from = instruction->GetInputType();
+  DataType::Type to = instruction->GetResultType();
+  if (from == DataType::Type::kInt32 && to == DataType::Type::kFloat32) {
     DCHECK_EQ(4u, instruction->GetVectorLength());
     __ Scvtf(dst.V4S(), src.V4S());
   } else {
@@ -268,28 +268,28 @@
   VRegister src = VRegisterFrom(locations->InAt(0));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Neg(dst.V16B(), src.V16B());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Neg(dst.V8H(), src.V8H());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Neg(dst.V4S(), src.V4S());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Neg(dst.V2D(), src.V2D());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fneg(dst.V4S(), src.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fneg(dst.V2D(), src.V2D());
       break;
@@ -308,28 +308,28 @@
   VRegister src = VRegisterFrom(locations->InAt(0));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Abs(dst.V16B(), src.V16B());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Abs(dst.V8H(), src.V8H());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Abs(dst.V4S(), src.V4S());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Abs(dst.V2D(), src.V2D());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fabs(dst.V4S(), src.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fabs(dst.V2D(), src.V2D());
       break;
@@ -348,16 +348,16 @@
   VRegister src = VRegisterFrom(locations->InAt(0));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:  // special case boolean-not
+    case DataType::Type::kBool:  // special case boolean-not
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Movi(dst.V16B(), 1);
       __ Eor(dst.V16B(), dst.V16B(), src.V16B());
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       __ Not(dst.V16B(), src.V16B());  // lanes do not matter
       break;
     default:
@@ -370,14 +370,14 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -398,28 +398,28 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Add(dst.V16B(), lhs.V16B(), rhs.V16B());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Add(dst.V8H(), lhs.V8H(), rhs.V8H());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Add(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Add(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fadd(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fadd(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
@@ -439,7 +439,7 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -451,8 +451,8 @@
             : __ Shadd(dst.V16B(), lhs.V16B(), rhs.V16B());
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -480,28 +480,28 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Sub(dst.V16B(), lhs.V16B(), rhs.V16B());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Sub(dst.V8H(), lhs.V8H(), rhs.V8H());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Sub(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Sub(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fsub(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fsub(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
@@ -521,24 +521,24 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Mul(dst.V16B(), lhs.V16B(), rhs.V16B());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Mul(dst.V8H(), lhs.V8H(), rhs.V8H());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Mul(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fmul(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fmul(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
@@ -558,11 +558,11 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Fdiv(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Fdiv(dst.V2D(), lhs.V2D(), rhs.V2D());
       break;
@@ -582,7 +582,7 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umin(dst.V16B(), lhs.V16B(), rhs.V16B());
@@ -590,8 +590,8 @@
         __ Smin(dst.V16B(), lhs.V16B(), rhs.V16B());
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umin(dst.V8H(), lhs.V8H(), rhs.V8H());
@@ -599,7 +599,7 @@
         __ Smin(dst.V8H(), lhs.V8H(), rhs.V8H());
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umin(dst.V4S(), lhs.V4S(), rhs.V4S());
@@ -607,12 +607,12 @@
         __ Smin(dst.V4S(), lhs.V4S(), rhs.V4S());
       }
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ Fmin(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ Fmin(dst.V2D(), lhs.V2D(), rhs.V2D());
@@ -633,7 +633,7 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umax(dst.V16B(), lhs.V16B(), rhs.V16B());
@@ -641,8 +641,8 @@
         __ Smax(dst.V16B(), lhs.V16B(), rhs.V16B());
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umax(dst.V8H(), lhs.V8H(), rhs.V8H());
@@ -650,7 +650,7 @@
         __ Smax(dst.V8H(), lhs.V8H(), rhs.V8H());
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Umax(dst.V4S(), lhs.V4S(), rhs.V4S());
@@ -658,12 +658,12 @@
         __ Smax(dst.V4S(), lhs.V4S(), rhs.V4S());
       }
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ Fmax(dst.V4S(), lhs.V4S(), rhs.V4S());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ Fmax(dst.V2D(), lhs.V2D(), rhs.V2D());
@@ -684,14 +684,14 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ And(dst.V16B(), lhs.V16B(), rhs.V16B());  // lanes do not matter
       break;
     default:
@@ -718,14 +718,14 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Orr(dst.V16B(), lhs.V16B(), rhs.V16B());  // lanes do not matter
       break;
     default:
@@ -744,14 +744,14 @@
   VRegister rhs = VRegisterFrom(locations->InAt(1));
   VRegister dst = VRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       __ Eor(dst.V16B(), lhs.V16B(), rhs.V16B());  // lanes do not matter
       break;
     default:
@@ -764,11 +764,11 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -789,20 +789,20 @@
   VRegister dst = VRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Shl(dst.V16B(), lhs.V16B(), value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Shl(dst.V8H(), lhs.V8H(), value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Shl(dst.V4S(), lhs.V4S(), value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Shl(dst.V2D(), lhs.V2D(), value);
       break;
@@ -822,20 +822,20 @@
   VRegister dst = VRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Sshr(dst.V16B(), lhs.V16B(), value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Sshr(dst.V8H(), lhs.V8H(), value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Sshr(dst.V4S(), lhs.V4S(), value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Sshr(dst.V2D(), lhs.V2D(), value);
       break;
@@ -855,20 +855,20 @@
   VRegister dst = VRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Ushr(dst.V16B(), lhs.V16B(), value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Ushr(dst.V8H(), lhs.V8H(), value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Ushr(dst.V4S(), lhs.V4S(), value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Ushr(dst.V2D(), lhs.V2D(), value);
       break;
@@ -887,18 +887,18 @@
   bool is_zero = IsZeroBitPattern(input);
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister());
@@ -925,21 +925,21 @@
 
   // Set required elements.
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ Mov(dst.V16B(), 0, InputRegisterAt(instruction, 0));
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Mov(dst.V8H(), 0, InputRegisterAt(instruction, 0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Mov(dst.V4S(), 0, InputRegisterAt(instruction, 0));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Mov(dst.V2D(), 0, InputRegisterAt(instruction, 0));
       break;
@@ -953,11 +953,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -985,7 +985,7 @@
   DCHECK(locations->InAt(0).Equals(locations->Out()));
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ Mla(acc.V16B(), left.V16B(), right.V16B());
@@ -993,8 +993,8 @@
         __ Mls(acc.V16B(), left.V16B(), right.V16B());
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ Mla(acc.V8H(), left.V8H(), right.V8H());
@@ -1002,7 +1002,7 @@
         __ Mls(acc.V8H(), left.V8H(), right.V8H());
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ Mla(acc.V4S(), left.V4S(), right.V4S());
@@ -1024,13 +1024,13 @@
   HVecOperation* b = instruction->InputAt(2)->AsVecOperation();
   DCHECK_EQ(a->GetPackedType(), b->GetPackedType());
   switch (a->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (instruction->GetPackedType()) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           locations->AddTemp(Location::RequiresFpuRegister());
           locations->AddTemp(Location::RequiresFpuRegister());
           FALLTHROUGH_INTENDED;
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           locations->AddTemp(Location::RequiresFpuRegister());
           locations->AddTemp(Location::RequiresFpuRegister());
           break;
@@ -1038,15 +1038,15 @@
           break;
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-      if (instruction->GetPackedType() == Primitive::kPrimLong) {
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+      if (instruction->GetPackedType() == DataType::Type::kInt64) {
         locations->AddTemp(Location::RequiresFpuRegister());
         locations->AddTemp(Location::RequiresFpuRegister());
       }
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       if (instruction->GetPackedType() == a->GetPackedType()) {
         locations->AddTemp(Location::RequiresFpuRegister());
       }
@@ -1069,16 +1069,16 @@
   HVecOperation* b = instruction->InputAt(2)->AsVecOperation();
   DCHECK_EQ(a->GetPackedType(), b->GetPackedType());
   switch (a->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, a->GetVectorLength());
       switch (instruction->GetPackedType()) {
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
           DCHECK_EQ(8u, instruction->GetVectorLength());
           __ Sabal(acc.V8H(), left.V8B(), right.V8B());
           __ Sabal2(acc.V8H(), left.V16B(), right.V16B());
           break;
-        case Primitive::kPrimInt: {
+        case DataType::Type::kInt32: {
           DCHECK_EQ(4u, instruction->GetVectorLength());
           VRegister tmp1 = VRegisterFrom(locations->GetTemp(0));
           VRegister tmp2 = VRegisterFrom(locations->GetTemp(1));
@@ -1092,7 +1092,7 @@
           __ Sabal2(acc.V4S(), tmp1.V8H(), tmp2.V8H());
           break;
         }
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           DCHECK_EQ(2u, instruction->GetVectorLength());
           VRegister tmp1 = VRegisterFrom(locations->GetTemp(0));
           VRegister tmp2 = VRegisterFrom(locations->GetTemp(1));
@@ -1125,16 +1125,16 @@
           UNREACHABLE();
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, a->GetVectorLength());
       switch (instruction->GetPackedType()) {
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           DCHECK_EQ(4u, instruction->GetVectorLength());
           __ Sabal(acc.V4S(), left.V4H(), right.V4H());
           __ Sabal2(acc.V4S(), left.V8H(), right.V8H());
           break;
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           DCHECK_EQ(2u, instruction->GetVectorLength());
           VRegister tmp1 = VRegisterFrom(locations->GetTemp(0));
           VRegister tmp2 = VRegisterFrom(locations->GetTemp(1));
@@ -1153,10 +1153,10 @@
           UNREACHABLE();
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, a->GetVectorLength());
       switch (instruction->GetPackedType()) {
-        case Primitive::kPrimInt: {
+        case DataType::Type::kInt32: {
           DCHECK_EQ(4u, instruction->GetVectorLength());
           VRegister tmp = VRegisterFrom(locations->GetTemp(0));
           __ Sub(tmp.V4S(), left.V4S(), right.V4S());
@@ -1164,7 +1164,7 @@
           __ Add(acc.V4S(), acc.V4S(), tmp.V4S());
           break;
         }
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           DCHECK_EQ(2u, instruction->GetVectorLength());
           __ Sabal(acc.V2D(), left.V2S(), right.V2S());
           __ Sabal2(acc.V2D(), left.V4S(), right.V4S());
@@ -1174,10 +1174,10 @@
           UNREACHABLE();
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, a->GetVectorLength());
       switch (instruction->GetPackedType()) {
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           DCHECK_EQ(2u, instruction->GetVectorLength());
           VRegister tmp = VRegisterFrom(locations->GetTemp(0));
           __ Sub(tmp.V2D(), left.V2D(), right.V2D());
@@ -1201,14 +1201,14 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -1265,13 +1265,13 @@
 
 void InstructionCodeGeneratorARM64::VisitVecLoad(HVecLoad* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VRegister reg = VRegisterFrom(locations->Out());
   UseScratchRegisterScope temps(GetVIXLAssembler());
   Register scratch;
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       // Special handling of compressed/uncompressed string load.
       if (mirror::kUseStringCompression && instruction->IsStringCharAt()) {
@@ -1299,13 +1299,13 @@
         return;
       }
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ Ldr(reg, VecAddress(instruction, &temps, size, instruction->IsStringCharAt(), &scratch));
@@ -1322,20 +1322,20 @@
 
 void InstructionCodeGeneratorARM64::VisitVecStore(HVecStore* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VRegister reg = VRegisterFrom(locations->InAt(2));
   UseScratchRegisterScope temps(GetVIXLAssembler());
   Register scratch;
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ Str(reg, VecAddress(instruction, &temps, size, /*is_string_char_at*/ false, &scratch));
diff --git a/compiler/optimizing/code_generator_vector_arm_vixl.cc b/compiler/optimizing/code_generator_vector_arm_vixl.cc
index 069054c..333d108 100644
--- a/compiler/optimizing/code_generator_vector_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_vector_arm_vixl.cc
@@ -35,11 +35,11 @@
 void LocationsBuilderARMVIXL::VisitVecReplicateScalar(HVecReplicateScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
@@ -53,17 +53,17 @@
   LocationSummary* locations = instruction->GetLocations();
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vdup(Untyped8, dst, InputRegisterAt(instruction, 0));
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vdup(Untyped16, dst, InputRegisterAt(instruction, 0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vdup(Untyped32, dst, InputRegisterAt(instruction, 0));
       break;
@@ -85,16 +85,16 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         instruction->IsVecNot() ? Location::kOutputOverlap
                                                 : Location::kNoOutputOverlap);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -129,16 +129,16 @@
   vixl32::DRegister src = DRegisterFrom(locations->InAt(0));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vneg(DataTypeValue::S8, dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vneg(DataTypeValue::S16, dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vneg(DataTypeValue::S32, dst, src);
       break;
@@ -157,16 +157,16 @@
   vixl32::DRegister src = DRegisterFrom(locations->InAt(0));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vabs(DataTypeValue::S8, dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vabs(DataTypeValue::S16, dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vabs(DataTypeValue::S32, dst, src);
       break;
@@ -185,15 +185,15 @@
   vixl32::DRegister src = DRegisterFrom(locations->InAt(0));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:  // special case boolean-not
+    case DataType::Type::kBool:  // special case boolean-not
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vmov(I8, dst, 1);
       __ Veor(dst, dst, src);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       __ Vmvn(I8, dst, src);  // lanes do not matter
       break;
     default:
@@ -206,11 +206,11 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -231,16 +231,16 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vadd(I8, dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vadd(I16, dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vadd(I32, dst, lhs, rhs);
       break;
@@ -260,7 +260,7 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -272,8 +272,8 @@
             : __ Vhadd(DataTypeValue::S8, dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -301,16 +301,16 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vsub(I8, dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vsub(I16, dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vsub(I32, dst, lhs, rhs);
       break;
@@ -330,16 +330,16 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vmul(I8, dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vmul(I16, dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vmul(I32, dst, lhs, rhs);
       break;
@@ -367,7 +367,7 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmin(DataTypeValue::U8, dst, lhs, rhs);
@@ -375,8 +375,8 @@
         __ Vmin(DataTypeValue::S8, dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmin(DataTypeValue::U16, dst, lhs, rhs);
@@ -384,7 +384,7 @@
         __ Vmin(DataTypeValue::S16, dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmin(DataTypeValue::U32, dst, lhs, rhs);
@@ -408,7 +408,7 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmax(DataTypeValue::U8, dst, lhs, rhs);
@@ -416,8 +416,8 @@
         __ Vmax(DataTypeValue::S8, dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmax(DataTypeValue::U16, dst, lhs, rhs);
@@ -425,7 +425,7 @@
         __ Vmax(DataTypeValue::S16, dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Vmax(DataTypeValue::U32, dst, lhs, rhs);
@@ -449,11 +449,11 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       __ Vand(I8, dst, lhs, rhs);
       break;
     default:
@@ -480,11 +480,11 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       __ Vorr(I8, dst, lhs, rhs);
       break;
     default:
@@ -503,11 +503,11 @@
   vixl32::DRegister rhs = DRegisterFrom(locations->InAt(1));
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       __ Veor(I8, dst, lhs, rhs);
       break;
     default:
@@ -520,10 +520,10 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -544,16 +544,16 @@
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vshl(I8, dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vshl(I16, dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vshl(I32, dst, lhs, value);
       break;
@@ -573,16 +573,16 @@
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::S8, dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::S16, dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::S32, dst, lhs, value);
       break;
@@ -602,16 +602,16 @@
   vixl32::DRegister dst = DRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::U8, dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::U16, dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Vshr(DataTypeValue::U32, dst, lhs, value);
       break;
@@ -633,11 +633,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -677,11 +677,11 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -707,7 +707,7 @@
   vixl32::Register base = InputRegisterAt(instruction, 0);
 
   Location index = locations->InAt(1);
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   uint32_t offset = mirror::Array::DataOffset(size).Uint32Value();
   size_t shift = ComponentSizeShiftWidth(size);
 
@@ -733,7 +733,7 @@
   vixl32::Register base = InputRegisterAt(instruction, 0);
 
   Location index = locations->InAt(1);
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   uint32_t offset = mirror::Array::DataOffset(size).Uint32Value();
   size_t shift = ComponentSizeShiftWidth(size);
 
@@ -760,11 +760,11 @@
   UseScratchRegisterScope temps(GetVIXLAssembler());
   vixl32::Register scratch;
 
-  DCHECK(instruction->GetPackedType() != Primitive::kPrimChar || !instruction->IsStringCharAt());
+  DCHECK(instruction->GetPackedType() != DataType::Type::kUint16 || !instruction->IsStringCharAt());
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vldr(reg, VecAddress(instruction, &temps, &scratch));
@@ -774,8 +774,8 @@
             VecAddressUnaligned(instruction, &temps, &scratch));
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vldr(reg, VecAddress(instruction, &temps, &scratch));
@@ -785,7 +785,7 @@
             VecAddressUnaligned(instruction, &temps, &scratch));
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vldr(reg, VecAddress(instruction, &temps, &scratch));
@@ -810,8 +810,8 @@
   UseScratchRegisterScope temps(GetVIXLAssembler());
   vixl32::Register scratch;
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vstr(reg, VecAddress(instruction, &temps, &scratch));
@@ -821,8 +821,8 @@
                 VecAddressUnaligned(instruction, &temps, &scratch));
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vstr(reg, VecAddress(instruction, &temps, &scratch));
@@ -832,7 +832,7 @@
                 VecAddressUnaligned(instruction, &temps, &scratch));
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (IsWordAligned(instruction)) {
         __ Vstr(reg, VecAddress(instruction, &temps, &scratch));
diff --git a/compiler/optimizing/code_generator_vector_mips.cc b/compiler/optimizing/code_generator_vector_mips.cc
index 0bedafc..c25f5ac 100644
--- a/compiler/optimizing/code_generator_vector_mips.cc
+++ b/compiler/optimizing/code_generator_vector_mips.cc
@@ -26,17 +26,17 @@
 void LocationsBuilderMIPS::VisitVecReplicateScalar(HVecReplicateScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -50,33 +50,33 @@
   LocationSummary* locations = instruction->GetLocations();
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, locations->InAt(0).AsRegister<Register>());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, locations->InAt(0).AsRegister<Register>());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, locations->InAt(0).AsRegister<Register>());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ Mtc1(locations->InAt(0).AsRegisterPairLow<Register>(), FTMP);
       __ MoveToFpuHigh(locations->InAt(0).AsRegisterPairHigh<Register>(), FTMP);
       __ ReplicateFPToVectorRegister(dst, FTMP, /* is_double */ true);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ ReplicateFPToVectorRegister(dst,
                                      locations->InAt(0).AsFpuRegister<FRegister>(),
                                      /* is_double */ false);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ ReplicateFPToVectorRegister(dst,
                                      locations->InAt(0).AsFpuRegister<FRegister>(),
@@ -100,19 +100,19 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         instruction->IsVecNot() ? Location::kOutputOverlap
                                                 : Location::kNoOutputOverlap);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         (instruction->IsVecNeg() || instruction->IsVecAbs())
@@ -141,9 +141,9 @@
   LocationSummary* locations = instruction->GetLocations();
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
-  Primitive::Type from = instruction->GetInputType();
-  Primitive::Type to = instruction->GetResultType();
-  if (from == Primitive::kPrimInt && to == Primitive::kPrimFloat) {
+  DataType::Type from = instruction->GetInputType();
+  DataType::Type to = instruction->GetResultType();
+  if (from == DataType::Type::kInt32 && to == DataType::Type::kFloat32) {
     DCHECK_EQ(4u, instruction->GetVectorLength());
     __ Ffint_sW(dst, src);
   } else {
@@ -160,33 +160,33 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, ZERO);
       __ SubvB(dst, dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, ZERO);
       __ SubvH(dst, dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ SubvW(dst, dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ SubvD(dst, dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ FsubW(dst, dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ FsubD(dst, dst, src);
@@ -206,34 +206,34 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, ZERO);       // all zeroes
       __ Add_aB(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, ZERO);       // all zeroes
       __ Add_aH(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);       // all zeroes
       __ Add_aW(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);       // all zeroes
       __ Add_aD(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ LdiW(dst, -1);          // all ones
       __ SrliW(dst, dst, 1);
       __ AndV(dst, dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ LdiD(dst, -1);          // all ones
       __ SrliD(dst, dst, 1);
@@ -254,18 +254,18 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:  // special case boolean-not
+    case DataType::Type::kBool:  // special case boolean-not
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ LdiB(dst, 1);
       __ XorV(dst, dst, src);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ NorV(dst, src, src);  // lanes do not matter
@@ -280,14 +280,14 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -308,28 +308,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ AddvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ AddvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ AddvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ AddvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FaddW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FaddD(dst, lhs, rhs);
       break;
@@ -349,7 +349,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -361,8 +361,8 @@
             : __ Ave_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -390,28 +390,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SubvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SubvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SubvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SubvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FsubW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FsubD(dst, lhs, rhs);
       break;
@@ -431,28 +431,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ MulvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ MulvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ MulvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ MulvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FmulW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FmulD(dst, lhs, rhs);
       break;
@@ -472,11 +472,11 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FdivW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FdivD(dst, lhs, rhs);
       break;
@@ -496,7 +496,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uB(dst, lhs, rhs);
@@ -504,8 +504,8 @@
         __ Min_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uH(dst, lhs, rhs);
@@ -513,7 +513,7 @@
         __ Min_sH(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uW(dst, lhs, rhs);
@@ -521,7 +521,7 @@
         __ Min_sW(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uD(dst, lhs, rhs);
@@ -531,12 +531,12 @@
       break;
     // When one of arguments is NaN, fmin.df returns other argument, but Java expects a NaN value.
     // TODO: Fix min(x, NaN) cases for float and double.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FminW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FminD(dst, lhs, rhs);
@@ -557,7 +557,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uB(dst, lhs, rhs);
@@ -565,8 +565,8 @@
         __ Max_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uH(dst, lhs, rhs);
@@ -574,7 +574,7 @@
         __ Max_sH(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uW(dst, lhs, rhs);
@@ -582,7 +582,7 @@
         __ Max_sW(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uD(dst, lhs, rhs);
@@ -592,12 +592,12 @@
       break;
     // When one of arguments is NaN, fmax.df returns other argument, but Java expects a NaN value.
     // TODO: Fix max(x, NaN) cases for float and double.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FmaxW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FmaxD(dst, lhs, rhs);
@@ -618,14 +618,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ AndV(dst, lhs, rhs);  // lanes do not matter
@@ -654,14 +654,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ OrV(dst, lhs, rhs);  // lanes do not matter
@@ -682,14 +682,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ XorV(dst, lhs, rhs);  // lanes do not matter
@@ -704,11 +704,11 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -729,20 +729,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SlliB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SlliH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SlliW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SlliD(dst, lhs, value);
       break;
@@ -762,20 +762,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SraiB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SraiH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SraiW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SraiD(dst, lhs, value);
       break;
@@ -795,20 +795,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SrliB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SrliH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SrliW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SrliD(dst, lhs, value);
       break;
@@ -830,11 +830,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -856,7 +856,7 @@
   VectorRegister left = VectorRegisterFrom(locations->InAt(1));
   VectorRegister right = VectorRegisterFrom(locations->InAt(2));
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvB(acc, left, right);
@@ -864,8 +864,8 @@
         __ MsubvB(acc, left, right);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvH(acc, left, right);
@@ -873,7 +873,7 @@
         __ MsubvH(acc, left, right);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvW(acc, left, right);
@@ -881,7 +881,7 @@
         __ MsubvW(acc, left, right);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvD(acc, left, right);
@@ -910,14 +910,14 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -970,18 +970,18 @@
 
 void InstructionCodeGeneratorMIPS::VisitVecLoad(HVecLoad* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VectorRegister reg = VectorRegisterFrom(locations->Out());
   Register base;
   int32_t offset = VecAddress(locations, size, &base);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ LdB(reg, base, offset);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       // Loading 8-bytes (needed if dealing with compressed strings in StringCharAt) from unaligned
       // memory address may cause a trap to the kernel if the CPU doesn't directly support unaligned
       // loads and stores.
@@ -990,13 +990,13 @@
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ LdH(reg, base, offset);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ LdW(reg, base, offset);
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ LdD(reg, base, offset);
       break;
@@ -1012,28 +1012,28 @@
 
 void InstructionCodeGeneratorMIPS::VisitVecStore(HVecStore* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VectorRegister reg = VectorRegisterFrom(locations->InAt(2));
   Register base;
   int32_t offset = VecAddress(locations, size, &base);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ StB(reg, base, offset);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ StH(reg, base, offset);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ StW(reg, base, offset);
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ StD(reg, base, offset);
       break;
diff --git a/compiler/optimizing/code_generator_vector_mips64.cc b/compiler/optimizing/code_generator_vector_mips64.cc
index db31bdc..f60f708 100644
--- a/compiler/optimizing/code_generator_vector_mips64.cc
+++ b/compiler/optimizing/code_generator_vector_mips64.cc
@@ -31,17 +31,17 @@
 void LocationsBuilderMIPS64::VisitVecReplicateScalar(HVecReplicateScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
       break;
@@ -55,31 +55,31 @@
   LocationSummary* locations = instruction->GetLocations();
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, locations->InAt(0).AsRegister<GpuRegister>());
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, locations->InAt(0).AsRegister<GpuRegister>());
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, locations->InAt(0).AsRegister<GpuRegister>());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillD(dst, locations->InAt(0).AsRegister<GpuRegister>());
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ ReplicateFPToVectorRegister(dst,
                                      locations->InAt(0).AsFpuRegister<FpuRegister>(),
                                      /* is_double */ false);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ ReplicateFPToVectorRegister(dst,
                                      locations->InAt(0).AsFpuRegister<FpuRegister>(),
@@ -103,19 +103,19 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
+    case DataType::Type::kBool:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         instruction->IsVecNot() ? Location::kOutputOverlap
                                                 : Location::kNoOutputOverlap);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(),
                         (instruction->IsVecNeg() || instruction->IsVecAbs())
@@ -144,9 +144,9 @@
   LocationSummary* locations = instruction->GetLocations();
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
-  Primitive::Type from = instruction->GetInputType();
-  Primitive::Type to = instruction->GetResultType();
-  if (from == Primitive::kPrimInt && to == Primitive::kPrimFloat) {
+  DataType::Type from = instruction->GetInputType();
+  DataType::Type to = instruction->GetResultType();
+  if (from == DataType::Type::kInt32 && to == DataType::Type::kFloat32) {
     DCHECK_EQ(4u, instruction->GetVectorLength());
     __ Ffint_sW(dst, src);
   } else {
@@ -164,33 +164,33 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, ZERO);
       __ SubvB(dst, dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, ZERO);
       __ SubvH(dst, dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ SubvW(dst, dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillD(dst, ZERO);
       __ SubvD(dst, dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);
       __ FsubW(dst, dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillD(dst, ZERO);
       __ FsubD(dst, dst, src);
@@ -210,34 +210,34 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ FillB(dst, ZERO);       // all zeroes
       __ Add_aB(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ FillH(dst, ZERO);       // all zeroes
       __ Add_aH(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FillW(dst, ZERO);       // all zeroes
       __ Add_aW(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FillD(dst, ZERO);       // all zeroes
       __ Add_aD(dst, dst, src);  // dst = abs(0) + abs(src)
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ LdiW(dst, -1);          // all ones
       __ SrliW(dst, dst, 1);
       __ AndV(dst, dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ LdiD(dst, -1);          // all ones
       __ SrliD(dst, dst, 1);
@@ -258,18 +258,18 @@
   VectorRegister src = VectorRegisterFrom(locations->InAt(0));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:  // special case boolean-not
+    case DataType::Type::kBool:  // special case boolean-not
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ LdiB(dst, 1);
       __ XorV(dst, dst, src);
       break;
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ NorV(dst, src, src);  // lanes do not matter
@@ -284,14 +284,14 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -312,28 +312,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ AddvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ AddvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ AddvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ AddvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FaddW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FaddD(dst, lhs, rhs);
       break;
@@ -353,7 +353,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -365,8 +365,8 @@
             : __ Ave_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         instruction->IsRounded()
@@ -394,28 +394,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SubvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SubvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SubvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SubvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FsubW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FsubD(dst, lhs, rhs);
       break;
@@ -435,28 +435,28 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ MulvB(dst, lhs, rhs);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ MulvH(dst, lhs, rhs);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ MulvW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ MulvD(dst, lhs, rhs);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FmulW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FmulD(dst, lhs, rhs);
       break;
@@ -476,11 +476,11 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ FdivW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ FdivD(dst, lhs, rhs);
       break;
@@ -500,7 +500,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uB(dst, lhs, rhs);
@@ -508,8 +508,8 @@
         __ Min_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uH(dst, lhs, rhs);
@@ -517,7 +517,7 @@
         __ Min_sH(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uW(dst, lhs, rhs);
@@ -525,7 +525,7 @@
         __ Min_sW(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Min_uD(dst, lhs, rhs);
@@ -535,12 +535,12 @@
       break;
     // When one of arguments is NaN, fmin.df returns other argument, but Java expects a NaN value.
     // TODO: Fix min(x, NaN) cases for float and double.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FminW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FminD(dst, lhs, rhs);
@@ -561,7 +561,7 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uB(dst, lhs, rhs);
@@ -569,8 +569,8 @@
         __ Max_sB(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uH(dst, lhs, rhs);
@@ -578,7 +578,7 @@
         __ Max_sH(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uW(dst, lhs, rhs);
@@ -586,7 +586,7 @@
         __ Max_sW(dst, lhs, rhs);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ Max_uD(dst, lhs, rhs);
@@ -596,12 +596,12 @@
       break;
     // When one of arguments is NaN, fmax.df returns other argument, but Java expects a NaN value.
     // TODO: Fix max(x, NaN) cases for float and double.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FmaxW(dst, lhs, rhs);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ FmaxD(dst, lhs, rhs);
@@ -622,14 +622,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ AndV(dst, lhs, rhs);  // lanes do not matter
@@ -658,14 +658,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ OrV(dst, lhs, rhs);  // lanes do not matter
@@ -686,14 +686,14 @@
   VectorRegister rhs = VectorRegisterFrom(locations->InAt(1));
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ XorV(dst, lhs, rhs);  // lanes do not matter
@@ -708,11 +708,11 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -733,20 +733,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SlliB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SlliH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SlliW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SlliD(dst, lhs, value);
       break;
@@ -766,20 +766,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SraiB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SraiH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SraiW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SraiD(dst, lhs, value);
       break;
@@ -799,20 +799,20 @@
   VectorRegister dst = VectorRegisterFrom(locations->Out());
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ SrliB(dst, lhs, value);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ SrliH(dst, lhs, value);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ SrliW(dst, lhs, value);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ SrliD(dst, lhs, value);
       break;
@@ -834,11 +834,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -860,7 +860,7 @@
   VectorRegister left = VectorRegisterFrom(locations->InAt(1));
   VectorRegister right = VectorRegisterFrom(locations->InAt(2));
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvB(acc, left, right);
@@ -868,8 +868,8 @@
         __ MsubvB(acc, left, right);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvH(acc, left, right);
@@ -877,7 +877,7 @@
         __ MsubvH(acc, left, right);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvW(acc, left, right);
@@ -885,7 +885,7 @@
         __ MsubvW(acc, left, right);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       if (instruction->GetOpKind() == HInstruction::kAdd) {
         __ MaddvD(acc, left, right);
@@ -914,14 +914,14 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -974,18 +974,18 @@
 
 void InstructionCodeGeneratorMIPS64::VisitVecLoad(HVecLoad* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VectorRegister reg = VectorRegisterFrom(locations->Out());
   GpuRegister base;
   int32_t offset = VecAddress(locations, size, &base);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ LdB(reg, base, offset);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       // Loading 8-bytes (needed if dealing with compressed strings in StringCharAt) from unaligned
       // memory address may cause a trap to the kernel if the CPU doesn't directly support unaligned
       // loads and stores.
@@ -994,13 +994,13 @@
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ LdH(reg, base, offset);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ LdW(reg, base, offset);
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ LdD(reg, base, offset);
       break;
@@ -1016,28 +1016,28 @@
 
 void InstructionCodeGeneratorMIPS64::VisitVecStore(HVecStore* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   VectorRegister reg = VectorRegisterFrom(locations->InAt(2));
   GpuRegister base;
   int32_t offset = VecAddress(locations, size, &base);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ StB(reg, base, offset);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ StH(reg, base, offset);
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kInt32:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ StW(reg, base, offset);
       break;
-    case Primitive::kPrimLong:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ StD(reg, base, offset);
       break;
diff --git a/compiler/optimizing/code_generator_vector_x86.cc b/compiler/optimizing/code_generator_vector_x86.cc
index 5a012e7..6515dbe 100644
--- a/compiler/optimizing/code_generator_vector_x86.cc
+++ b/compiler/optimizing/code_generator_vector_x86.cc
@@ -30,23 +30,23 @@
   HInstruction* input = instruction->InputAt(0);
   bool is_zero = IsZeroBitPattern(input);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // Long needs extra temporary to load from the register pair.
       if (!is_zero) {
         locations->AddTemp(Location::RequiresFpuRegister());
       }
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresFpuRegister());
       locations->SetOut(is_zero ? Location::RequiresFpuRegister()
@@ -69,27 +69,27 @@
   }
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<Register>());
       __ punpcklbw(dst, dst);
       __ punpcklwd(dst, dst);
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<Register>());
       __ punpcklwd(dst, dst);
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<Register>());
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegisterPairLow<Register>());
@@ -98,12 +98,12 @@
       __ punpcklqdq(dst, dst);
       break;
     }
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK(locations->InAt(0).Equals(locations->Out()));
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ shufps(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK(locations->InAt(0).Equals(locations->Out()));
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ shufpd(dst, dst, Immediate(0));
@@ -117,20 +117,20 @@
 void LocationsBuilderX86::VisitVecExtractScalar(HVecExtractScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // Long needs extra temporary to store into the register pair.
       locations->AddTemp(Location::RequiresFpuRegister());
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       break;
@@ -144,18 +144,18 @@
   LocationSummary* locations = instruction->GetLocations();
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:  // TODO: up to here, and?
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:  // TODO: up to here, and?
       LOG(FATAL) << "Unsupported SIMD type";
       UNREACHABLE();
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_LE(4u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ movd(locations->Out().AsRegister<Register>(), src);
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movd(locations->Out().AsRegisterPairLow<Register>(), src);
@@ -163,8 +163,8 @@
       __ movd(locations->Out().AsRegisterPairHigh<Register>(), tmp);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 4u);
       DCHECK(locations->InAt(0).Equals(locations->Out()));  // no code required
@@ -179,14 +179,14 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
@@ -199,7 +199,7 @@
 void LocationsBuilderX86::VisitVecReduce(HVecReduce* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Long reduction or min/max require a temporary.
-  if (instruction->GetPackedType() == Primitive::kPrimLong ||
+  if (instruction->GetPackedType() == DataType::Type::kInt64 ||
       instruction->GetKind() == HVecReduce::kMin ||
       instruction->GetKind() == HVecReduce::kMax) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
@@ -211,7 +211,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       switch (instruction->GetKind()) {
         case HVecReduce::kSum:
@@ -241,7 +241,7 @@
         }
       }
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       DCHECK_EQ(2u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       switch (instruction->GetKind()) {
@@ -271,9 +271,9 @@
   LocationSummary* locations = instruction->GetLocations();
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
-  Primitive::Type from = instruction->GetInputType();
-  Primitive::Type to = instruction->GetResultType();
-  if (from == Primitive::kPrimInt && to == Primitive::kPrimFloat) {
+  DataType::Type from = instruction->GetInputType();
+  DataType::Type to = instruction->GetResultType();
+  if (from == DataType::Type::kInt32 && to == DataType::Type::kFloat32) {
     DCHECK_EQ(4u, instruction->GetVectorLength());
     __ cvtdq2ps(dst, src);
   } else {
@@ -290,33 +290,33 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ xorps(dst, dst);
       __ subps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ xorpd(dst, dst);
       __ subpd(dst, src);
@@ -330,7 +330,7 @@
 void LocationsBuilderX86::VisitVecAbs(HVecAbs* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Integral-abs requires a temporary for the comparison.
-  if (instruction->GetPackedType() == Primitive::kPrimInt) {
+  if (instruction->GetPackedType() == DataType::Type::kInt32) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
   }
 }
@@ -340,7 +340,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK_EQ(4u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       __ movaps(dst, src);
@@ -350,13 +350,13 @@
       __ psubd(dst, tmp);
       break;
     }
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ psrld(dst, Immediate(1));
       __ andps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ psrlq(dst, Immediate(1));
@@ -371,7 +371,7 @@
 void LocationsBuilderX86::VisitVecNot(HVecNot* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Boolean-not requires a temporary to construct the 16 x one.
-  if (instruction->GetPackedType() == Primitive::kPrimBoolean) {
+  if (instruction->GetPackedType() == DataType::Type::kBool) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
   }
 }
@@ -381,7 +381,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean: {  // special case boolean-not
+    case DataType::Type::kBool: {  // special case boolean-not
       DCHECK_EQ(16u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       __ pxor(dst, dst);
@@ -390,22 +390,22 @@
       __ pxor(dst, src);
       break;
     }
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pcmpeqb(dst, dst);  // all ones
       __ pxor(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ xorps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ xorpd(dst, src);
@@ -420,14 +420,14 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
@@ -448,28 +448,28 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ paddb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ paddw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ paddd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ paddq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ addps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ addpd(dst, src);
       break;
@@ -493,12 +493,12 @@
   DCHECK(instruction->IsUnsigned());
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
      __ pavgb(dst, src);
      return;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pavgw(dst, src);
       return;
@@ -518,28 +518,28 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ psubb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psubw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psubd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psubq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ subps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ subpd(dst, src);
       break;
@@ -559,20 +559,20 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pmullw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pmulld(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ mulps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ mulpd(dst, src);
       break;
@@ -592,11 +592,11 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ divps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ divpd(dst, src);
       break;
@@ -616,7 +616,7 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminub(dst, src);
@@ -624,8 +624,8 @@
         __ pminsb(dst, src);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminuw(dst, src);
@@ -633,7 +633,7 @@
         __ pminsw(dst, src);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminud(dst, src);
@@ -642,12 +642,12 @@
       }
       break;
     // Next cases are sloppy wrt 0.0 vs -0.0.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ minps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ minpd(dst, src);
@@ -668,7 +668,7 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxub(dst, src);
@@ -676,8 +676,8 @@
         __ pmaxsb(dst, src);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxuw(dst, src);
@@ -685,7 +685,7 @@
         __ pmaxsw(dst, src);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxud(dst, src);
@@ -694,12 +694,12 @@
       }
       break;
     // Next cases are sloppy wrt 0.0 vs -0.0.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ maxps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ maxpd(dst, src);
@@ -720,21 +720,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pand(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ andps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ andpd(dst, src);
       break;
@@ -754,21 +754,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pandn(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ andnps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ andnpd(dst, src);
       break;
@@ -788,21 +788,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ por(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ orps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ orpd(dst, src);
       break;
@@ -822,21 +822,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pxor(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ xorps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ xorpd(dst, src);
       break;
@@ -850,10 +850,10 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::SameAsFirstInput());
@@ -874,16 +874,16 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psllw(dst, Immediate(static_cast<uint8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pslld(dst, Immediate(static_cast<uint8_t>(value)));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psllq(dst, Immediate(static_cast<uint8_t>(value)));
       break;
@@ -903,12 +903,12 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psraw(dst, Immediate(static_cast<uint8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psrad(dst, Immediate(static_cast<uint8_t>(value)));
       break;
@@ -928,16 +928,16 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psrlw(dst, Immediate(static_cast<uint8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psrld(dst, Immediate(static_cast<uint8_t>(value)));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psrlq(dst, Immediate(static_cast<uint8_t>(value)));
       break;
@@ -956,23 +956,23 @@
   bool is_zero = IsZeroBitPattern(input);
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // Long needs extra temporary to load from register pairs.
       if (!is_zero) {
         locations->AddTemp(Location::RequiresFpuRegister());
       }
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister());
@@ -999,17 +999,17 @@
 
   // Set required elements.
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:  // TODO: up to here, and?
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:  // TODO: up to here, and?
       LOG(FATAL) << "Unsupported SIMD type";
       UNREACHABLE();
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<Register>());
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ xorps(tmp, tmp);
@@ -1018,11 +1018,11 @@
       __ punpckldq(dst, tmp);
       break;
     }
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movss(dst, locations->InAt(1).AsFpuRegister<XmmRegister>());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movsd(dst, locations->InAt(1).AsFpuRegister<XmmRegister>());
       break;
@@ -1036,11 +1036,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -1076,14 +1076,14 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -1126,12 +1126,12 @@
 
 void InstructionCodeGeneratorX86::VisitVecLoad(HVecLoad* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   Address address = VecAddress(locations, size, instruction->IsStringCharAt());
   XmmRegister reg = locations->Out().AsFpuRegister<XmmRegister>();
   bool is_aligned16 = instruction->GetAlignment().IsAlignedAt(16);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       // Special handling of compressed/uncompressed string load.
       if (mirror::kUseStringCompression && instruction->IsStringCharAt()) {
@@ -1155,20 +1155,20 @@
         return;
       }
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       is_aligned16 ? __ movdqa(reg, address) : __ movdqu(reg, address);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       is_aligned16 ? __ movaps(reg, address) : __ movups(reg, address);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       is_aligned16 ? __ movapd(reg, address) : __ movupd(reg, address);
       break;
@@ -1184,26 +1184,26 @@
 
 void InstructionCodeGeneratorX86::VisitVecStore(HVecStore* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   Address address = VecAddress(locations, size, /*is_string_char_at*/ false);
   XmmRegister reg = locations->InAt(2).AsFpuRegister<XmmRegister>();
   bool is_aligned16 = instruction->GetAlignment().IsAlignedAt(16);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       is_aligned16 ? __ movdqa(address, reg) : __ movdqu(address, reg);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       is_aligned16 ? __ movaps(address, reg) : __ movups(address, reg);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       is_aligned16 ? __ movapd(address, reg) : __ movupd(address, reg);
       break;
diff --git a/compiler/optimizing/code_generator_vector_x86_64.cc b/compiler/optimizing/code_generator_vector_x86_64.cc
index 3698b7f..4241042 100644
--- a/compiler/optimizing/code_generator_vector_x86_64.cc
+++ b/compiler/optimizing/code_generator_vector_x86_64.cc
@@ -30,18 +30,18 @@
   HInstruction* input = instruction->InputAt(0);
   bool is_zero = IsZeroBitPattern(input);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresFpuRegister());
       locations->SetOut(is_zero ? Location::RequiresFpuRegister()
@@ -64,37 +64,37 @@
   }
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>(), /*64-bit*/ false);
       __ punpcklbw(dst, dst);
       __ punpcklwd(dst, dst);
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>(), /*64-bit*/ false);
       __ punpcklwd(dst, dst);
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>(), /*64-bit*/ false);
       __ pshufd(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>(), /*64-bit*/ true);
       __ punpcklqdq(dst, dst);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(locations->InAt(0).Equals(locations->Out()));
       __ shufps(dst, dst, Immediate(0));
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(locations->InAt(0).Equals(locations->Out()));
       __ shufpd(dst, dst, Immediate(0));
@@ -108,17 +108,17 @@
 void LocationsBuilderX86_64::VisitVecExtractScalar(HVecExtractScalar* instruction) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       break;
@@ -132,22 +132,22 @@
   LocationSummary* locations = instruction->GetLocations();
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:  // TODO: up to here, and?
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:  // TODO: up to here, and?
       LOG(FATAL) << "Unsupported SIMD type";
       UNREACHABLE();
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movd(locations->Out().AsRegister<CpuRegister>(), src, /*64-bit*/ false);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movd(locations->Out().AsRegister<CpuRegister>(), src, /*64-bit*/ true);
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 4u);
       DCHECK(locations->InAt(0).Equals(locations->Out()));  // no code required
@@ -162,14 +162,14 @@
 static void CreateVecUnOpLocations(ArenaAllocator* arena, HVecUnaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
@@ -182,7 +182,7 @@
 void LocationsBuilderX86_64::VisitVecReduce(HVecReduce* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Long reduction or min/max require a temporary.
-  if (instruction->GetPackedType() == Primitive::kPrimLong ||
+  if (instruction->GetPackedType() == DataType::Type::kInt64 ||
       instruction->GetKind() == HVecReduce::kMin ||
       instruction->GetKind() == HVecReduce::kMax) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
@@ -194,7 +194,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       switch (instruction->GetKind()) {
         case HVecReduce::kSum:
@@ -224,7 +224,7 @@
         }
       }
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       DCHECK_EQ(2u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       switch (instruction->GetKind()) {
@@ -254,9 +254,9 @@
   LocationSummary* locations = instruction->GetLocations();
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
-  Primitive::Type from = instruction->GetInputType();
-  Primitive::Type to = instruction->GetResultType();
-  if (from == Primitive::kPrimInt && to == Primitive::kPrimFloat) {
+  DataType::Type from = instruction->GetInputType();
+  DataType::Type to = instruction->GetResultType();
+  if (from == DataType::Type::kInt32 && to == DataType::Type::kFloat32) {
     DCHECK_EQ(4u, instruction->GetVectorLength());
     __ cvtdq2ps(dst, src);
   } else {
@@ -273,33 +273,33 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pxor(dst, dst);
       __ psubq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ xorps(dst, dst);
       __ subps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ xorpd(dst, dst);
       __ subpd(dst, src);
@@ -313,7 +313,7 @@
 void LocationsBuilderX86_64::VisitVecAbs(HVecAbs* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Integral-abs requires a temporary for the comparison.
-  if (instruction->GetPackedType() == Primitive::kPrimInt) {
+  if (instruction->GetPackedType() == DataType::Type::kInt32) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
   }
 }
@@ -323,7 +323,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK_EQ(4u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       __ movaps(dst, src);
@@ -333,13 +333,13 @@
       __ psubd(dst, tmp);
       break;
     }
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ psrld(dst, Immediate(1));
       __ andps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ psrlq(dst, Immediate(1));
@@ -354,7 +354,7 @@
 void LocationsBuilderX86_64::VisitVecNot(HVecNot* instruction) {
   CreateVecUnOpLocations(GetGraph()->GetArena(), instruction);
   // Boolean-not requires a temporary to construct the 16 x one.
-  if (instruction->GetPackedType() == Primitive::kPrimBoolean) {
+  if (instruction->GetPackedType() == DataType::Type::kBool) {
     instruction->GetLocations()->AddTemp(Location::RequiresFpuRegister());
   }
 }
@@ -364,7 +364,7 @@
   XmmRegister src = locations->InAt(0).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean: {  // special case boolean-not
+    case DataType::Type::kBool: {  // special case boolean-not
       DCHECK_EQ(16u, instruction->GetVectorLength());
       XmmRegister tmp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       __ pxor(dst, dst);
@@ -373,22 +373,22 @@
       __ pxor(dst, src);
       break;
     }
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pcmpeqb(dst, dst);  // all ones
       __ pxor(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ xorps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ pcmpeqb(dst, dst);  // all ones
       __ xorpd(dst, src);
@@ -403,14 +403,14 @@
 static void CreateVecBinOpLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
@@ -431,28 +431,28 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ paddb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ paddw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ paddd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ paddq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ addps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ addpd(dst, src);
       break;
@@ -476,12 +476,12 @@
   DCHECK(instruction->IsUnsigned());
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
      __ pavgb(dst, src);
      return;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pavgw(dst, src);
       return;
@@ -501,28 +501,28 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       __ psubb(dst, src);
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psubw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psubd(dst, src);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psubq(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ subps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ subpd(dst, src);
       break;
@@ -542,20 +542,20 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ pmullw(dst, src);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pmulld(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ mulps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ mulpd(dst, src);
       break;
@@ -575,11 +575,11 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ divps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ divpd(dst, src);
       break;
@@ -599,7 +599,7 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminub(dst, src);
@@ -607,8 +607,8 @@
         __ pminsb(dst, src);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminuw(dst, src);
@@ -616,7 +616,7 @@
         __ pminsw(dst, src);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pminud(dst, src);
@@ -625,12 +625,12 @@
       }
       break;
     // Next cases are sloppy wrt 0.0 vs -0.0.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ minps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ minpd(dst, src);
@@ -651,7 +651,7 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       DCHECK_EQ(16u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxub(dst, src);
@@ -659,8 +659,8 @@
         __ pmaxsb(dst, src);
       }
       break;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxuw(dst, src);
@@ -668,7 +668,7 @@
         __ pmaxsw(dst, src);
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       if (instruction->IsUnsigned()) {
         __ pmaxud(dst, src);
@@ -677,12 +677,12 @@
       }
       break;
     // Next cases are sloppy wrt 0.0 vs -0.0.
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ maxps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       DCHECK(!instruction->IsUnsigned());
       __ maxpd(dst, src);
@@ -703,21 +703,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pand(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ andps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ andpd(dst, src);
       break;
@@ -737,21 +737,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pandn(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ andnps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ andnpd(dst, src);
       break;
@@ -771,21 +771,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ por(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ orps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ orpd(dst, src);
       break;
@@ -805,21 +805,21 @@
   XmmRegister src = locations->InAt(1).AsFpuRegister<XmmRegister>();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       __ pxor(dst, src);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ xorps(dst, src);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ xorpd(dst, src);
       break;
@@ -833,10 +833,10 @@
 static void CreateVecShiftLocations(ArenaAllocator* arena, HVecBinaryOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::ConstantLocation(instruction->InputAt(1)->AsConstant()));
       locations->SetOut(Location::SameAsFirstInput());
@@ -857,16 +857,16 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psllw(dst, Immediate(static_cast<int8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ pslld(dst, Immediate(static_cast<int8_t>(value)));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psllq(dst, Immediate(static_cast<int8_t>(value)));
       break;
@@ -886,12 +886,12 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psraw(dst, Immediate(static_cast<int8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psrad(dst, Immediate(static_cast<int8_t>(value)));
       break;
@@ -911,16 +911,16 @@
   int32_t value = locations->InAt(1).GetConstant()->AsIntConstant()->GetValue();
   XmmRegister dst = locations->Out().AsFpuRegister<XmmRegister>();
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       __ psrlw(dst, Immediate(static_cast<int8_t>(value)));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ psrld(dst, Immediate(static_cast<int8_t>(value)));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ psrlq(dst, Immediate(static_cast<int8_t>(value)));
       break;
@@ -939,18 +939,18 @@
   bool is_zero = IsZeroBitPattern(input);
 
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresRegister());
       locations->SetOut(Location::RequiresFpuRegister());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, is_zero ? Location::ConstantLocation(input->AsConstant())
                                     : Location::RequiresFpuRegister());
       locations->SetOut(Location::RequiresFpuRegister());
@@ -977,25 +977,25 @@
 
   // Set required elements.
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:  // TODO: up to here, and?
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:  // TODO: up to here, and?
       LOG(FATAL) << "Unsupported SIMD type";
       UNREACHABLE();
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>());
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movd(dst, locations->InAt(0).AsRegister<CpuRegister>());  // is 64-bit
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       __ movss(dst, locations->InAt(0).AsFpuRegister<XmmRegister>());
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       __ movsd(dst, locations->InAt(0).AsFpuRegister<XmmRegister>());
       break;
@@ -1009,11 +1009,11 @@
 static void CreateVecAccumLocations(ArenaAllocator* arena, HVecOperation* instruction) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::RequiresFpuRegister());
       locations->SetInAt(2, Location::RequiresFpuRegister());
@@ -1049,14 +1049,14 @@
                                   bool is_load) {
   LocationSummary* locations = new (arena) LocationSummary(instruction);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
       if (is_load) {
@@ -1099,12 +1099,12 @@
 
 void InstructionCodeGeneratorX86_64::VisitVecLoad(HVecLoad* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   Address address = VecAddress(locations, size, instruction->IsStringCharAt());
   XmmRegister reg = locations->Out().AsFpuRegister<XmmRegister>();
   bool is_aligned16 = instruction->GetAlignment().IsAlignedAt(16);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       DCHECK_EQ(8u, instruction->GetVectorLength());
       // Special handling of compressed/uncompressed string load.
       if (mirror::kUseStringCompression && instruction->IsStringCharAt()) {
@@ -1128,20 +1128,20 @@
         return;
       }
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       is_aligned16 ? __ movdqa(reg, address) : __ movdqu(reg, address);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       is_aligned16 ? __ movaps(reg, address) : __ movups(reg, address);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       is_aligned16 ? __ movapd(reg, address) : __ movupd(reg, address);
       break;
@@ -1157,26 +1157,26 @@
 
 void InstructionCodeGeneratorX86_64::VisitVecStore(HVecStore* instruction) {
   LocationSummary* locations = instruction->GetLocations();
-  size_t size = Primitive::ComponentSize(instruction->GetPackedType());
+  size_t size = DataType::Size(instruction->GetPackedType());
   Address address = VecAddress(locations, size, /*is_string_char_at*/ false);
   XmmRegister reg = locations->InAt(2).AsFpuRegister<XmmRegister>();
   bool is_aligned16 = instruction->GetAlignment().IsAlignedAt(16);
   switch (instruction->GetPackedType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       DCHECK_LE(2u, instruction->GetVectorLength());
       DCHECK_LE(instruction->GetVectorLength(), 16u);
       is_aligned16 ? __ movdqa(address, reg) : __ movdqu(address, reg);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       DCHECK_EQ(4u, instruction->GetVectorLength());
       is_aligned16 ? __ movaps(address, reg) : __ movups(address, reg);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       DCHECK_EQ(2u, instruction->GetVectorLength());
       is_aligned16 ? __ movapd(address, reg) : __ movupd(address, reg);
       break;
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index 99581ee..70e270e 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -161,10 +161,10 @@
     x86_codegen->EmitParallelMoves(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         length_loc,
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt);
+        DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -342,10 +342,10 @@
     InvokeRuntimeCallingConvention calling_convention;
     x86_codegen->EmitParallelMoves(locations->InAt(0),
                                    Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                                   Primitive::kPrimNot,
+                                   DataType::Type::kReference,
                                    locations->InAt(1),
                                    Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                                   Primitive::kPrimNot);
+                                   DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       x86_codegen->InvokeRuntime(kQuickInstanceofNonTrivial,
                                  instruction_,
@@ -418,17 +418,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -814,16 +814,16 @@
     HParallelMove parallel_move(codegen->GetGraph()->GetArena());
     parallel_move.AddMove(ref_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     parallel_move.AddMove(obj_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -1129,24 +1129,24 @@
   __ Bind(GetLabelOf(block));
 }
 
-Location InvokeDexCallingConventionVisitorX86::GetReturnLocation(Primitive::Type type) const {
+Location InvokeDexCallingConventionVisitorX86::GetReturnLocation(DataType::Type type) const {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
       return Location::RegisterLocation(EAX);
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       return Location::RegisterPairLocation(EAX, EDX);
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       return Location::NoLocation();
 
-    case Primitive::kPrimDouble:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat64:
+    case DataType::Type::kFloat32:
       return Location::FpuRegisterLocation(XMM0);
   }
 
@@ -1157,14 +1157,14 @@
   return Location::RegisterLocation(kMethodRegisterArgument);
 }
 
-Location InvokeDexCallingConventionVisitorX86::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorX86::GetNextLocation(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       uint32_t index = gp_index_++;
       stack_index_++;
       if (index < calling_convention.GetNumberOfRegisters()) {
@@ -1174,7 +1174,7 @@
       }
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t index = gp_index_;
       gp_index_ += 2;
       stack_index_ += 2;
@@ -1187,7 +1187,7 @@
       }
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t index = float_index_++;
       stack_index_++;
       if (index < calling_convention.GetNumberOfFpuRegisters()) {
@@ -1197,7 +1197,7 @@
       }
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t index = float_index_++;
       stack_index_ += 2;
       if (index < calling_convention.GetNumberOfFpuRegisters()) {
@@ -1207,7 +1207,7 @@
       }
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unexpected parameter type " << type;
       break;
   }
@@ -1263,10 +1263,10 @@
       EmitParallelMoves(
           Location::RegisterLocation(source.AsRegisterPairHigh<Register>()),
           Location::RegisterLocation(destination.AsRegisterPairHigh<Register>()),
-          Primitive::kPrimInt,
+          DataType::Type::kInt32,
           Location::RegisterLocation(source.AsRegisterPairLow<Register>()),
           Location::RegisterLocation(destination.AsRegisterPairLow<Register>()),
-          Primitive::kPrimInt);
+          DataType::Type::kInt32);
     } else if (source.IsFpuRegister()) {
       XmmRegister src_reg = source.AsFpuRegister<XmmRegister>();
       __ movd(destination.AsRegisterPairLow<Register>(), src_reg);
@@ -1285,7 +1285,7 @@
     } else if (source.IsDoubleStackSlot()) {
       __ movsd(destination.AsFpuRegister<XmmRegister>(), Address(ESP, source.GetStackIndex()));
     } else if (source.IsRegisterPair()) {
-      size_t elem_size = Primitive::ComponentSize(Primitive::kPrimInt);
+      size_t elem_size = DataType::Size(DataType::Type::kInt32);
       // Create stack space for 2 elements.
       __ subl(ESP, Immediate(2 * elem_size));
       __ movl(Address(ESP, 0), source.AsRegisterPairLow<Register>());
@@ -1317,10 +1317,10 @@
       EmitParallelMoves(
           Location::StackSlot(source.GetStackIndex()),
           Location::StackSlot(destination.GetStackIndex()),
-          Primitive::kPrimInt,
+          DataType::Type::kInt32,
           Location::StackSlot(source.GetHighStackIndex(kX86WordSize)),
           Location::StackSlot(destination.GetHighStackIndex(kX86WordSize)),
-          Primitive::kPrimInt);
+          DataType::Type::kInt32);
     }
   }
 }
@@ -1330,11 +1330,11 @@
   __ movl(location.AsRegister<Register>(), Immediate(value));
 }
 
-void CodeGeneratorX86::MoveLocation(Location dst, Location src, Primitive::Type dst_type) {
+void CodeGeneratorX86::MoveLocation(Location dst, Location src, DataType::Type dst_type) {
   HParallelMove move(GetGraph()->GetArena());
-  if (dst_type == Primitive::kPrimLong && !src.IsConstant() && !src.IsFpuRegister()) {
-    move.AddMove(src.ToLow(), dst.ToLow(), Primitive::kPrimInt, nullptr);
-    move.AddMove(src.ToHigh(), dst.ToHigh(), Primitive::kPrimInt, nullptr);
+  if (dst_type == DataType::Type::kInt64 && !src.IsConstant() && !src.IsFpuRegister()) {
+    move.AddMove(src.ToLow(), dst.ToLow(), DataType::Type::kInt32, nullptr);
+    move.AddMove(src.ToHigh(), dst.ToHigh(), DataType::Type::kInt32, nullptr);
   } else {
     move.AddMove(src, dst, dst_type, nullptr);
   }
@@ -1557,16 +1557,16 @@
   Location left = locations->InAt(0);
   Location right = locations->InAt(1);
 
-  Primitive::Type type = condition->InputAt(0)->GetType();
+  DataType::Type type = condition->InputAt(0)->GetType();
   switch (type) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       GenerateLongComparesAndJumps(condition, true_target, false_target);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       GenerateFPCompare(left, right, condition, false);
       GenerateFPJumps(condition, true_target, false_target);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       GenerateFPCompare(left, right, condition, true);
       GenerateFPJumps(condition, true_target, false_target);
       break;
@@ -1589,8 +1589,8 @@
   // conditions if they are materialized due to the complex branching.
   return cond->IsCondition() &&
          cond->GetNext() == branch &&
-         cond->InputAt(0)->GetType() != Primitive::kPrimLong &&
-         !Primitive::IsFloatingPointType(cond->InputAt(0)->GetType());
+         cond->InputAt(0)->GetType() != DataType::Type::kInt64 &&
+         !DataType::IsFloatingPointType(cond->InputAt(0)->GetType());
 }
 
 template<class LabelType>
@@ -1654,8 +1654,8 @@
 
     // If this is a long or FP comparison that has been folded into
     // the HCondition, generate the comparison directly.
-    Primitive::Type type = condition->InputAt(0)->GetType();
-    if (type == Primitive::kPrimLong || Primitive::IsFloatingPointType(type)) {
+    DataType::Type type = condition->InputAt(0)->GetType();
+    if (type == DataType::Type::kInt64 || DataType::IsFloatingPointType(type)) {
       GenerateCompareTestAndBranch(condition, true_target, false_target);
       return;
     }
@@ -1728,7 +1728,7 @@
 
 static bool SelectCanUseCMOV(HSelect* select) {
   // There are no conditional move instructions for XMMs.
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     return false;
   }
 
@@ -1736,9 +1736,9 @@
   // In 32 bit mode, a long condition doesn't generate a single CC either.
   HInstruction* condition = select->GetCondition();
   if (condition->IsCondition()) {
-    Primitive::Type compare_type = condition->InputAt(0)->GetType();
-    if (compare_type == Primitive::kPrimLong ||
-        Primitive::IsFloatingPointType(compare_type)) {
+    DataType::Type compare_type = condition->InputAt(0)->GetType();
+    if (compare_type == DataType::Type::kInt64 ||
+        DataType::IsFloatingPointType(compare_type)) {
       return false;
     }
   }
@@ -1749,7 +1749,7 @@
 
 void LocationsBuilderX86::VisitSelect(HSelect* select) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
     locations->SetInAt(1, Location::Any());
   } else {
@@ -1797,8 +1797,8 @@
         }
       } else {
         // We can't handle FP or long here.
-        DCHECK_NE(condition->InputAt(0)->GetType(), Primitive::kPrimLong);
-        DCHECK(!Primitive::IsFloatingPointType(condition->InputAt(0)->GetType()));
+        DCHECK_NE(condition->InputAt(0)->GetType(), DataType::Type::kInt64);
+        DCHECK(!DataType::IsFloatingPointType(condition->InputAt(0)->GetType()));
         LocationSummary* cond_locations = condition->GetLocations();
         codegen_->GenerateIntCompare(cond_locations->InAt(0), cond_locations->InAt(1));
         cond = X86Condition(condition->GetCondition());
@@ -1812,7 +1812,7 @@
     // If the condition is true, overwrite the output, which already contains false.
     Location false_loc = locations->InAt(0);
     Location true_loc = locations->InAt(1);
-    if (select->GetType() == Primitive::kPrimLong) {
+    if (select->GetType() == DataType::Type::kInt64) {
       // 64 bit conditional move.
       Register false_high = false_loc.AsRegisterPairHigh<Register>();
       Register false_low = false_loc.AsRegisterPairLow<Register>();
@@ -1858,7 +1858,7 @@
       new (GetGraph()->GetArena()) LocationSummary(cond, LocationSummary::kNoCall);
   // Handle the long/FP comparisons made in instruction simplification.
   switch (cond->InputAt(0)->GetType()) {
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       if (!cond->IsEmittedAtUseSite()) {
@@ -1866,8 +1866,8 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (cond->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(cond->InputAt(1)->IsEmittedAtUseSite());
@@ -1913,14 +1913,14 @@
       __ setb(X86Condition(cond->GetCondition()), reg);
       return;
     }
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       GenerateLongComparesAndJumps(cond, &true_label, &false_label);
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       GenerateFPCompare(lhs, rhs, cond, false);
       GenerateFPJumps(cond, &true_label, &false_label);
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       GenerateFPCompare(lhs, rhs, cond, true);
       GenerateFPJumps(cond, &true_label, &false_label);
       break;
@@ -2099,22 +2099,22 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(ret, LocationSummary::kNoCall);
   switch (ret->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
       locations->SetInAt(0, Location::RegisterLocation(EAX));
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(
           0, Location::RegisterPairLocation(EAX, EDX));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(
           0, Location::FpuRegisterLocation(XMM0));
       break;
@@ -2127,22 +2127,22 @@
 void InstructionCodeGeneratorX86::VisitReturn(HReturn* ret) {
   if (kIsDebugBuild) {
     switch (ret->InputAt(0)->GetType()) {
-      case Primitive::kPrimBoolean:
-      case Primitive::kPrimByte:
-      case Primitive::kPrimChar:
-      case Primitive::kPrimShort:
-      case Primitive::kPrimInt:
-      case Primitive::kPrimNot:
+      case DataType::Type::kBool:
+      case DataType::Type::kInt8:
+      case DataType::Type::kUint16:
+      case DataType::Type::kInt16:
+      case DataType::Type::kInt32:
+      case DataType::Type::kReference:
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsRegister<Register>(), EAX);
         break;
 
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsRegisterPairLow<Register>(), EAX);
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsRegisterPairHigh<Register>(), EDX);
         break;
 
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsFpuRegister<XmmRegister>(), XMM0);
         break;
 
@@ -2298,20 +2298,20 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::SameAsFirstInput());
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       locations->AddTemp(Location::RequiresRegister());
       locations->AddTemp(Location::RequiresFpuRegister());
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       locations->AddTemp(Location::RequiresFpuRegister());
@@ -2327,13 +2327,13 @@
   Location out = locations->Out();
   Location in = locations->InAt(0);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK(in.IsRegister());
       DCHECK(in.Equals(out));
       __ negl(out.AsRegister<Register>());
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK(in.IsRegisterPair());
       DCHECK(in.Equals(out));
       __ negl(out.AsRegisterPairLow<Register>());
@@ -2346,7 +2346,7 @@
       __ negl(out.AsRegisterPairHigh<Register>());
       break;
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       DCHECK(in.Equals(out));
       Register constant = locations->GetTemp(0).AsRegister<Register>();
       XmmRegister mask = locations->GetTemp(1).AsFpuRegister<XmmRegister>();
@@ -2359,7 +2359,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       DCHECK(in.Equals(out));
       XmmRegister mask = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       // Implement double negation with an exclusive or with value
@@ -2378,7 +2378,7 @@
 void LocationsBuilderX86::VisitX86FPNeg(HX86FPNeg* neg) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
-  DCHECK(Primitive::IsFloatingPointType(neg->GetType()));
+  DCHECK(DataType::IsFloatingPointType(neg->GetType()));
   locations->SetInAt(0, Location::RequiresFpuRegister());
   locations->SetInAt(1, Location::RequiresRegister());
   locations->SetOut(Location::SameAsFirstInput());
@@ -2392,7 +2392,7 @@
 
   Register constant_area = locations->InAt(1).AsRegister<Register>();
   XmmRegister mask = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
-  if (neg->GetType() == Primitive::kPrimFloat) {
+  if (neg->GetType() == DataType::Type::kFloat32) {
     __ movss(mask, codegen_->LiteralInt32Address(INT32_C(0x80000000),
                                                  neg->GetBaseMethodAddress(),
                                                  constant_area));
@@ -2406,15 +2406,15 @@
 }
 
 void LocationsBuilderX86::VisitTypeConversion(HTypeConversion* conversion) {
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
 
   // The float-to-long and double-to-long type conversions rely on a
   // call to the runtime.
   LocationSummary::CallKind call_kind =
-      ((input_type == Primitive::kPrimFloat || input_type == Primitive::kPrimDouble)
-       && result_type == Primitive::kPrimLong)
+      ((input_type == DataType::Type::kFloat32 || input_type == DataType::Type::kFloat64)
+       && result_type == DataType::Type::kInt64)
       ? LocationSummary::kCallOnMainOnly
       : LocationSummary::kNoCall;
   LocationSummary* locations =
@@ -2424,9 +2424,9 @@
   // our bit representation makes it safe.
 
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           // Type conversion from long to byte is a result of code transformations.
           HInstruction* input = conversion->InputAt(0);
           Location input_location = input->IsConstant()
@@ -2438,11 +2438,11 @@
           locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
           break;
         }
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           locations->SetInAt(0, Location::ByteRegisterOrConstant(ECX, conversion->InputAt(0)));
           // Make the output overlap to please the register allocator. This greatly simplifies
@@ -2456,15 +2456,15 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2476,22 +2476,22 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
           locations->AddTemp(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
@@ -2504,21 +2504,21 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           locations->SetInAt(0, Location::RegisterLocation(EAX));
           locations->SetOut(Location::RegisterPairLocation(EAX, EDX));
           break;
 
-        case Primitive::kPrimFloat:
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat32:
+        case DataType::Type::kFloat64: {
           // Processing a Dex `float-to-long' or 'double-to-long' instruction.
           InvokeRuntimeCallingConvention calling_convention;
           XmmRegister parameter = calling_convention.GetFpuRegisterAt(0);
@@ -2535,15 +2535,15 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to char is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `int-to-char' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2555,26 +2555,26 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-float' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-float' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::Any());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -2586,26 +2586,26 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-double' instruction.
           locations->SetInAt(0, Location::RequiresRegister());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-double' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::Any());
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -2627,13 +2627,13 @@
   LocationSummary* locations = conversion->GetLocations();
   Location out = locations->Out();
   Location in = locations->InAt(0);
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to byte is a result of code transformations.
           if (in.IsRegisterPair()) {
             __ movsxb(out.AsRegister<Register>(), in.AsRegisterPairLow<ByteRegister>());
@@ -2643,11 +2643,11 @@
             __ movl(out.AsRegister<Register>(), Immediate(static_cast<int8_t>(value)));
           }
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           if (in.IsRegister()) {
             __ movsxb(out.AsRegister<Register>(), in.AsRegister<ByteRegister>());
@@ -2664,9 +2664,9 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
           if (in.IsRegisterPair()) {
             __ movsxw(out.AsRegister<Register>(), in.AsRegisterPairLow<Register>());
@@ -2678,11 +2678,11 @@
             __ movl(out.AsRegister<Register>(), Immediate(static_cast<int16_t>(value)));
           }
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           if (in.IsRegister()) {
             __ movsxw(out.AsRegister<Register>(), in.AsRegister<Register>());
@@ -2701,9 +2701,9 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           if (in.IsRegisterPair()) {
             __ movl(out.AsRegister<Register>(), in.AsRegisterPairLow<Register>());
@@ -2717,7 +2717,7 @@
           }
           break;
 
-        case Primitive::kPrimFloat: {
+        case DataType::Type::kFloat32: {
           // Processing a Dex `float-to-int' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           Register output = out.AsRegister<Register>();
@@ -2742,7 +2742,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat64: {
           // Processing a Dex `double-to-int' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           Register output = out.AsRegister<Register>();
@@ -2773,14 +2773,14 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           DCHECK_EQ(out.AsRegisterPairLow<Register>(), EAX);
           DCHECK_EQ(out.AsRegisterPairHigh<Register>(), EDX);
@@ -2788,13 +2788,13 @@
           __ cdq();
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-long' instruction.
           codegen_->InvokeRuntime(kQuickF2l, conversion, conversion->GetDexPc());
           CheckEntrypointTypes<kQuickF2l, int64_t, float>();
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-long' instruction.
           codegen_->InvokeRuntime(kQuickD2l, conversion, conversion->GetDexPc());
           CheckEntrypointTypes<kQuickD2l, int64_t, double>();
@@ -2806,9 +2806,9 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
           if (in.IsRegisterPair()) {
             __ movzxw(out.AsRegister<Register>(), in.AsRegisterPairLow<Register>());
@@ -2820,11 +2820,11 @@
             __ movl(out.AsRegister<Register>(), Immediate(static_cast<uint16_t>(value)));
           }
           break;
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `Process a Dex `int-to-char'' instruction.
           if (in.IsRegister()) {
             __ movzxw(out.AsRegister<Register>(), in.AsRegister<Register>());
@@ -2843,19 +2843,19 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-float' instruction.
           __ cvtsi2ss(out.AsFpuRegister<XmmRegister>(), in.AsRegister<Register>());
           break;
 
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           // Processing a Dex `long-to-float' instruction.
           size_t adjustment = 0;
 
@@ -2863,7 +2863,7 @@
           // InstructionCodeGeneratorX86::PushOntoFPStack and/or X86Assembler::fstps below.
           // TODO: enhance register allocator to ask for stack temporaries.
           if (!in.IsDoubleStackSlot() || !out.IsStackSlot()) {
-            adjustment = Primitive::ComponentSize(Primitive::kPrimLong);
+            adjustment = DataType::Size(DataType::Type::kInt64);
             __ subl(ESP, Immediate(adjustment));
           }
 
@@ -2885,7 +2885,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           __ cvtsd2ss(out.AsFpuRegister<XmmRegister>(), in.AsFpuRegister<XmmRegister>());
           break;
@@ -2896,19 +2896,19 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-double' instruction.
           __ cvtsi2sd(out.AsFpuRegister<XmmRegister>(), in.AsRegister<Register>());
           break;
 
-        case Primitive::kPrimLong: {
+        case DataType::Type::kInt64: {
           // Processing a Dex `long-to-double' instruction.
           size_t adjustment = 0;
 
@@ -2916,7 +2916,7 @@
           // InstructionCodeGeneratorX86::PushOntoFPStack and/or X86Assembler::fstpl below.
           // TODO: enhance register allocator to ask for stack temporaries.
           if (!in.IsDoubleStackSlot() || !out.IsDoubleStackSlot()) {
-            adjustment = Primitive::ComponentSize(Primitive::kPrimLong);
+            adjustment = DataType::Size(DataType::Type::kInt64);
             __ subl(ESP, Immediate(adjustment));
           }
 
@@ -2938,7 +2938,7 @@
           break;
         }
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           __ cvtss2sd(out.AsFpuRegister<XmmRegister>(), in.AsFpuRegister<XmmRegister>());
           break;
@@ -2959,22 +2959,22 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(add, LocationSummary::kNoCall);
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(add->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (add->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(add->InputAt(1)->IsEmittedAtUseSite());
@@ -3000,7 +3000,7 @@
   Location out = locations->Out();
 
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (second.IsRegister()) {
         if (out.AsRegister<Register>() == first.AsRegister<Register>()) {
           __ addl(out.AsRegister<Register>(), second.AsRegister<Register>());
@@ -3024,7 +3024,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsRegisterPair()) {
         __ addl(first.AsRegisterPairLow<Register>(), second.AsRegisterPairLow<Register>());
         __ adcl(first.AsRegisterPairHigh<Register>(), second.AsRegisterPairHigh<Register>());
@@ -3041,7 +3041,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ addss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (add->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3059,7 +3059,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ addsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (add->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3086,15 +3086,15 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(sub, LocationSummary::kNoCall);
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (sub->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(sub->InputAt(1)->IsEmittedAtUseSite());
@@ -3118,7 +3118,7 @@
   Location second = locations->InAt(1);
   DCHECK(first.Equals(locations->Out()));
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (second.IsRegister()) {
         __ subl(first.AsRegister<Register>(), second.AsRegister<Register>());
       } else if (second.IsConstant()) {
@@ -3130,7 +3130,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsRegisterPair()) {
         __ subl(first.AsRegisterPairLow<Register>(), second.AsRegisterPairLow<Register>());
         __ sbbl(first.AsRegisterPairHigh<Register>(), second.AsRegisterPairHigh<Register>());
@@ -3147,7 +3147,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ subss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (sub->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3165,7 +3165,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ subsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (sub->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3192,7 +3192,7 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       if (mul->InputAt(1)->IsIntConstant()) {
@@ -3202,7 +3202,7 @@
         locations->SetOut(Location::SameAsFirstInput());
       }
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
@@ -3211,8 +3211,8 @@
       locations->AddTemp(Location::RegisterLocation(EDX));
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (mul->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(mul->InputAt(1)->IsEmittedAtUseSite());
@@ -3237,7 +3237,7 @@
   Location out = locations->Out();
 
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       // The constant may have ended up in a register, so test explicitly to avoid
       // problems where the output may not be the same as the first operand.
       if (mul->InputAt(1)->IsIntConstant()) {
@@ -3253,7 +3253,7 @@
       }
       break;
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register in1_hi = first.AsRegisterPairHigh<Register>();
       Register in1_lo = first.AsRegisterPairLow<Register>();
       Register eax = locations->GetTemp(0).AsRegister<Register>();
@@ -3335,7 +3335,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       DCHECK(first.Equals(locations->Out()));
       if (second.IsFpuRegister()) {
         __ mulss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
@@ -3354,7 +3354,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       DCHECK(first.Equals(locations->Out()));
       if (second.IsFpuRegister()) {
         __ mulsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
@@ -3420,9 +3420,9 @@
 }
 
 void InstructionCodeGeneratorX86::GenerateRemFP(HRem *rem) {
-  Primitive::Type type = rem->GetResultType();
-  bool is_float = type == Primitive::kPrimFloat;
-  size_t elem_size = Primitive::ComponentSize(type);
+  DataType::Type type = rem->GetResultType();
+  bool is_float = type == DataType::Type::kFloat32;
+  size_t elem_size = DataType::Size(type);
   LocationSummary* locations = rem->GetLocations();
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
@@ -3599,7 +3599,7 @@
   bool is_div = instruction->IsDiv();
 
   switch (instruction->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK_EQ(EAX, first.AsRegister<Register>());
       DCHECK_EQ(is_div ? EAX : EDX, out.AsRegister<Register>());
 
@@ -3638,7 +3638,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConvention calling_convention;
       DCHECK_EQ(calling_convention.GetRegisterAt(0), first.AsRegisterPairLow<Register>());
       DCHECK_EQ(calling_convention.GetRegisterAt(1), first.AsRegisterPairHigh<Register>());
@@ -3663,13 +3663,13 @@
 }
 
 void LocationsBuilderX86::VisitDiv(HDiv* div) {
-  LocationSummary::CallKind call_kind = (div->GetResultType() == Primitive::kPrimLong)
+  LocationSummary::CallKind call_kind = (div->GetResultType() == DataType::Type::kInt64)
       ? LocationSummary::kCallOnMainOnly
       : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(div, call_kind);
 
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RegisterLocation(EAX));
       locations->SetInAt(1, Location::RegisterOrConstant(div->InputAt(1)));
       locations->SetOut(Location::SameAsFirstInput());
@@ -3683,7 +3683,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::RegisterPairLocation(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -3693,8 +3693,8 @@
       locations->SetOut(Location::RegisterPairLocation(EAX, EDX));
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (div->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(div->InputAt(1)->IsEmittedAtUseSite());
@@ -3718,13 +3718,13 @@
   Location second = locations->InAt(1);
 
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GenerateDivRemIntegral(div);
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ divss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (div->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3742,7 +3742,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ divsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (div->InputAt(1)->IsX86LoadFromConstantTable()) {
@@ -3766,15 +3766,15 @@
 }
 
 void LocationsBuilderX86::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
 
-  LocationSummary::CallKind call_kind = (rem->GetResultType() == Primitive::kPrimLong)
+  LocationSummary::CallKind call_kind = (rem->GetResultType() == DataType::Type::kInt64)
       ? LocationSummary::kCallOnMainOnly
       : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(rem, call_kind);
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RegisterLocation(EAX));
       locations->SetInAt(1, Location::RegisterOrConstant(rem->InputAt(1)));
       locations->SetOut(Location::RegisterLocation(EDX));
@@ -3786,7 +3786,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       InvokeRuntimeCallingConvention calling_convention;
       locations->SetInAt(0, Location::RegisterPairLocation(
           calling_convention.GetRegisterAt(0), calling_convention.GetRegisterAt(1)));
@@ -3796,8 +3796,8 @@
       locations->SetOut(Location::RegisterPairLocation(EAX, EDX));
       break;
     }
-    case Primitive::kPrimDouble:
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat64:
+    case DataType::Type::kFloat32: {
       locations->SetInAt(0, Location::Any());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::RequiresFpuRegister());
@@ -3811,15 +3811,15 @@
 }
 
 void InstructionCodeGeneratorX86::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GenerateDivRemIntegral(rem);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       GenerateRemFP(rem);
       break;
     }
@@ -3831,15 +3831,15 @@
 void LocationsBuilderX86::VisitDivZeroCheck(HDivZeroCheck* instruction) {
   LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
   switch (instruction->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::Any());
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
       if (!instruction->IsConstant()) {
         locations->AddTemp(Location::RequiresRegister());
@@ -3859,11 +3859,11 @@
   Location value = locations->InAt(0);
 
   switch (instruction->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32: {
       if (value.IsRegister()) {
         __ testl(value.AsRegister<Register>(), value.AsRegister<Register>());
         __ j(kEqual, slow_path->GetEntryLabel());
@@ -3878,7 +3878,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (value.IsRegisterPair()) {
         Register temp = locations->GetTemp(0).AsRegister<Register>();
         __ movl(temp, value.AsRegisterPairLow<Register>());
@@ -3904,8 +3904,8 @@
       new (GetGraph()->GetArena()) LocationSummary(op, LocationSummary::kNoCall);
 
   switch (op->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       // Can't have Location::Any() and output SameAsFirstInput()
       locations->SetInAt(0, Location::RequiresRegister());
       // The shift count needs to be in CL or a constant.
@@ -3927,7 +3927,7 @@
   DCHECK(first.Equals(locations->Out()));
 
   switch (op->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       DCHECK(first.IsRegister());
       Register first_reg = first.AsRegister<Register>();
       if (second.IsRegister()) {
@@ -3956,7 +3956,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsRegister()) {
         Register second_reg = second.AsRegister<Register>();
         DCHECK_EQ(ECX, second_reg);
@@ -4000,10 +4000,10 @@
     codegen_->EmitParallelMoves(
         loc.ToLow(),
         loc.ToHigh(),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         Location::ConstantLocation(GetGraph()->GetIntConstant(0)),
         loc.ToLow(),
-        Primitive::kPrimInt);
+        DataType::Type::kInt32);
   } else if (shift > 32) {
     // Low part becomes 0.  High part is low part << (shift-32).
     __ movl(high, low);
@@ -4067,10 +4067,10 @@
     codegen_->EmitParallelMoves(
         loc.ToHigh(),
         loc.ToLow(),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         Location::ConstantLocation(GetGraph()->GetIntConstant(0)),
         loc.ToHigh(),
-        Primitive::kPrimInt);
+        DataType::Type::kInt32);
   } else if (shift > 32) {
     // Low part is high >> (shift - 32). High part becomes 0.
     __ movl(low, high);
@@ -4099,11 +4099,11 @@
       new (GetGraph()->GetArena()) LocationSummary(ror, LocationSummary::kNoCall);
 
   switch (ror->GetResultType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // Add the temporary needed.
       locations->AddTemp(Location::RequiresRegister());
       FALLTHROUGH_INTENDED;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetInAt(0, Location::RequiresRegister());
       // The shift count needs to be in CL (unless it is a constant).
       locations->SetInAt(1, Location::ByteRegisterOrConstant(ECX, ror->InputAt(1)));
@@ -4120,7 +4120,7 @@
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
 
-  if (ror->GetResultType() == Primitive::kPrimInt) {
+  if (ror->GetResultType() == DataType::Type::kInt32) {
     Register first_reg = first.AsRegister<Register>();
     if (second.IsRegister()) {
       Register second_reg = second.AsRegister<Register>();
@@ -4132,7 +4132,7 @@
     return;
   }
 
-  DCHECK_EQ(ror->GetResultType(), Primitive::kPrimLong);
+  DCHECK_EQ(ror->GetResultType(), DataType::Type::kInt64);
   Register first_reg_lo = first.AsRegisterPairLow<Register>();
   Register first_reg_hi = first.AsRegisterPairHigh<Register>();
   Register temp_reg = locations->GetTemp(0).AsRegister<Register>();
@@ -4315,11 +4315,11 @@
   Location out = locations->Out();
   DCHECK(in.Equals(out));
   switch (not_->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ notl(out.AsRegister<Register>());
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ notl(out.AsRegisterPairLow<Register>());
       __ notl(out.AsRegisterPairHigh<Register>());
       break;
@@ -4348,19 +4348,19 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(compare, LocationSummary::kNoCall);
   switch (compare->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       if (compare->InputAt(1)->IsX86LoadFromConstantTable()) {
         DCHECK(compare->InputAt(1)->IsEmittedAtUseSite());
@@ -4387,15 +4387,15 @@
   Condition less_cond = kLess;
 
   switch (compare->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       codegen_->GenerateIntCompare(left, right);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register left_low = left.AsRegisterPairLow<Register>();
       Register left_high = left.AsRegisterPairHigh<Register>();
       int32_t val_low = 0;
@@ -4431,13 +4431,13 @@
       less_cond = kBelow;  // for CF (unsigned).
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       GenerateFPCompare(left, right, compare, false);
       __ j(kUnordered, compare->IsGtBias() ? &greater : &less);
       less_cond = kBelow;  // for CF (floats).
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       GenerateFPCompare(left, right, compare, true);
       __ j(kUnordered, compare->IsGtBias() ? &greater : &less);
       less_cond = kBelow;  // for CF (floats).
@@ -4744,7 +4744,7 @@
   DCHECK(instruction->IsInstanceFieldGet() || instruction->IsStaticFieldGet());
 
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    kEmitCompilerReadBarrier ?
@@ -4755,7 +4755,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
 
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister());
   } else {
     // The output overlaps in case of long: we don't want the low move
@@ -4765,12 +4765,12 @@
     // the read barrier.
     locations->SetOut(
         Location::RequiresRegister(),
-        (object_field_get_with_read_barrier || instruction->GetType() == Primitive::kPrimLong) ?
+        (object_field_get_with_read_barrier || instruction->GetType() == DataType::Type::kInt64) ?
             Location::kOutputOverlap :
             Location::kNoOutputOverlap);
   }
 
-  if (field_info.IsVolatile() && (field_info.GetFieldType() == Primitive::kPrimLong)) {
+  if (field_info.IsVolatile() && (field_info.GetFieldType() == DataType::Type::kInt64)) {
     // Long values can be loaded atomically into an XMM using movsd.
     // So we use an XMM register as a temp to achieve atomicity (first
     // load the temp into the XMM and then copy the XMM into the
@@ -4788,35 +4788,35 @@
   Register base = base_loc.AsRegister<Register>();
   Location out = locations->Out();
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
 
   switch (field_type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       __ movzxb(out.AsRegister<Register>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       __ movsxb(out.AsRegister<Register>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       __ movsxw(out.AsRegister<Register>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       __ movzxw(out.AsRegister<Register>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ movl(out.AsRegister<Register>(), Address(base, offset));
       break;
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       // /* HeapReference<Object> */ out = *(base + offset)
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         // Note that a potential implicit null check is handled in this
@@ -4840,7 +4840,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (is_volatile) {
         XmmRegister temp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
         __ movsd(temp, Address(base, offset));
@@ -4857,22 +4857,22 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       __ movss(out.AsFpuRegister<XmmRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       __ movsd(out.AsFpuRegister<XmmRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
 
-  if (field_type == Primitive::kPrimNot || field_type == Primitive::kPrimLong) {
+  if (field_type == DataType::Type::kReference || field_type == DataType::Type::kInt64) {
     // Potential implicit null checks, in the case of reference or
     // long fields, are handled in the previous switch statement.
   } else {
@@ -4880,7 +4880,7 @@
   }
 
   if (is_volatile) {
-    if (field_type == Primitive::kPrimNot) {
+    if (field_type == DataType::Type::kReference) {
       // Memory barriers, in the case of references, are also handled
       // in the previous switch statement.
     } else {
@@ -4896,23 +4896,23 @@
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
   locations->SetInAt(0, Location::RequiresRegister());
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
-  bool is_byte_type = (field_type == Primitive::kPrimBoolean)
-    || (field_type == Primitive::kPrimByte);
+  DataType::Type field_type = field_info.GetFieldType();
+  bool is_byte_type = (field_type == DataType::Type::kBool)
+    || (field_type == DataType::Type::kInt8);
 
   // The register allocator does not support multiple
   // inputs that die at entry with one in a specific register.
   if (is_byte_type) {
     // Ensure the value is in a byte register.
     locations->SetInAt(1, Location::RegisterLocation(EAX));
-  } else if (Primitive::IsFloatingPointType(field_type)) {
-    if (is_volatile && field_type == Primitive::kPrimDouble) {
+  } else if (DataType::IsFloatingPointType(field_type)) {
+    if (is_volatile && field_type == DataType::Type::kFloat64) {
       // In order to satisfy the semantics of volatile, this must be a single instruction store.
       locations->SetInAt(1, Location::RequiresFpuRegister());
     } else {
       locations->SetInAt(1, Location::FpuRegisterOrConstant(instruction->InputAt(1)));
     }
-  } else if (is_volatile && field_type == Primitive::kPrimLong) {
+  } else if (is_volatile && field_type == DataType::Type::kInt64) {
     // In order to satisfy the semantics of volatile, this must be a single instruction store.
     locations->SetInAt(1, Location::RequiresRegister());
 
@@ -4944,7 +4944,7 @@
   Register base = locations->InAt(0).AsRegister<Register>();
   Location value = locations->InAt(1);
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(field_type, instruction->InputAt(1));
@@ -4956,14 +4956,14 @@
   bool maybe_record_implicit_null_check_done = false;
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       __ movb(Address(base, offset), value.AsRegister<ByteRegister>());
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       if (value.IsConstant()) {
         __ movw(Address(base, offset),
                 Immediate(CodeGenerator::GetInt16ValueOf(value.GetConstant())));
@@ -4973,13 +4973,13 @@
       break;
     }
 
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       if (kPoisonHeapReferences && needs_write_barrier) {
         // Note that in the case where `value` is a null reference,
         // we do not enter this block, as the reference does not
         // need poisoning.
-        DCHECK_EQ(field_type, Primitive::kPrimNot);
+        DCHECK_EQ(field_type, DataType::Type::kReference);
         Register temp = locations->GetTemp(0).AsRegister<Register>();
         __ movl(temp, value.AsRegister<Register>());
         __ PoisonHeapReference(temp);
@@ -4994,7 +4994,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (is_volatile) {
         XmmRegister temp1 = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
         XmmRegister temp2 = locations->GetTemp(1).AsFpuRegister<XmmRegister>();
@@ -5017,7 +5017,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (value.IsConstant()) {
         int32_t v = CodeGenerator::GetInt32ValueOf(value.GetConstant());
         __ movl(Address(base, offset), Immediate(v));
@@ -5027,7 +5027,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (value.IsConstant()) {
         int64_t v = CodeGenerator::GetInt64ValueOf(value.GetConstant());
         __ movl(Address(base, offset), Immediate(Low32Bits(v)));
@@ -5040,7 +5040,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
@@ -5205,7 +5205,7 @@
 
 void LocationsBuilderX86::VisitArrayGet(HArrayGet* instruction) {
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier ?
@@ -5216,7 +5216,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps in case of long: we don't want the low move
@@ -5226,9 +5226,9 @@
     // the read barrier.
     locations->SetOut(
         Location::RequiresRegister(),
-        (instruction->GetType() == Primitive::kPrimLong || object_array_get_with_read_barrier) ?
-            Location::kOutputOverlap :
-            Location::kNoOutputOverlap);
+        (instruction->GetType() == DataType::Type::kInt64 || object_array_get_with_read_barrier)
+            ? Location::kOutputOverlap
+            : Location::kNoOutputOverlap);
   }
 }
 
@@ -5240,27 +5240,27 @@
   Location out_loc = locations->Out();
   uint32_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   switch (type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       Register out = out_loc.AsRegister<Register>();
       __ movzxb(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_1, data_offset));
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       Register out = out_loc.AsRegister<Register>();
       __ movsxb(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_1, data_offset));
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       Register out = out_loc.AsRegister<Register>();
       __ movsxw(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_2, data_offset));
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       Register out = out_loc.AsRegister<Register>();
       if (mirror::kUseStringCompression && instruction->IsStringCharAt()) {
         // Branch cases into compressed and uncompressed for each index's type.
@@ -5284,13 +5284,13 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register out = out_loc.AsRegister<Register>();
       __ movl(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset));
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       static_assert(
           sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
           "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -5320,7 +5320,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       DCHECK_NE(obj, out_loc.AsRegisterPairLow<Register>());
       __ movl(out_loc.AsRegisterPairLow<Register>(),
               CodeGeneratorX86::ArrayAddress(obj, index, TIMES_8, data_offset));
@@ -5330,24 +5330,24 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
       __ movss(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_4, data_offset));
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
       __ movsd(out, CodeGeneratorX86::ArrayAddress(obj, index, TIMES_8, data_offset));
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
 
-  if (type == Primitive::kPrimNot || type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kReference || type == DataType::Type::kInt64) {
     // Potential implicit null checks, in the case of reference or
     // long arrays, are handled in the previous switch statement.
   } else {
@@ -5356,7 +5356,7 @@
 }
 
 void LocationsBuilderX86::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -5368,8 +5368,8 @@
           LocationSummary::kCallOnSlowPath :
           LocationSummary::kNoCall);
 
-  bool is_byte_type = (value_type == Primitive::kPrimBoolean)
-      || (value_type == Primitive::kPrimByte);
+  bool is_byte_type = (value_type == DataType::Type::kBool)
+      || (value_type == DataType::Type::kInt8);
   // We need the inputs to be different than the output in case of long operation.
   // In case of a byte operation, the register allocator does not support multiple
   // inputs that die at entry with one in a specific register.
@@ -5378,7 +5378,7 @@
   if (is_byte_type) {
     // Ensure the value is in a byte register.
     locations->SetInAt(2, Location::ByteRegisterOrConstant(EAX, instruction->InputAt(2)));
-  } else if (Primitive::IsFloatingPointType(value_type)) {
+  } else if (DataType::IsFloatingPointType(value_type)) {
     locations->SetInAt(2, Location::FpuRegisterOrConstant(instruction->InputAt(2)));
   } else {
     locations->SetInAt(2, Location::RegisterOrConstant(instruction->InputAt(2)));
@@ -5397,7 +5397,7 @@
   Register array = array_loc.AsRegister<Register>();
   Location index = locations->InAt(1);
   Location value = locations->InAt(2);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
   uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
   uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
@@ -5406,8 +5406,8 @@
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_1, offset);
       if (value.IsRegister()) {
@@ -5419,8 +5419,8 @@
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_2, offset);
       if (value.IsRegister()) {
@@ -5432,7 +5432,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
 
@@ -5528,7 +5528,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
       if (value.IsRegister()) {
@@ -5542,7 +5542,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t data_offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
       if (value.IsRegisterPair()) {
         __ movl(CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, data_offset),
@@ -5562,7 +5562,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_4, offset);
       if (value.IsFpuRegister()) {
@@ -5576,7 +5576,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
       Address address = CodeGeneratorX86::ArrayAddress(array, index, TIMES_8, offset);
       if (value.IsFpuRegister()) {
@@ -5593,7 +5593,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -5803,7 +5803,7 @@
       __ movl(Address(ESP, destination.GetStackIndex()), source.AsRegister<Register>());
     }
   } else if (source.IsRegisterPair()) {
-      size_t elem_size = Primitive::ComponentSize(Primitive::kPrimInt);
+      size_t elem_size = DataType::Size(DataType::Type::kInt32);
       // Create stack space for 2 elements.
       __ subl(ESP, Immediate(2 * elem_size));
       __ movl(Address(ESP, 0), source.AsRegisterPairLow<Register>());
@@ -6957,8 +6957,8 @@
 void LocationsBuilderX86::HandleBitwiseOperation(HBinaryOperation* instruction) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt
-         || instruction->GetResultType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32
+         || instruction->GetResultType() == DataType::Type::kInt64);
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::Any());
   locations->SetOut(Location::SameAsFirstInput());
@@ -6982,7 +6982,7 @@
   Location second = locations->InAt(1);
   DCHECK(first.Equals(locations->Out()));
 
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     if (second.IsRegister()) {
       if (instruction->IsAnd()) {
         __ andl(first.AsRegister<Register>(), second.AsRegister<Register>());
@@ -7015,7 +7015,7 @@
       }
     }
   } else {
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
     if (second.IsRegisterPair()) {
       if (instruction->IsAnd()) {
         __ andl(first.AsRegisterPairLow<Register>(), second.AsRegisterPairLow<Register>());
@@ -7557,12 +7557,12 @@
   }
 
   switch (insn->GetType()) {
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetOut(Location::RequiresFpuRegister());
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       locations->SetOut(Location::RequiresRegister());
       break;
 
@@ -7582,19 +7582,19 @@
   HConstant *value = insn->GetConstant();
 
   switch (insn->GetType()) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       __ movss(out.AsFpuRegister<XmmRegister>(),
                codegen_->LiteralFloatAddress(
                   value->AsFloatConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       __ movsd(out.AsFpuRegister<XmmRegister>(),
                codegen_->LiteralDoubleAddress(
                   value->AsDoubleConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ movl(out.AsRegister<Register>(),
               codegen_->LiteralInt32Address(
                   value->AsIntConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
@@ -7787,13 +7787,13 @@
 }
 
 // TODO: target as memory.
-void CodeGeneratorX86::MoveFromReturnRegister(Location target, Primitive::Type type) {
+void CodeGeneratorX86::MoveFromReturnRegister(Location target, DataType::Type type) {
   if (!target.IsValid()) {
-    DCHECK_EQ(type, Primitive::kPrimVoid);
+    DCHECK_EQ(type, DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
   Location return_loc = InvokeDexCallingConventionVisitorX86().GetReturnLocation(type);
   if (target.Equals(return_loc)) {
@@ -7802,10 +7802,10 @@
 
   // TODO: Consider pairs in the parallel move resolver, then this could be nicely merged
   //       with the else branch.
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     HParallelMove parallel_move(GetGraph()->GetArena());
-    parallel_move.AddMove(return_loc.ToLow(), target.ToLow(), Primitive::kPrimInt, nullptr);
-    parallel_move.AddMove(return_loc.ToHigh(), target.ToHigh(), Primitive::kPrimInt, nullptr);
+    parallel_move.AddMove(return_loc.ToLow(), target.ToLow(), DataType::Type::kInt32, nullptr);
+    parallel_move.AddMove(return_loc.ToHigh(), target.ToHigh(), DataType::Type::kInt32, nullptr);
     GetMoveResolver()->EmitNativeCode(&parallel_move);
   } else {
     // Let the parallel move resolver take care of all of this.
diff --git a/compiler/optimizing/code_generator_x86.h b/compiler/optimizing/code_generator_x86.h
index e8f919d..fb61e75 100644
--- a/compiler/optimizing/code_generator_x86.h
+++ b/compiler/optimizing/code_generator_x86.h
@@ -83,8 +83,8 @@
   InvokeDexCallingConventionVisitorX86() {}
   virtual ~InvokeDexCallingConventionVisitorX86() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE;
   Location GetMethodLocation() const OVERRIDE;
 
  private:
@@ -103,13 +103,13 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return Location::RegisterLocation(EAX);
   }
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? Location::RegisterPairLocation(EAX, EDX)
         : Location::RegisterLocation(EAX);
   }
-  Location GetSetValueLocation(Primitive::Type type, bool is_instance) const OVERRIDE {
-    return Primitive::Is64BitType(type)
+  Location GetSetValueLocation(DataType::Type type, bool is_instance) const OVERRIDE {
+    return DataType::Is64BitType(type)
         ? (is_instance
             ? Location::RegisterPairLocation(EDX, EBX)
             : Location::RegisterPairLocation(ECX, EDX))
@@ -117,7 +117,7 @@
             ? Location::RegisterLocation(EDX)
             : Location::RegisterLocation(ECX));
   }
-  Location GetFpuLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetFpuLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::FpuRegisterLocation(XMM0);
   }
 
@@ -321,7 +321,7 @@
   void GenerateFrameExit() OVERRIDE;
   void Bind(HBasicBlock* block) OVERRIDE;
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
   void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
 
   size_t SaveCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
@@ -428,7 +428,7 @@
                               dex::TypeIndex dex_index,
                               Handle<mirror::Class> handle);
 
-  void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
+  void MoveFromReturnRegister(Location trg, DataType::Type type) OVERRIDE;
 
   // Emit linker patches.
   void EmitLinkerPatches(ArenaVector<linker::LinkerPatch>* linker_patches) OVERRIDE;
@@ -456,8 +456,8 @@
     block_labels_ = CommonInitializeLabels<Label>();
   }
 
-  bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE {
-    return type == Primitive::kPrimLong;
+  bool NeedsTwoRegisters(DataType::Type type) const OVERRIDE {
+    return type == DataType::Type::kInt64;
   }
 
   bool ShouldSplitLongMoves() const OVERRIDE { return true; }
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 65b3f62..42704e9 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -106,12 +106,12 @@
 
 class DivRemMinusOneSlowPathX86_64 : public SlowPathCode {
  public:
-  DivRemMinusOneSlowPathX86_64(HInstruction* at, Register reg, Primitive::Type type, bool is_div)
+  DivRemMinusOneSlowPathX86_64(HInstruction* at, Register reg, DataType::Type type, bool is_div)
       : SlowPathCode(at), cpu_reg_(CpuRegister(reg)), type_(type), is_div_(is_div) {}
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
     __ Bind(GetEntryLabel());
-    if (type_ == Primitive::kPrimInt) {
+    if (type_ == DataType::Type::kInt32) {
       if (is_div_) {
         __ negl(cpu_reg_);
       } else {
@@ -119,7 +119,7 @@
       }
 
     } else {
-      DCHECK_EQ(Primitive::kPrimLong, type_);
+      DCHECK_EQ(DataType::Type::kInt64, type_);
       if (is_div_) {
         __ negq(cpu_reg_);
       } else {
@@ -133,7 +133,7 @@
 
  private:
   const CpuRegister cpu_reg_;
-  const Primitive::Type type_;
+  const DataType::Type type_;
   const bool is_div_;
   DISALLOW_COPY_AND_ASSIGN(DivRemMinusOneSlowPathX86_64);
 };
@@ -215,10 +215,10 @@
     codegen->EmitParallelMoves(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         length_loc,
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt);
+        DataType::Type::kInt32);
     QuickEntrypointEnum entrypoint = instruction_->AsBoundsCheck()->IsStringCharAt()
         ? kQuickThrowStringBounds
         : kQuickThrowArrayBounds;
@@ -360,10 +360,10 @@
     InvokeRuntimeCallingConvention calling_convention;
     codegen->EmitParallelMoves(locations->InAt(0),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                               Primitive::kPrimNot,
+                               DataType::Type::kReference,
                                locations->InAt(1),
                                Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                               Primitive::kPrimNot);
+                               DataType::Type::kReference);
     if (instruction_->IsInstanceOf()) {
       x86_64_codegen->InvokeRuntime(kQuickInstanceofNonTrivial, instruction_, dex_pc, this);
       CheckEntrypointTypes<kQuickInstanceofNonTrivial, size_t, mirror::Object*, mirror::Class*>();
@@ -431,17 +431,17 @@
     parallel_move.AddMove(
         locations->InAt(0),
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(1),
         Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     parallel_move.AddMove(
         locations->InAt(2),
         Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-        Primitive::kPrimNot,
+        DataType::Type::kReference,
         nullptr);
     codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
 
@@ -834,16 +834,16 @@
     HParallelMove parallel_move(codegen->GetGraph()->GetArena());
     parallel_move.AddMove(ref_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     parallel_move.AddMove(obj_,
                           Location::RegisterLocation(calling_convention.GetRegisterAt(1)),
-                          Primitive::kPrimNot,
+                          DataType::Type::kReference,
                           nullptr);
     if (index.IsValid()) {
       parallel_move.AddMove(index,
                             Location::RegisterLocation(calling_convention.GetRegisterAt(2)),
-                            Primitive::kPrimInt,
+                            DataType::Type::kInt32,
                             nullptr);
       codegen->GetMoveResolver()->EmitNativeCode(&parallel_move);
     } else {
@@ -1443,7 +1443,7 @@
 }
 
 void CodeGeneratorX86_64::MoveLocation(
-    Location dst, Location src, Primitive::Type dst_type ATTRIBUTE_UNUSED) {
+    Location dst, Location src, DataType::Type dst_type ATTRIBUTE_UNUSED) {
   Move(dst, src);
 }
 
@@ -1518,22 +1518,22 @@
 
   Location left = locations->InAt(0);
   Location right = locations->InAt(1);
-  Primitive::Type type = condition->InputAt(0)->GetType();
+  DataType::Type type = condition->InputAt(0)->GetType();
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       codegen_->GenerateIntCompare(left, right);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       codegen_->GenerateLongCompare(left, right);
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (right.IsFpuRegister()) {
         __ ucomiss(left.AsFpuRegister<XmmRegister>(), right.AsFpuRegister<XmmRegister>());
       } else if (right.IsConstant()) {
@@ -1547,7 +1547,7 @@
       }
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (right.IsFpuRegister()) {
         __ ucomisd(left.AsFpuRegister<XmmRegister>(), right.AsFpuRegister<XmmRegister>());
       } else if (right.IsConstant()) {
@@ -1580,17 +1580,17 @@
   GenerateCompareTest(condition);
 
   // Now generate the correct jump(s).
-  Primitive::Type type = condition->InputAt(0)->GetType();
+  DataType::Type type = condition->InputAt(0)->GetType();
   switch (type) {
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       __ j(X86_64IntegerCondition(condition->GetCondition()), true_target);
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       GenerateFPJumps(condition, true_target, false_target);
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       GenerateFPJumps(condition, true_target, false_target);
       break;
     }
@@ -1613,7 +1613,7 @@
   // conditions if they are materialized due to the complex branching.
   return cond->IsCondition() &&
          cond->GetNext() == branch &&
-         !Primitive::IsFloatingPointType(cond->InputAt(0)->GetType());
+         !DataType::IsFloatingPointType(cond->InputAt(0)->GetType());
 }
 
 template<class LabelType>
@@ -1677,8 +1677,8 @@
 
     // If this is a long or FP comparison that has been folded into
     // the HCondition, generate the comparison directly.
-    Primitive::Type type = condition->InputAt(0)->GetType();
-    if (type == Primitive::kPrimLong || Primitive::IsFloatingPointType(type)) {
+    DataType::Type type = condition->InputAt(0)->GetType();
+    if (type == DataType::Type::kInt64 || DataType::IsFloatingPointType(type)) {
       GenerateCompareTestAndBranch(condition, true_target, false_target);
       return;
     }
@@ -1750,14 +1750,14 @@
 
 static bool SelectCanUseCMOV(HSelect* select) {
   // There are no conditional move instructions for XMMs.
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     return false;
   }
 
   // A FP condition doesn't generate the single CC that we need.
   HInstruction* condition = select->GetCondition();
   if (condition->IsCondition() &&
-      Primitive::IsFloatingPointType(condition->InputAt(0)->GetType())) {
+      DataType::IsFloatingPointType(condition->InputAt(0)->GetType())) {
     return false;
   }
 
@@ -1767,7 +1767,7 @@
 
 void LocationsBuilderX86_64::VisitSelect(HSelect* select) {
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
-  if (Primitive::IsFloatingPointType(select->GetType())) {
+  if (DataType::IsFloatingPointType(select->GetType())) {
     locations->SetInAt(0, Location::RequiresFpuRegister());
     locations->SetInAt(1, Location::Any());
   } else {
@@ -1826,7 +1826,7 @@
 
     // If the condition is true, overwrite the output, which already contains false.
     // Generate the correct sized CMOV.
-    bool is_64_bit = Primitive::Is64BitType(select->GetType());
+    bool is_64_bit = DataType::Is64BitType(select->GetType());
     if (value_true_loc.IsRegister()) {
       __ cmov(cond, value_false, value_true_loc.AsRegister<CpuRegister>(), is_64_bit);
     } else {
@@ -1862,12 +1862,12 @@
       new (GetGraph()->GetArena()) LocationSummary(cond, LocationSummary::kNoCall);
   // Handle the long/FP comparisons made in instruction simplification.
   switch (cond->InputAt(0)->GetType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       break;
@@ -1902,14 +1902,14 @@
       codegen_->GenerateIntCompare(lhs, rhs);
       __ setcc(X86_64IntegerCondition(cond->GetCondition()), reg);
       return;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // Clear output register: setcc only sets the low byte.
       __ xorl(reg, reg);
 
       codegen_->GenerateLongCompare(lhs, rhs);
       __ setcc(X86_64IntegerCondition(cond->GetCondition()), reg);
       return;
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       XmmRegister lhs_reg = lhs.AsFpuRegister<XmmRegister>();
       if (rhs.IsConstant()) {
         float value = rhs.GetConstant()->AsFloatConstant()->GetValue();
@@ -1922,7 +1922,7 @@
       GenerateFPJumps(cond, &true_label, &false_label);
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       XmmRegister lhs_reg = lhs.AsFpuRegister<XmmRegister>();
       if (rhs.IsConstant()) {
         double value = rhs.GetConstant()->AsDoubleConstant()->GetValue();
@@ -2035,19 +2035,19 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(compare, LocationSummary::kNoCall);
   switch (compare->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::RequiresRegister());
@@ -2065,23 +2065,23 @@
   Location right = locations->InAt(1);
 
   NearLabel less, greater, done;
-  Primitive::Type type = compare->InputAt(0)->GetType();
+  DataType::Type type = compare->InputAt(0)->GetType();
   Condition less_cond = kLess;
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       codegen_->GenerateIntCompare(left, right);
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       codegen_->GenerateLongCompare(left, right);
       break;
     }
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       XmmRegister left_reg = left.AsFpuRegister<XmmRegister>();
       if (right.IsConstant()) {
         float value = right.GetConstant()->AsFloatConstant()->GetValue();
@@ -2095,7 +2095,7 @@
       less_cond = kBelow;  //  ucomis{s,d} sets CF
       break;
     }
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       XmmRegister left_reg = left.AsFpuRegister<XmmRegister>();
       if (right.IsConstant()) {
         double value = right.GetConstant()->AsDoubleConstant()->GetValue();
@@ -2207,18 +2207,18 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(ret, LocationSummary::kNoCall);
   switch (ret->InputAt(0)->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RegisterLocation(RAX));
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::FpuRegisterLocation(XMM0));
       break;
 
@@ -2230,18 +2230,18 @@
 void InstructionCodeGeneratorX86_64::VisitReturn(HReturn* ret) {
   if (kIsDebugBuild) {
     switch (ret->InputAt(0)->GetType()) {
-      case Primitive::kPrimBoolean:
-      case Primitive::kPrimByte:
-      case Primitive::kPrimChar:
-      case Primitive::kPrimShort:
-      case Primitive::kPrimInt:
-      case Primitive::kPrimNot:
-      case Primitive::kPrimLong:
+      case DataType::Type::kBool:
+      case DataType::Type::kInt8:
+      case DataType::Type::kUint16:
+      case DataType::Type::kInt16:
+      case DataType::Type::kInt32:
+      case DataType::Type::kReference:
+      case DataType::Type::kInt64:
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsRegister<CpuRegister>().AsRegister(), RAX);
         break;
 
-      case Primitive::kPrimFloat:
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat32:
+      case DataType::Type::kFloat64:
         DCHECK_EQ(ret->GetLocations()->InAt(0).AsFpuRegister<XmmRegister>().AsFloatRegister(),
                   XMM0);
         break;
@@ -2253,22 +2253,22 @@
   codegen_->GenerateFrameExit();
 }
 
-Location InvokeDexCallingConventionVisitorX86_64::GetReturnLocation(Primitive::Type type) const {
+Location InvokeDexCallingConventionVisitorX86_64::GetReturnLocation(DataType::Type type) const {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-    case Primitive::kPrimLong:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt64:
       return Location::RegisterLocation(RAX);
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       return Location::NoLocation();
 
-    case Primitive::kPrimDouble:
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat64:
+    case DataType::Type::kFloat32:
       return Location::FpuRegisterLocation(XMM0);
   }
 
@@ -2279,14 +2279,14 @@
   return Location::RegisterLocation(kMethodRegisterArgument);
 }
 
-Location InvokeDexCallingConventionVisitorX86_64::GetNextLocation(Primitive::Type type) {
+Location InvokeDexCallingConventionVisitorX86_64::GetNextLocation(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       uint32_t index = gp_index_++;
       stack_index_++;
       if (index < calling_convention.GetNumberOfRegisters()) {
@@ -2296,7 +2296,7 @@
       }
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t index = gp_index_;
       stack_index_ += 2;
       if (index < calling_convention.GetNumberOfRegisters()) {
@@ -2308,7 +2308,7 @@
       }
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t index = float_index_++;
       stack_index_++;
       if (index < calling_convention.GetNumberOfFpuRegisters()) {
@@ -2318,7 +2318,7 @@
       }
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t index = float_index_++;
       stack_index_ += 2;
       if (index < calling_convention.GetNumberOfFpuRegisters()) {
@@ -2328,7 +2328,7 @@
       }
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unexpected parameter type " << type;
       break;
   }
@@ -2469,14 +2469,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetOut(Location::SameAsFirstInput());
       break;
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetOut(Location::SameAsFirstInput());
       locations->AddTemp(Location::RequiresFpuRegister());
@@ -2492,19 +2492,19 @@
   Location out = locations->Out();
   Location in = locations->InAt(0);
   switch (neg->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       DCHECK(in.IsRegister());
       DCHECK(in.Equals(out));
       __ negl(out.AsRegister<CpuRegister>());
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       DCHECK(in.IsRegister());
       DCHECK(in.Equals(out));
       __ negq(out.AsRegister<CpuRegister>());
       break;
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       DCHECK(in.Equals(out));
       XmmRegister mask = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       // Implement float negation with an exclusive or with value
@@ -2515,7 +2515,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       DCHECK(in.Equals(out));
       XmmRegister mask = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
       // Implement double negation with an exclusive or with value
@@ -2534,23 +2534,23 @@
 void LocationsBuilderX86_64::VisitTypeConversion(HTypeConversion* conversion) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(conversion, LocationSummary::kNoCall);
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
 
   // The Java language does not allow treating boolean as an integral type but
   // our bit representation makes it safe.
 
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to byte is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2562,15 +2562,15 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2582,21 +2582,21 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-int' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
@@ -2608,14 +2608,14 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           // TODO: We would benefit from a (to-be-implemented)
           // Location::RegisterOrStackSlot requirement for this input.
@@ -2623,13 +2623,13 @@
           locations->SetOut(Location::RequiresRegister());
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-long' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-long' instruction.
           locations->SetInAt(0, Location::RequiresFpuRegister());
           locations->SetOut(Location::RequiresRegister());
@@ -2641,15 +2641,15 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to char is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `int-to-char' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
@@ -2661,26 +2661,26 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-float' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-float' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -2692,26 +2692,26 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-double' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-double' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister());
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           locations->SetInAt(0, Location::Any());
           locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
@@ -2733,19 +2733,19 @@
   LocationSummary* locations = conversion->GetLocations();
   Location out = locations->Out();
   Location in = locations->InAt(0);
-  Primitive::Type result_type = conversion->GetResultType();
-  Primitive::Type input_type = conversion->GetInputType();
+  DataType::Type result_type = conversion->GetResultType();
+  DataType::Type input_type = conversion->GetInputType();
   DCHECK_NE(result_type, input_type);
   switch (result_type) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to byte is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-byte' instruction.
           if (in.IsRegister()) {
             __ movsxb(out.AsRegister<CpuRegister>(), in.AsRegister<CpuRegister>());
@@ -2764,15 +2764,15 @@
       }
       break;
 
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to short is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-short' instruction.
           if (in.IsRegister()) {
             __ movsxw(out.AsRegister<CpuRegister>(), in.AsRegister<CpuRegister>());
@@ -2791,9 +2791,9 @@
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-int' instruction.
           if (in.IsRegister()) {
             __ movl(out.AsRegister<CpuRegister>(), in.AsRegister<CpuRegister>());
@@ -2808,7 +2808,7 @@
           }
           break;
 
-        case Primitive::kPrimFloat: {
+        case DataType::Type::kFloat32: {
           // Processing a Dex `float-to-int' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           CpuRegister output = out.AsRegister<CpuRegister>();
@@ -2830,7 +2830,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat64: {
           // Processing a Dex `double-to-int' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           CpuRegister output = out.AsRegister<CpuRegister>();
@@ -2858,21 +2858,21 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
         DCHECK(out.IsRegister());
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-long' instruction.
           DCHECK(in.IsRegister());
           __ movsxd(out.AsRegister<CpuRegister>(), in.AsRegister<CpuRegister>());
           break;
 
-        case Primitive::kPrimFloat: {
+        case DataType::Type::kFloat32: {
           // Processing a Dex `float-to-long' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           CpuRegister output = out.AsRegister<CpuRegister>();
@@ -2894,7 +2894,7 @@
           break;
         }
 
-        case Primitive::kPrimDouble: {
+        case DataType::Type::kFloat64: {
           // Processing a Dex `double-to-long' instruction.
           XmmRegister input = in.AsFpuRegister<XmmRegister>();
           CpuRegister output = out.AsRegister<CpuRegister>();
@@ -2922,15 +2922,15 @@
       }
       break;
 
-    case Primitive::kPrimChar:
+    case DataType::Type::kUint16:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Type conversion from long to char is a result of code transformations.
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // Processing a Dex `int-to-char' instruction.
           if (in.IsRegister()) {
             __ movzxw(out.AsRegister<CpuRegister>(), in.AsRegister<CpuRegister>());
@@ -2949,14 +2949,14 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-float' instruction.
           if (in.IsRegister()) {
             __ cvtsi2ss(out.AsFpuRegister<XmmRegister>(), in.AsRegister<CpuRegister>(), false);
@@ -2970,7 +2970,7 @@
           }
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-float' instruction.
           if (in.IsRegister()) {
             __ cvtsi2ss(out.AsFpuRegister<XmmRegister>(), in.AsRegister<CpuRegister>(), true);
@@ -2984,7 +2984,7 @@
           }
           break;
 
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           // Processing a Dex `double-to-float' instruction.
           if (in.IsFpuRegister()) {
             __ cvtsd2ss(out.AsFpuRegister<XmmRegister>(), in.AsFpuRegister<XmmRegister>());
@@ -3004,14 +3004,14 @@
       };
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           // Boolean input is a result of code transformations.
-        case Primitive::kPrimByte:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
+        case DataType::Type::kInt8:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
           // Processing a Dex `int-to-double' instruction.
           if (in.IsRegister()) {
             __ cvtsi2sd(out.AsFpuRegister<XmmRegister>(), in.AsRegister<CpuRegister>(), false);
@@ -3025,7 +3025,7 @@
           }
           break;
 
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // Processing a Dex `long-to-double' instruction.
           if (in.IsRegister()) {
             __ cvtsi2sd(out.AsFpuRegister<XmmRegister>(), in.AsRegister<CpuRegister>(), true);
@@ -3039,7 +3039,7 @@
           }
           break;
 
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           // Processing a Dex `float-to-double' instruction.
           if (in.IsFpuRegister()) {
             __ cvtss2sd(out.AsFpuRegister<XmmRegister>(), in.AsFpuRegister<XmmRegister>());
@@ -3069,14 +3069,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(add, LocationSummary::kNoCall);
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrConstant(add->InputAt(1)));
       locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       // We can use a leaq or addq if the constant can fit in an immediate.
       locations->SetInAt(1, Location::RegisterOrInt32Constant(add->InputAt(1)));
@@ -3084,8 +3084,8 @@
       break;
     }
 
-    case Primitive::kPrimDouble:
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat64:
+    case DataType::Type::kFloat32: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
@@ -3104,7 +3104,7 @@
   Location out = locations->Out();
 
   switch (add->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (second.IsRegister()) {
         if (out.AsRegister<Register>() == first.AsRegister<Register>()) {
           __ addl(out.AsRegister<CpuRegister>(), second.AsRegister<CpuRegister>());
@@ -3129,7 +3129,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsRegister()) {
         if (out.AsRegister<Register>() == first.AsRegister<Register>()) {
           __ addq(out.AsRegister<CpuRegister>(), second.AsRegister<CpuRegister>());
@@ -3154,7 +3154,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ addss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3169,7 +3169,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ addsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3193,20 +3193,20 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(sub, LocationSummary::kNoCall);
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::RegisterOrInt32Constant(sub->InputAt(1)));
       locations->SetOut(Location::SameAsFirstInput());
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
@@ -3223,7 +3223,7 @@
   Location second = locations->InAt(1);
   DCHECK(first.Equals(locations->Out()));
   switch (sub->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (second.IsRegister()) {
         __ subl(first.AsRegister<CpuRegister>(), second.AsRegister<CpuRegister>());
       } else if (second.IsConstant()) {
@@ -3234,7 +3234,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsConstant()) {
         int64_t value = second.GetConstant()->AsLongConstant()->GetValue();
         DCHECK(IsInt<32>(value));
@@ -3245,7 +3245,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ subss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3260,7 +3260,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ subsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3284,7 +3284,7 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(mul, LocationSummary::kNoCall);
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       if (mul->InputAt(1)->IsIntConstant()) {
@@ -3295,7 +3295,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       locations->SetInAt(1, Location::Any());
       if (mul->InputAt(1)->IsLongConstant() &&
@@ -3307,8 +3307,8 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
@@ -3326,7 +3326,7 @@
   Location second = locations->InAt(1);
   Location out = locations->Out();
   switch (mul->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       // The constant may have ended up in a register, so test explicitly to avoid
       // problems where the output may not be the same as the first operand.
       if (mul->InputAt(1)->IsIntConstant()) {
@@ -3342,7 +3342,7 @@
                  Address(CpuRegister(RSP), second.GetStackIndex()));
       }
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       // The constant may have ended up in a register, so test explicitly to avoid
       // problems where the output may not be the same as the first operand.
       if (mul->InputAt(1)->IsLongConstant()) {
@@ -3367,7 +3367,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       DCHECK(first.Equals(out));
       if (second.IsFpuRegister()) {
         __ mulss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
@@ -3383,7 +3383,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       DCHECK(first.Equals(out));
       if (second.IsFpuRegister()) {
         __ mulsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
@@ -3427,9 +3427,9 @@
 }
 
 void InstructionCodeGeneratorX86_64::GenerateRemFP(HRem *rem) {
-  Primitive::Type type = rem->GetResultType();
-  bool is_float = type == Primitive::kPrimFloat;
-  size_t elem_size = Primitive::ComponentSize(type);
+  DataType::Type type = rem->GetResultType();
+  bool is_float = type == DataType::Type::kFloat32;
+  size_t elem_size = DataType::Size(type);
   LocationSummary* locations = rem->GetLocations();
   Location first = locations->InAt(0);
   Location second = locations->InAt(1);
@@ -3493,7 +3493,7 @@
   DCHECK(imm == 1 || imm == -1);
 
   switch (instruction->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (instruction->IsRem()) {
         __ xorl(output_register, output_register);
       } else {
@@ -3505,7 +3505,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (instruction->IsRem()) {
         __ xorl(output_register, output_register);
       } else {
@@ -3535,7 +3535,7 @@
 
   CpuRegister tmp = locations->GetTemp(0).AsRegister<CpuRegister>();
 
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     __ leal(tmp, Address(numerator, abs_imm - 1));
     __ testl(numerator, numerator);
     __ cmov(kGreaterEqual, tmp, numerator);
@@ -3548,7 +3548,7 @@
 
     __ movl(output_register, tmp);
   } else {
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
     CpuRegister rdx = locations->GetTemp(0).AsRegister<CpuRegister>();
 
     codegen_->Load64BitValue(rdx, abs_imm - 1);
@@ -3591,7 +3591,7 @@
   int shift;
 
   // TODO: can these branches be written as one?
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     int imm = second.GetConstant()->AsIntConstant()->GetValue();
 
     CalculateMagicAndShiftForDivRem(imm, false /* is_long */, &magic, &shift);
@@ -3626,7 +3626,7 @@
   } else {
     int64_t imm = second.GetConstant()->AsLongConstant()->GetValue();
 
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
 
     CpuRegister rax = eax;
     CpuRegister rdx = edx;
@@ -3679,8 +3679,8 @@
 
 void InstructionCodeGeneratorX86_64::GenerateDivRemIntegral(HBinaryOperation* instruction) {
   DCHECK(instruction->IsDiv() || instruction->IsRem());
-  Primitive::Type type = instruction->GetResultType();
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DataType::Type type = instruction->GetResultType();
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   bool is_div = instruction->IsDiv();
   LocationSummary* locations = instruction->GetLocations();
@@ -3714,7 +3714,7 @@
     // 0x80000000(00000000)/-1 triggers an arithmetic exception!
     // Dividing by -1 is actually negation and -0x800000000(00000000) = 0x80000000(00000000)
     // so it's safe to just use negl instead of more complex comparisons.
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       __ cmpl(second_reg, Immediate(-1));
       __ j(kEqual, slow_path->GetEntryLabel());
       // edx:eax <- sign-extended of eax
@@ -3737,8 +3737,8 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(div, LocationSummary::kNoCall);
   switch (div->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RegisterLocation(RAX));
       locations->SetInAt(1, Location::RegisterOrConstant(div->InputAt(1)));
       locations->SetOut(Location::SameAsFirstInput());
@@ -3753,8 +3753,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::RequiresFpuRegister());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::SameAsFirstInput());
@@ -3772,15 +3772,15 @@
   Location second = locations->InAt(1);
   DCHECK(first.Equals(locations->Out()));
 
-  Primitive::Type type = div->GetResultType();
+  DataType::Type type = div->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GenerateDivRemIntegral(div);
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (second.IsFpuRegister()) {
         __ divss(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3795,7 +3795,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (second.IsFpuRegister()) {
         __ divsd(first.AsFpuRegister<XmmRegister>(), second.AsFpuRegister<XmmRegister>());
       } else if (second.IsConstant()) {
@@ -3816,13 +3816,13 @@
 }
 
 void LocationsBuilderX86_64::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   LocationSummary* locations =
     new (GetGraph()->GetArena()) LocationSummary(rem, LocationSummary::kNoCall);
 
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RegisterLocation(RAX));
       locations->SetInAt(1, Location::RegisterOrConstant(rem->InputAt(1)));
       // Intel uses rdx:rax as the dividend and puts the remainder in rdx
@@ -3836,8 +3836,8 @@
       break;
     }
 
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       locations->SetInAt(0, Location::Any());
       locations->SetInAt(1, Location::Any());
       locations->SetOut(Location::RequiresFpuRegister());
@@ -3851,15 +3851,15 @@
 }
 
 void InstructionCodeGeneratorX86_64::VisitRem(HRem* rem) {
-  Primitive::Type type = rem->GetResultType();
+  DataType::Type type = rem->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       GenerateDivRemIntegral(rem);
       break;
     }
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64: {
       GenerateRemFP(rem);
       break;
     }
@@ -3882,11 +3882,11 @@
   Location value = locations->InAt(0);
 
   switch (instruction->GetType()) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32: {
       if (value.IsRegister()) {
         __ testl(value.AsRegister<CpuRegister>(), value.AsRegister<CpuRegister>());
         __ j(kEqual, slow_path->GetEntryLabel());
@@ -3901,7 +3901,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (value.IsRegister()) {
         __ testq(value.AsRegister<CpuRegister>(), value.AsRegister<CpuRegister>());
         __ j(kEqual, slow_path->GetEntryLabel());
@@ -3928,8 +3928,8 @@
       new (GetGraph()->GetArena()) LocationSummary(op, LocationSummary::kNoCall);
 
   switch (op->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       // The shift count needs to be in CL.
       locations->SetInAt(1, Location::ByteRegisterOrConstant(RCX, op->InputAt(1)));
@@ -3949,7 +3949,7 @@
   Location second = locations->InAt(1);
 
   switch (op->GetResultType()) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       if (second.IsRegister()) {
         CpuRegister second_reg = second.AsRegister<CpuRegister>();
         if (op->IsShl()) {
@@ -3971,7 +3971,7 @@
       }
       break;
     }
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (second.IsRegister()) {
         CpuRegister second_reg = second.AsRegister<CpuRegister>();
         if (op->IsShl()) {
@@ -4004,8 +4004,8 @@
       new (GetGraph()->GetArena()) LocationSummary(ror, LocationSummary::kNoCall);
 
   switch (ror->GetResultType()) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64: {
       locations->SetInAt(0, Location::RequiresRegister());
       // The shift count needs to be in CL (unless it is a constant).
       locations->SetInAt(1, Location::ByteRegisterOrConstant(RCX, ror->InputAt(1)));
@@ -4024,7 +4024,7 @@
   Location second = locations->InAt(1);
 
   switch (ror->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       if (second.IsRegister()) {
         CpuRegister second_reg = second.AsRegister<CpuRegister>();
         __ rorl(first_reg, second_reg);
@@ -4033,7 +4033,7 @@
         __ rorl(first_reg, imm);
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (second.IsRegister()) {
         CpuRegister second_reg = second.AsRegister<CpuRegister>();
         __ rorq(first_reg, second_reg);
@@ -4186,11 +4186,11 @@
             locations->Out().AsRegister<CpuRegister>().AsRegister());
   Location out = locations->Out();
   switch (not_->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ notl(out.AsRegister<CpuRegister>());
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ notq(out.AsRegister<CpuRegister>());
       break;
 
@@ -4255,7 +4255,7 @@
   DCHECK(instruction->IsInstanceFieldGet() || instruction->IsStaticFieldGet());
 
   bool object_field_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_field_get_with_read_barrier ?
@@ -4265,7 +4265,7 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
   locations->SetInAt(0, Location::RequiresRegister());
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister());
   } else {
     // The output overlaps for an object field get when read barriers
@@ -4286,36 +4286,36 @@
   CpuRegister base = base_loc.AsRegister<CpuRegister>();
   Location out = locations->Out();
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
 
   switch (field_type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       __ movzxb(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       __ movsxb(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       __ movsxw(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       __ movzxw(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       __ movl(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       // /* HeapReference<Object> */ out = *(base + offset)
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         // Note that a potential implicit null check is handled in this
@@ -4339,27 +4339,27 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       __ movq(out.AsRegister<CpuRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       __ movss(out.AsFpuRegister<XmmRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       __ movsd(out.AsFpuRegister<XmmRegister>(), Address(base, offset));
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
 
-  if (field_type == Primitive::kPrimNot) {
+  if (field_type == DataType::Type::kReference) {
     // Potential implicit null checks, in the case of reference
     // fields, are handled in the previous switch statement.
   } else {
@@ -4367,7 +4367,7 @@
   }
 
   if (is_volatile) {
-    if (field_type == Primitive::kPrimNot) {
+    if (field_type == DataType::Type::kReference) {
       // Memory barriers, in the case of references, are also handled
       // in the previous switch statement.
     } else {
@@ -4382,13 +4382,13 @@
 
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   bool is_volatile = field_info.IsVolatile();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(field_type, instruction->InputAt(1));
 
   locations->SetInAt(0, Location::RequiresRegister());
-  if (Primitive::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->InputAt(1)->GetType())) {
     if (is_volatile) {
       // In order to satisfy the semantics of volatile, this must be a single instruction store.
       locations->SetInAt(1, Location::FpuRegisterOrInt32Constant(instruction->InputAt(1)));
@@ -4407,7 +4407,7 @@
     // Temporary registers for the write barrier.
     locations->AddTemp(Location::RequiresRegister());  // Possibly used for reference poisoning too.
     locations->AddTemp(Location::RequiresRegister());
-  } else if (kPoisonHeapReferences && field_type == Primitive::kPrimNot) {
+  } else if (kPoisonHeapReferences && field_type == DataType::Type::kReference) {
     // Temporary register for the reference poisoning.
     locations->AddTemp(Location::RequiresRegister());
   }
@@ -4422,7 +4422,7 @@
   CpuRegister base = locations->InAt(0).AsRegister<CpuRegister>();
   Location value = locations->InAt(1);
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   uint32_t offset = field_info.GetFieldOffset().Uint32Value();
 
   if (is_volatile) {
@@ -4432,8 +4432,8 @@
   bool maybe_record_implicit_null_check_done = false;
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       if (value.IsConstant()) {
         __ movb(Address(base, offset),
                 Immediate(CodeGenerator::GetInt8ValueOf(value.GetConstant())));
@@ -4443,8 +4443,8 @@
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       if (value.IsConstant()) {
         __ movw(Address(base, offset),
                 Immediate(CodeGenerator::GetInt16ValueOf(value.GetConstant())));
@@ -4454,17 +4454,17 @@
       break;
     }
 
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot: {
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference: {
       if (value.IsConstant()) {
         int32_t v = CodeGenerator::GetInt32ValueOf(value.GetConstant());
-        // `field_type == Primitive::kPrimNot` implies `v == 0`.
-        DCHECK((field_type != Primitive::kPrimNot) || (v == 0));
+        // `field_type == DataType::Type::kReference` implies `v == 0`.
+        DCHECK((field_type != DataType::Type::kReference) || (v == 0));
         // Note: if heap poisoning is enabled, no need to poison
         // (negate) `v` if it is a reference, as it would be null.
         __ movl(Address(base, offset), Immediate(v));
       } else {
-        if (kPoisonHeapReferences && field_type == Primitive::kPrimNot) {
+        if (kPoisonHeapReferences && field_type == DataType::Type::kReference) {
           CpuRegister temp = locations->GetTemp(0).AsRegister<CpuRegister>();
           __ movl(temp, value.AsRegister<CpuRegister>());
           __ PoisonHeapReference(temp);
@@ -4476,7 +4476,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (value.IsConstant()) {
         int64_t v = value.GetConstant()->AsLongConstant()->GetValue();
         codegen_->MoveInt64ToAddress(Address(base, offset),
@@ -4490,7 +4490,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (value.IsConstant()) {
         int32_t v =
             bit_cast<int32_t, float>(value.GetConstant()->AsFloatConstant()->GetValue());
@@ -4501,7 +4501,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (value.IsConstant()) {
         int64_t v =
             bit_cast<int64_t, double>(value.GetConstant()->AsDoubleConstant()->GetValue());
@@ -4516,7 +4516,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << field_type;
       UNREACHABLE();
   }
@@ -4681,7 +4681,7 @@
 
 void LocationsBuilderX86_64::VisitArrayGet(HArrayGet* instruction) {
   bool object_array_get_with_read_barrier =
-      kEmitCompilerReadBarrier && (instruction->GetType() == Primitive::kPrimNot);
+      kEmitCompilerReadBarrier && (instruction->GetType() == DataType::Type::kReference);
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction,
                                                    object_array_get_with_read_barrier ?
@@ -4692,7 +4692,7 @@
   }
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(instruction->GetType())) {
+  if (DataType::IsFloatingPointType(instruction->GetType())) {
     locations->SetOut(Location::RequiresFpuRegister(), Location::kNoOutputOverlap);
   } else {
     // The output overlaps for an object array get when read barriers
@@ -4712,27 +4712,27 @@
   Location out_loc = locations->Out();
   uint32_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
 
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   switch (type) {
-    case Primitive::kPrimBoolean: {
+    case DataType::Type::kBool: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       __ movzxb(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_1, data_offset));
       break;
     }
 
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt8: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       __ movsxb(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_1, data_offset));
       break;
     }
 
-    case Primitive::kPrimShort: {
+    case DataType::Type::kInt16: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       __ movsxw(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_2, data_offset));
       break;
     }
 
-    case Primitive::kPrimChar: {
+    case DataType::Type::kUint16: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       if (mirror::kUseStringCompression && instruction->IsStringCharAt()) {
         // Branch cases into compressed and uncompressed for each index's type.
@@ -4754,13 +4754,13 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       __ movl(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset));
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       static_assert(
           sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
           "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
@@ -4790,30 +4790,30 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       CpuRegister out = out_loc.AsRegister<CpuRegister>();
       __ movq(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_8, data_offset));
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
       __ movss(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_4, data_offset));
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       XmmRegister out = out_loc.AsFpuRegister<XmmRegister>();
       __ movsd(out, CodeGeneratorX86_64::ArrayAddress(obj, index, TIMES_8, data_offset));
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << type;
       UNREACHABLE();
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Potential implicit null checks, in the case of reference
     // arrays, are handled in the previous switch statement.
   } else {
@@ -4822,7 +4822,7 @@
 }
 
 void LocationsBuilderX86_64::VisitArraySet(HArraySet* instruction) {
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
 
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -4836,7 +4836,7 @@
 
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
-  if (Primitive::IsFloatingPointType(value_type)) {
+  if (DataType::IsFloatingPointType(value_type)) {
     locations->SetInAt(2, Location::FpuRegisterOrConstant(instruction->InputAt(2)));
   } else {
     locations->SetInAt(2, Location::RegisterOrConstant(instruction->InputAt(2)));
@@ -4855,7 +4855,7 @@
   CpuRegister array = array_loc.AsRegister<CpuRegister>();
   Location index = locations->InAt(1);
   Location value = locations->InAt(2);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   bool may_need_runtime_call_for_type_check = instruction->NeedsTypeCheck();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(value_type, instruction->GetValue());
@@ -4864,8 +4864,8 @@
   uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(uint8_t)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_1, offset);
       if (value.IsRegister()) {
@@ -4877,8 +4877,8 @@
       break;
     }
 
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(uint16_t)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_2, offset);
       if (value.IsRegister()) {
@@ -4891,7 +4891,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
 
@@ -4987,7 +4987,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(int32_t)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
       if (value.IsRegister()) {
@@ -5001,7 +5001,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(int64_t)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset);
       if (value.IsRegister()) {
@@ -5016,7 +5016,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(float)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_4, offset);
       if (value.IsFpuRegister()) {
@@ -5030,7 +5030,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       uint32_t offset = mirror::Array::DataOffset(sizeof(double)).Uint32Value();
       Address address = CodeGeneratorX86_64::ArrayAddress(array, index, TIMES_8, offset);
       if (value.IsFpuRegister()) {
@@ -5046,7 +5046,7 @@
       break;
     }
 
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unreachable type " << instruction->GetType();
       UNREACHABLE();
   }
@@ -6361,8 +6361,8 @@
 void LocationsBuilderX86_64::HandleBitwiseOperation(HBinaryOperation* instruction) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
-  DCHECK(instruction->GetResultType() == Primitive::kPrimInt
-         || instruction->GetResultType() == Primitive::kPrimLong);
+  DCHECK(instruction->GetResultType() == DataType::Type::kInt32
+         || instruction->GetResultType() == DataType::Type::kInt64);
   locations->SetInAt(0, Location::RequiresRegister());
   locations->SetInAt(1, Location::Any());
   locations->SetOut(Location::SameAsFirstInput());
@@ -6386,7 +6386,7 @@
   Location second = locations->InAt(1);
   DCHECK(first.Equals(locations->Out()));
 
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     if (second.IsRegister()) {
       if (instruction->IsAnd()) {
         __ andl(first.AsRegister<CpuRegister>(), second.AsRegister<CpuRegister>());
@@ -6418,7 +6418,7 @@
       }
     }
   } else {
-    DCHECK_EQ(instruction->GetResultType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetResultType(), DataType::Type::kInt64);
     CpuRegister first_reg = first.AsRegister<CpuRegister>();
     bool second_is_constant = false;
     int64_t value = 0;
@@ -7096,13 +7096,13 @@
 }
 
 // TODO: trg as memory.
-void CodeGeneratorX86_64::MoveFromReturnRegister(Location trg, Primitive::Type type) {
+void CodeGeneratorX86_64::MoveFromReturnRegister(Location trg, DataType::Type type) {
   if (!trg.IsValid()) {
-    DCHECK_EQ(type, Primitive::kPrimVoid);
+    DCHECK_EQ(type, DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
   Location return_loc = InvokeDexCallingConventionVisitorX86_64().GetReturnLocation(type);
   if (trg.Equals(return_loc)) {
diff --git a/compiler/optimizing/code_generator_x86_64.h b/compiler/optimizing/code_generator_x86_64.h
index 8e8e695..6f67a45 100644
--- a/compiler/optimizing/code_generator_x86_64.h
+++ b/compiler/optimizing/code_generator_x86_64.h
@@ -89,16 +89,16 @@
   Location GetFieldIndexLocation() const OVERRIDE {
     return Location::RegisterLocation(RDI);
   }
-  Location GetReturnLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetReturnLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::RegisterLocation(RAX);
   }
-  Location GetSetValueLocation(Primitive::Type type ATTRIBUTE_UNUSED, bool is_instance)
+  Location GetSetValueLocation(DataType::Type type ATTRIBUTE_UNUSED, bool is_instance)
       const OVERRIDE {
     return is_instance
         ? Location::RegisterLocation(RDX)
         : Location::RegisterLocation(RSI);
   }
-  Location GetFpuLocation(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  Location GetFpuLocation(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return Location::FpuRegisterLocation(XMM0);
   }
 
@@ -112,8 +112,8 @@
   InvokeDexCallingConventionVisitorX86_64() {}
   virtual ~InvokeDexCallingConventionVisitorX86_64() {}
 
-  Location GetNextLocation(Primitive::Type type) OVERRIDE;
-  Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+  Location GetNextLocation(DataType::Type type) OVERRIDE;
+  Location GetReturnLocation(DataType::Type type) const OVERRIDE;
   Location GetMethodLocation() const OVERRIDE;
 
  private:
@@ -299,7 +299,7 @@
   void GenerateFrameExit() OVERRIDE;
   void Bind(HBasicBlock* block) OVERRIDE;
   void MoveConstant(Location destination, int32_t value) OVERRIDE;
-  void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
+  void MoveLocation(Location dst, Location src, DataType::Type dst_type) OVERRIDE;
   void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
 
   size_t SaveCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
@@ -384,7 +384,7 @@
     block_labels_ = CommonInitializeLabels<Label>();
   }
 
-  bool NeedsTwoRegisters(Primitive::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
+  bool NeedsTwoRegisters(DataType::Type type ATTRIBUTE_UNUSED) const OVERRIDE {
     return false;
   }
 
@@ -422,7 +422,7 @@
                               dex::TypeIndex dex_index,
                               Handle<mirror::Class> handle);
 
-  void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
+  void MoveFromReturnRegister(Location trg, DataType::Type type) OVERRIDE;
 
   void EmitLinkerPatches(ArenaVector<linker::LinkerPatch>* linker_patches) OVERRIDE;
 
diff --git a/compiler/optimizing/codegen_test.cc b/compiler/optimizing/codegen_test.cc
index 0a8e97c..896fcfa 100644
--- a/compiler/optimizing/codegen_test.cc
+++ b/compiler/optimizing/codegen_test.cc
@@ -91,7 +91,7 @@
   for (const CodegenTargetConfig& target_config : GetTargetConfigs()) {
     ArenaPool pool;
     ArenaAllocator arena(&pool);
-    HGraph* graph = CreateCFG(&arena, data, Primitive::kPrimLong);
+    HGraph* graph = CreateCFG(&arena, data, DataType::Type::kInt64);
     // Remove suspend checks, they cannot be executed in this context.
     RemoveSuspendChecks(graph);
     RunCode(target_config, graph, [](HGraph*) {}, has_result, expected);
@@ -602,7 +602,7 @@
 static void TestComparison(IfCondition condition,
                            int64_t i,
                            int64_t j,
-                           Primitive::Type type,
+                           DataType::Type type,
                            const CodegenTargetConfig target_config) {
   ArenaPool pool;
   ArenaAllocator allocator(&pool);
@@ -626,11 +626,11 @@
 
   HInstruction* op1;
   HInstruction* op2;
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     op1 = graph->GetIntConstant(i);
     op2 = graph->GetIntConstant(j);
   } else {
-    DCHECK_EQ(type, Primitive::kPrimLong);
+    DCHECK_EQ(type, DataType::Type::kInt64);
     op1 = graph->GetLongConstant(i);
     op2 = graph->GetLongConstant(j);
   }
@@ -693,7 +693,8 @@
     for (int64_t i = -1; i <= 1; i++) {
       for (int64_t j = -1; j <= 1; j++) {
         for (int cond = kCondFirst; cond <= kCondLast; cond++) {
-          TestComparison(static_cast<IfCondition>(cond), i, j, Primitive::kPrimInt, target_config);
+          TestComparison(
+              static_cast<IfCondition>(cond), i, j, DataType::Type::kInt32, target_config);
         }
       }
     }
@@ -705,7 +706,8 @@
     for (int64_t i = -1; i <= 1; i++) {
       for (int64_t j = -1; j <= 1; j++) {
         for (int cond = kCondFirst; cond <= kCondLast; cond++) {
-          TestComparison(static_cast<IfCondition>(cond), i, j, Primitive::kPrimLong, target_config);
+          TestComparison(
+              static_cast<IfCondition>(cond), i, j, DataType::Type::kInt64, target_config);
         }
       }
     }
@@ -728,8 +730,8 @@
   // used as temps; however GPR scratch register is required for big stack offsets which don't fit
   // LDR encoding. So the following code is a regression test for that situation.
   HParallelMove* move = new (graph->GetArena()) HParallelMove(graph->GetArena());
-  move->AddMove(Location::StackSlot(0), Location::StackSlot(8192), Primitive::kPrimInt, nullptr);
-  move->AddMove(Location::StackSlot(8192), Location::StackSlot(0), Primitive::kPrimInt, nullptr);
+  move->AddMove(Location::StackSlot(0), Location::StackSlot(8192), DataType::Type::kInt32, nullptr);
+  move->AddMove(Location::StackSlot(8192), Location::StackSlot(0), DataType::Type::kInt32, nullptr);
   codegen.GetMoveResolver()->EmitNativeCode(move);
 
   InternalCodeAllocator code_allocator;
@@ -778,11 +780,11 @@
   HParallelMove* move = new (graph->GetArena()) HParallelMove(graph->GetArena());
   move->AddMove(Location::DoubleStackSlot(0),
                 Location::DoubleStackSlot(257),
-                Primitive::kPrimDouble,
+                DataType::Type::kFloat64,
                 nullptr);
   move->AddMove(Location::DoubleStackSlot(257),
                 Location::DoubleStackSlot(0),
-                Primitive::kPrimDouble,
+                DataType::Type::kFloat64,
                 nullptr);
   codegen.GetMoveResolver()->EmitNativeCode(move);
 
@@ -806,19 +808,19 @@
     HParallelMove* move = new (graph->GetArena()) HParallelMove(graph->GetArena());
     move->AddMove(Location::SIMDStackSlot(0),
                   Location::SIMDStackSlot(257),
-                  Primitive::kPrimDouble,
+                  DataType::Type::kFloat64,
                   nullptr);
     move->AddMove(Location::SIMDStackSlot(257),
                   Location::SIMDStackSlot(0),
-                  Primitive::kPrimDouble,
+                  DataType::Type::kFloat64,
                   nullptr);
     move->AddMove(Location::FpuRegisterLocation(0),
                   Location::FpuRegisterLocation(1),
-                  Primitive::kPrimDouble,
+                  DataType::Type::kFloat64,
                   nullptr);
     move->AddMove(Location::FpuRegisterLocation(1),
                   Location::FpuRegisterLocation(0),
-                  Primitive::kPrimDouble,
+                  DataType::Type::kFloat64,
                   nullptr);
     codegen.GetMoveResolver()->EmitNativeCode(move);
     graph->SetHasSIMD(false);
diff --git a/compiler/optimizing/common_arm.h b/compiler/optimizing/common_arm.h
index e354654..356ff9f 100644
--- a/compiler/optimizing/common_arm.h
+++ b/compiler/optimizing/common_arm.h
@@ -76,8 +76,8 @@
   return vixl::aarch32::Register(location.reg());
 }
 
-inline vixl::aarch32::Register RegisterFrom(Location location, Primitive::Type type) {
-  DCHECK(type != Primitive::kPrimVoid && !Primitive::IsFloatingPointType(type)) << type;
+inline vixl::aarch32::Register RegisterFrom(Location location, DataType::Type type) {
+  DCHECK(type != DataType::Type::kVoid && !DataType::IsFloatingPointType(type)) << type;
   return RegisterFrom(location);
 }
 
@@ -94,20 +94,20 @@
 }
 
 inline vixl::aarch32::SRegister OutputSRegister(HInstruction* instr) {
-  Primitive::Type type = instr->GetType();
-  DCHECK_EQ(type, Primitive::kPrimFloat) << type;
+  DataType::Type type = instr->GetType();
+  DCHECK_EQ(type, DataType::Type::kFloat32) << type;
   return SRegisterFrom(instr->GetLocations()->Out());
 }
 
 inline vixl::aarch32::DRegister OutputDRegister(HInstruction* instr) {
-  Primitive::Type type = instr->GetType();
-  DCHECK_EQ(type, Primitive::kPrimDouble) << type;
+  DataType::Type type = instr->GetType();
+  DCHECK_EQ(type, DataType::Type::kFloat64) << type;
   return DRegisterFrom(instr->GetLocations()->Out());
 }
 
 inline vixl::aarch32::VRegister OutputVRegister(HInstruction* instr) {
-  Primitive::Type type = instr->GetType();
-  if (type == Primitive::kPrimFloat) {
+  DataType::Type type = instr->GetType();
+  if (type == DataType::Type::kFloat32) {
     return OutputSRegister(instr);
   } else {
     return OutputDRegister(instr);
@@ -115,23 +115,23 @@
 }
 
 inline vixl::aarch32::SRegister InputSRegisterAt(HInstruction* instr, int input_index) {
-  Primitive::Type type = instr->InputAt(input_index)->GetType();
-  DCHECK_EQ(type, Primitive::kPrimFloat) << type;
+  DataType::Type type = instr->InputAt(input_index)->GetType();
+  DCHECK_EQ(type, DataType::Type::kFloat32) << type;
   return SRegisterFrom(instr->GetLocations()->InAt(input_index));
 }
 
 inline vixl::aarch32::DRegister InputDRegisterAt(HInstruction* instr, int input_index) {
-  Primitive::Type type = instr->InputAt(input_index)->GetType();
-  DCHECK_EQ(type, Primitive::kPrimDouble) << type;
+  DataType::Type type = instr->InputAt(input_index)->GetType();
+  DCHECK_EQ(type, DataType::Type::kFloat64) << type;
   return DRegisterFrom(instr->GetLocations()->InAt(input_index));
 }
 
 inline vixl::aarch32::VRegister InputVRegisterAt(HInstruction* instr, int input_index) {
-  Primitive::Type type = instr->InputAt(input_index)->GetType();
-  if (type == Primitive::kPrimFloat) {
+  DataType::Type type = instr->InputAt(input_index)->GetType();
+  if (type == DataType::Type::kFloat32) {
     return InputSRegisterAt(instr, input_index);
   } else {
-    DCHECK_EQ(type, Primitive::kPrimDouble);
+    DCHECK_EQ(type, DataType::Type::kFloat64);
     return InputDRegisterAt(instr, input_index);
   }
 }
@@ -196,7 +196,7 @@
   return instr->AsConstant()->GetValueAsUint64();
 }
 
-inline vixl::aarch32::Operand OperandFrom(Location location, Primitive::Type type) {
+inline vixl::aarch32::Operand OperandFrom(Location location, DataType::Type type) {
   if (location.IsRegister()) {
     return vixl::aarch32::Operand(RegisterFrom(location, type));
   } else {
diff --git a/compiler/optimizing/common_arm64.h b/compiler/optimizing/common_arm64.h
index e73fd7d..102acb3 100644
--- a/compiler/optimizing/common_arm64.h
+++ b/compiler/optimizing/common_arm64.h
@@ -73,9 +73,9 @@
   return vixl::aarch64::Register::GetWRegFromCode(VIXLRegCodeFromART(location.reg()));
 }
 
-inline vixl::aarch64::Register RegisterFrom(Location location, Primitive::Type type) {
-  DCHECK(type != Primitive::kPrimVoid && !Primitive::IsFloatingPointType(type)) << type;
-  return type == Primitive::kPrimLong ? XRegisterFrom(location) : WRegisterFrom(location);
+inline vixl::aarch64::Register RegisterFrom(Location location, DataType::Type type) {
+  DCHECK(type != DataType::Type::kVoid && !DataType::IsFloatingPointType(type)) << type;
+  return type == DataType::Type::kInt64 ? XRegisterFrom(location) : WRegisterFrom(location);
 }
 
 inline vixl::aarch64::Register OutputRegister(HInstruction* instr) {
@@ -107,9 +107,9 @@
   return vixl::aarch64::FPRegister::GetSRegFromCode(location.reg());
 }
 
-inline vixl::aarch64::FPRegister FPRegisterFrom(Location location, Primitive::Type type) {
-  DCHECK(Primitive::IsFloatingPointType(type)) << type;
-  return type == Primitive::kPrimDouble ? DRegisterFrom(location) : SRegisterFrom(location);
+inline vixl::aarch64::FPRegister FPRegisterFrom(Location location, DataType::Type type) {
+  DCHECK(DataType::IsFloatingPointType(type)) << type;
+  return type == DataType::Type::kFloat64 ? DRegisterFrom(location) : SRegisterFrom(location);
 }
 
 inline vixl::aarch64::FPRegister OutputFPRegister(HInstruction* instr) {
@@ -121,20 +121,20 @@
                         instr->InputAt(input_index)->GetType());
 }
 
-inline vixl::aarch64::CPURegister CPURegisterFrom(Location location, Primitive::Type type) {
-  return Primitive::IsFloatingPointType(type)
+inline vixl::aarch64::CPURegister CPURegisterFrom(Location location, DataType::Type type) {
+  return DataType::IsFloatingPointType(type)
       ? vixl::aarch64::CPURegister(FPRegisterFrom(location, type))
       : vixl::aarch64::CPURegister(RegisterFrom(location, type));
 }
 
 inline vixl::aarch64::CPURegister OutputCPURegister(HInstruction* instr) {
-  return Primitive::IsFloatingPointType(instr->GetType())
+  return DataType::IsFloatingPointType(instr->GetType())
       ? static_cast<vixl::aarch64::CPURegister>(OutputFPRegister(instr))
       : static_cast<vixl::aarch64::CPURegister>(OutputRegister(instr));
 }
 
 inline vixl::aarch64::CPURegister InputCPURegisterAt(HInstruction* instr, int index) {
-  return Primitive::IsFloatingPointType(instr->InputAt(index)->GetType())
+  return DataType::IsFloatingPointType(instr->InputAt(index)->GetType())
       ? static_cast<vixl::aarch64::CPURegister>(InputFPRegisterAt(instr, index))
       : static_cast<vixl::aarch64::CPURegister>(InputRegisterAt(instr, index));
 }
@@ -142,9 +142,9 @@
 inline vixl::aarch64::CPURegister InputCPURegisterOrZeroRegAt(HInstruction* instr,
                                                                      int index) {
   HInstruction* input = instr->InputAt(index);
-  Primitive::Type input_type = input->GetType();
+  DataType::Type input_type = input->GetType();
   if (input->IsConstant() && input->AsConstant()->IsZeroBitPattern()) {
-    return (Primitive::ComponentSize(input_type) >= vixl::aarch64::kXRegSizeInBytes)
+    return (DataType::Size(input_type) >= vixl::aarch64::kXRegSizeInBytes)
         ? vixl::aarch64::Register(vixl::aarch64::xzr)
         : vixl::aarch64::Register(vixl::aarch64::wzr);
   }
@@ -163,7 +163,7 @@
   }
 }
 
-inline vixl::aarch64::Operand OperandFrom(Location location, Primitive::Type type) {
+inline vixl::aarch64::Operand OperandFrom(Location location, DataType::Type type) {
   if (location.IsRegister()) {
     return vixl::aarch64::Operand(RegisterFrom(location, type));
   } else {
@@ -202,7 +202,7 @@
 }
 
 inline vixl::aarch64::MemOperand HeapOperandFrom(Location location, Offset offset) {
-  return HeapOperand(RegisterFrom(location, Primitive::kPrimNot), offset);
+  return HeapOperand(RegisterFrom(location, DataType::Type::kReference), offset);
 }
 
 inline Location LocationFrom(const vixl::aarch64::Register& reg) {
diff --git a/compiler/optimizing/constant_folding.cc b/compiler/optimizing/constant_folding.cc
index 5f39a49..bb586bf 100644
--- a/compiler/optimizing/constant_folding.cc
+++ b/compiler/optimizing/constant_folding.cc
@@ -150,7 +150,7 @@
     //    EQUAL lhs, null
     // where lhs cannot be null with
     //    CONSTANT false
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 0));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 0));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -162,7 +162,7 @@
     //    NOT_EQUAL lhs, null
     // where lhs cannot be null with
     //    CONSTANT true
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 1));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 1));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -174,7 +174,7 @@
     //    ABOVE dst, 0, src  // unsigned 0 > src is always false
     // with
     //    CONSTANT false
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 0));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 0));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -186,7 +186,7 @@
     //    ABOVE_OR_EQUAL dst, src, 0  // unsigned src >= 0 is always true
     // with
     //    CONSTANT true
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 1));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 1));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -198,7 +198,7 @@
     //    BELOW dst, src, 0  // unsigned src < 0 is always false
     // with
     //    CONSTANT false
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 0));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 0));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -210,7 +210,7 @@
     //    BELOW_OR_EQUAL dst, 0, src  // unsigned 0 <= src is always true
     // with
     //    CONSTANT true
-    instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimBoolean, 1));
+    instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kBool, 1));
     instruction->GetBlock()->RemoveInstruction(instruction);
   }
 }
@@ -231,7 +231,7 @@
   HConstant* input_cst = instruction->GetConstantRight();
   if (input_cst != nullptr) {
     HInstruction* input_value = instruction->GetLeastConstantLeft();
-    if (Primitive::IsFloatingPointType(input_value->GetType()) &&
+    if (DataType::IsFloatingPointType(input_value->GetType()) &&
         ((input_cst->IsFloatConstant() && input_cst->AsFloatConstant()->IsNaN()) ||
          (input_cst->IsDoubleConstant() && input_cst->AsDoubleConstant()->IsNaN()))) {
       // Replace code looking like
@@ -240,7 +240,7 @@
       //    CONSTANT +1 (gt bias)
       // or
       //    CONSTANT -1 (lt bias)
-      instruction->ReplaceWith(GetGraph()->GetConstant(Primitive::kPrimInt,
+      instruction->ReplaceWith(GetGraph()->GetConstant(DataType::Type::kInt32,
                                                        (instruction->IsGtBias() ? 1 : -1)));
       instruction->GetBlock()->RemoveInstruction(instruction);
     }
@@ -249,8 +249,8 @@
 
 void InstructionWithAbsorbingInputSimplifier::VisitMul(HMul* instruction) {
   HConstant* input_cst = instruction->GetConstantRight();
-  Primitive::Type type = instruction->GetType();
-  if (Primitive::IsIntOrLongType(type) &&
+  DataType::Type type = instruction->GetType();
+  if (DataType::IsIntOrLongType(type) &&
       (input_cst != nullptr) && input_cst->IsArithmeticZero()) {
     // Replace code looking like
     //    MUL dst, src, 0
@@ -282,9 +282,9 @@
 }
 
 void InstructionWithAbsorbingInputSimplifier::VisitRem(HRem* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
-  if (!Primitive::IsIntegralType(type)) {
+  if (!DataType::IsIntegralType(type)) {
     return;
   }
 
@@ -326,9 +326,9 @@
 }
 
 void InstructionWithAbsorbingInputSimplifier::VisitSub(HSub* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
-  if (!Primitive::IsIntegralType(type)) {
+  if (!DataType::IsIntegralType(type)) {
     return;
   }
 
@@ -360,7 +360,7 @@
     //    XOR dst, src, src
     // with
     //    CONSTANT 0
-    Primitive::Type type = instruction->GetType();
+    DataType::Type type = instruction->GetType();
     HBasicBlock* block = instruction->GetBlock();
     instruction->ReplaceWith(GetGraph()->GetConstant(type, 0));
     block->RemoveInstruction(instruction);
diff --git a/compiler/optimizing/constant_folding_test.cc b/compiler/optimizing/constant_folding_test.cc
index 7ef28ed..c85a2e3 100644
--- a/compiler/optimizing/constant_folding_test.cc
+++ b/compiler/optimizing/constant_folding_test.cc
@@ -43,7 +43,7 @@
                 const std::string& expected_after_cf,
                 const std::string& expected_after_dce,
                 const std::function<void(HGraph*)>& check_after_cf,
-                Primitive::Type return_type = Primitive::kPrimInt) {
+                DataType::Type return_type = DataType::Type::kInt32) {
     graph_ = CreateCFG(&allocator_, data, return_type);
     TestCodeOnReadyGraph(expected_before,
                          expected_after_cf,
@@ -208,7 +208,7 @@
            expected_after_cf,
            expected_after_dce,
            check_after_cf,
-           Primitive::kPrimLong);
+           DataType::Type::kInt64);
 }
 
 /**
@@ -483,7 +483,7 @@
            expected_after_cf,
            expected_after_dce,
            check_after_cf,
-           Primitive::kPrimLong);
+           DataType::Type::kInt64);
 }
 
 /**
@@ -547,7 +547,7 @@
            expected_after_cf,
            expected_after_dce,
            check_after_cf,
-           Primitive::kPrimLong);
+           DataType::Type::kInt64);
 }
 
 /**
@@ -756,7 +756,7 @@
 
   // Make various unsigned comparisons with zero against a parameter.
   HInstruction* parameter = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt, true);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32, true);
   entry_block->AddInstruction(parameter);
   entry_block->AddInstruction(new (&allocator_) HGoto());
 
diff --git a/compiler/optimizing/data_type-inl.h b/compiler/optimizing/data_type-inl.h
new file mode 100644
index 0000000..fbc0c12
--- /dev/null
+++ b/compiler/optimizing/data_type-inl.h
@@ -0,0 +1,67 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_DATA_TYPE_INL_H_
+#define ART_COMPILER_OPTIMIZING_DATA_TYPE_INL_H_
+
+#include "data_type.h"
+#include "primitive.h"
+
+namespace art {
+
+// Note: Not declared in data_type.h to avoid pulling in "primitive.h".
+constexpr DataType::Type DataTypeFromPrimitive(Primitive::Type type) {
+  switch (type) {
+    case Primitive::kPrimNot: return DataType::Type::kReference;
+    case Primitive::kPrimBoolean: return DataType::Type::kBool;
+    case Primitive::kPrimByte: return DataType::Type::kInt8;
+    case Primitive::kPrimChar: return DataType::Type::kUint16;
+    case Primitive::kPrimShort: return DataType::Type::kInt16;
+    case Primitive::kPrimInt: return DataType::Type::kInt32;
+    case Primitive::kPrimLong: return DataType::Type::kInt64;
+    case Primitive::kPrimFloat: return DataType::Type::kFloat32;
+    case Primitive::kPrimDouble: return DataType::Type::kFloat64;
+    case Primitive::kPrimVoid: return DataType::Type::kVoid;
+  }
+  LOG(FATAL) << "Unreachable";
+  UNREACHABLE();
+}
+
+constexpr DataType::Type DataType::FromShorty(char type) {
+  return DataTypeFromPrimitive(Primitive::GetType(type));
+}
+
+constexpr char DataType::TypeId(DataType::Type type) {
+  // Type id for visualizer.
+  switch (type) {
+    case DataType::Type::kBool: return 'z';
+    case DataType::Type::kInt8: return 'b';
+    case DataType::Type::kUint16: return 'c';
+    case DataType::Type::kInt16: return 's';
+    case DataType::Type::kInt32: return 'i';
+    case DataType::Type::kInt64: return 'j';
+    case DataType::Type::kFloat32: return 'f';
+    case DataType::Type::kFloat64: return 'd';
+    case DataType::Type::kReference: return 'l';
+    case DataType::Type::kVoid: return 'v';
+  }
+  LOG(FATAL) << "Unreachable";
+  UNREACHABLE();
+}
+
+}  // namespace art
+
+#endif  // ART_COMPILER_OPTIMIZING_DATA_TYPE_INL_H_
diff --git a/compiler/optimizing/data_type.cc b/compiler/optimizing/data_type.cc
new file mode 100644
index 0000000..6890617
--- /dev/null
+++ b/compiler/optimizing/data_type.cc
@@ -0,0 +1,52 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "data_type.h"
+
+namespace art {
+
+static const char* kTypeNames[] = {
+    "Reference",
+    "Bool",
+    "Int8",
+    "Uint16",
+    "Int16",
+    "Int32",
+    "Int64",
+    "Float32",
+    "Float64",
+    "Void",
+};
+
+const char* DataType::PrettyDescriptor(Type type) {
+  static_assert(arraysize(kTypeNames) == static_cast<size_t>(Type::kLast) + 1,
+                "Missing element");
+  uint32_t uint_type = static_cast<uint32_t>(type);
+  CHECK_LE(uint_type, static_cast<uint32_t>(Type::kLast));
+  return kTypeNames[uint_type];
+}
+
+std::ostream& operator<<(std::ostream& os, DataType::Type type) {
+  uint32_t uint_type = static_cast<uint32_t>(type);
+  if (uint_type <= static_cast<uint32_t>(DataType::Type::kLast)) {
+    os << kTypeNames[uint_type];
+  } else {
+    os << "Type[" << uint_type << "]";
+  }
+  return os;
+}
+
+}  // namespace art
diff --git a/compiler/optimizing/data_type.h b/compiler/optimizing/data_type.h
new file mode 100644
index 0000000..08f9263
--- /dev/null
+++ b/compiler/optimizing/data_type.h
@@ -0,0 +1,184 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_DATA_TYPE_H_
+#define ART_COMPILER_OPTIMIZING_DATA_TYPE_H_
+
+#include <iosfwd>
+
+#include "base/logging.h"
+#include "base/bit_utils.h"
+
+namespace art {
+
+class DataType {
+ public:
+  enum class Type : uint8_t {
+    kReference = 0,
+    kBool,
+    kInt8,
+    kUint16,
+    kInt16,
+    kInt32,
+    kInt64,
+    kFloat32,
+    kFloat64,
+    kVoid,
+    kLast = kVoid
+  };
+
+  static constexpr Type FromShorty(char type);
+  static constexpr char TypeId(DataType::Type type);
+
+  static constexpr size_t SizeShift(Type type) {
+    switch (type) {
+      case Type::kVoid:
+      case Type::kBool:
+      case Type::kInt8:
+        return 0;
+      case Type::kUint16:
+      case Type::kInt16:
+        return 1;
+      case Type::kInt32:
+      case Type::kFloat32:
+        return 2;
+      case Type::kInt64:
+      case Type::kFloat64:
+        return 3;
+      case Type::kReference:
+        return WhichPowerOf2(kObjectReferenceSize);
+      default:
+        LOG(FATAL) << "Invalid type " << static_cast<int>(type);
+        return 0;
+    }
+  }
+
+  static constexpr size_t Size(Type type) {
+    switch (type) {
+      case Type::kVoid:
+        return 0;
+      case Type::kBool:
+      case Type::kInt8:
+        return 1;
+      case Type::kUint16:
+      case Type::kInt16:
+        return 2;
+      case Type::kInt32:
+      case Type::kFloat32:
+        return 4;
+      case Type::kInt64:
+      case Type::kFloat64:
+        return 8;
+      case Type::kReference:
+        return kObjectReferenceSize;
+      default:
+        LOG(FATAL) << "Invalid type " << static_cast<int>(type);
+        return 0;
+    }
+  }
+
+  static bool IsFloatingPointType(Type type) {
+    return type == Type::kFloat32 || type == Type::kFloat64;
+  }
+
+  static bool IsIntegralType(Type type) {
+    // The Java language does not allow treating boolean as an integral type but
+    // our bit representation makes it safe.
+    switch (type) {
+      case Type::kBool:
+      case Type::kInt8:
+      case Type::kUint16:
+      case Type::kInt16:
+      case Type::kInt32:
+      case Type::kInt64:
+        return true;
+      default:
+        return false;
+    }
+  }
+
+  static bool IsIntOrLongType(Type type) {
+    return type == Type::kInt32 || type == Type::kInt64;
+  }
+
+  static bool Is64BitType(Type type) {
+    return type == Type::kInt64 || type == Type::kFloat64;
+  }
+
+  // Return the general kind of `type`, fusing integer-like types as Type::kInt.
+  static Type Kind(Type type) {
+    switch (type) {
+      case Type::kBool:
+      case Type::kInt8:
+      case Type::kInt16:
+      case Type::kUint16:
+      case Type::kInt32:
+        return Type::kInt32;
+      default:
+        return type;
+    }
+  }
+
+  static int64_t MinValueOfIntegralType(Type type) {
+    switch (type) {
+      case Type::kBool:
+        return std::numeric_limits<bool>::min();
+      case Type::kInt8:
+        return std::numeric_limits<int8_t>::min();
+      case Type::kUint16:
+        return std::numeric_limits<uint16_t>::min();
+      case Type::kInt16:
+        return std::numeric_limits<int16_t>::min();
+      case Type::kInt32:
+        return std::numeric_limits<int32_t>::min();
+      case Type::kInt64:
+        return std::numeric_limits<int64_t>::min();
+      default:
+        LOG(FATAL) << "non integral type";
+    }
+    return 0;
+  }
+
+  static int64_t MaxValueOfIntegralType(Type type) {
+    switch (type) {
+      case Type::kBool:
+        return std::numeric_limits<bool>::max();
+      case Type::kInt8:
+        return std::numeric_limits<int8_t>::max();
+      case Type::kUint16:
+        return std::numeric_limits<uint16_t>::max();
+      case Type::kInt16:
+        return std::numeric_limits<int16_t>::max();
+      case Type::kInt32:
+        return std::numeric_limits<int32_t>::max();
+      case Type::kInt64:
+        return std::numeric_limits<int64_t>::max();
+      default:
+        LOG(FATAL) << "non integral type";
+    }
+    return 0;
+  }
+
+  static const char* PrettyDescriptor(Type type);
+
+ private:
+  static constexpr size_t kObjectReferenceSize = 4u;
+};
+std::ostream& operator<<(std::ostream& os, DataType::Type data_type);
+
+}  // namespace art
+
+#endif  // ART_COMPILER_OPTIMIZING_DATA_TYPE_H_
diff --git a/compiler/optimizing/data_type_test.cc b/compiler/optimizing/data_type_test.cc
new file mode 100644
index 0000000..927291a
--- /dev/null
+++ b/compiler/optimizing/data_type_test.cc
@@ -0,0 +1,60 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <gtest/gtest.h>
+
+#include "data_type-inl.h"
+
+#include "primitive.h"
+
+namespace art {
+
+template <DataType::Type data_type, Primitive::Type primitive_type>
+static void CheckConversion() {
+  static_assert(data_type == DataTypeFromPrimitive(primitive_type), "Conversion check.");
+  static_assert(DataType::Size(data_type) == Primitive::ComponentSize(primitive_type),
+                "Size check.");
+}
+
+TEST(DataType, SizeAgainstPrimitive) {
+  CheckConversion<DataType::Type::kVoid, Primitive::kPrimVoid>();
+  CheckConversion<DataType::Type::kBool, Primitive::kPrimBoolean>();
+  CheckConversion<DataType::Type::kInt8, Primitive::kPrimByte>();
+  CheckConversion<DataType::Type::kUint16, Primitive::kPrimChar>();
+  CheckConversion<DataType::Type::kInt16, Primitive::kPrimShort>();
+  CheckConversion<DataType::Type::kInt32, Primitive::kPrimInt>();
+  CheckConversion<DataType::Type::kInt64, Primitive::kPrimLong>();
+  CheckConversion<DataType::Type::kFloat32, Primitive::kPrimFloat>();
+  CheckConversion<DataType::Type::kFloat64, Primitive::kPrimDouble>();
+  CheckConversion<DataType::Type::kReference, Primitive::kPrimNot>();
+}
+
+TEST(DataType, Names) {
+#define CHECK_NAME(type) EXPECT_STREQ(#type, DataType::PrettyDescriptor(DataType::Type::k##type))
+  CHECK_NAME(Void);
+  CHECK_NAME(Bool);
+  CHECK_NAME(Int8);
+  CHECK_NAME(Uint16);
+  CHECK_NAME(Int16);
+  CHECK_NAME(Int32);
+  CHECK_NAME(Int64);
+  CHECK_NAME(Float32);
+  CHECK_NAME(Float64);
+  CHECK_NAME(Reference);
+#undef CHECK_NAME
+}
+
+}  // namespace art
diff --git a/compiler/optimizing/dead_code_elimination.cc b/compiler/optimizing/dead_code_elimination.cc
index 787296d..9b094e9 100644
--- a/compiler/optimizing/dead_code_elimination.cc
+++ b/compiler/optimizing/dead_code_elimination.cc
@@ -118,7 +118,7 @@
 }
 
 static HConstant* Evaluate(HCondition* condition, HInstruction* left, HInstruction* right) {
-  if (left == right && !Primitive::IsFloatingPointType(left->GetType())) {
+  if (left == right && !DataType::IsFloatingPointType(left->GetType())) {
     return condition->GetBlock()->GetGraph()->GetIntConstant(
         HasEquality(condition->GetCondition()) ? 1 : 0);
   }
diff --git a/compiler/optimizing/emit_swap_mips_test.cc b/compiler/optimizing/emit_swap_mips_test.cc
index fa3c4df..0e9c81d 100644
--- a/compiler/optimizing/emit_swap_mips_test.cc
+++ b/compiler/optimizing/emit_swap_mips_test.cc
@@ -118,12 +118,12 @@
   moves_->AddMove(
       Location::RegisterLocation(4),
       Location::RegisterLocation(5),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   moves_->AddMove(
       Location::RegisterLocation(5),
       Location::RegisterLocation(4),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   const char* expected =
       "or $t8, $a1, $zero\n"
@@ -136,12 +136,12 @@
   moves_->AddMove(
       Location::RegisterPairLocation(4, 5),
       Location::RegisterPairLocation(6, 7),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   moves_->AddMove(
       Location::RegisterPairLocation(6, 7),
       Location::RegisterPairLocation(4, 5),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   const char* expected =
       "or $t8, $a2, $zero\n"
@@ -157,12 +157,12 @@
   moves_->AddMove(
       Location::FpuRegisterLocation(4),
       Location::FpuRegisterLocation(2),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   moves_->AddMove(
       Location::FpuRegisterLocation(2),
       Location::FpuRegisterLocation(4),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   const char* expected =
       "mov.s $f6, $f2\n"
@@ -175,12 +175,12 @@
   moves_->AddMove(
       Location::FpuRegisterLocation(4),
       Location::FpuRegisterLocation(2),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   moves_->AddMove(
       Location::FpuRegisterLocation(2),
       Location::FpuRegisterLocation(4),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   const char* expected =
       "mov.d $f6, $f2\n"
@@ -193,12 +193,12 @@
   moves_->AddMove(
       Location::RegisterLocation(4),
       Location::FpuRegisterLocation(2),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   moves_->AddMove(
       Location::FpuRegisterLocation(2),
       Location::RegisterLocation(4),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   const char* expected =
       "or $t8, $a0, $zero\n"
@@ -211,12 +211,12 @@
   moves_->AddMove(
       Location::RegisterPairLocation(4, 5),
       Location::FpuRegisterLocation(4),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   moves_->AddMove(
       Location::FpuRegisterLocation(4),
       Location::RegisterPairLocation(4, 5),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   const char* expected =
       "mfc1 $t8, $f4\n"
@@ -232,12 +232,12 @@
   moves_->AddMove(
       Location::StackSlot(52),
       Location::StackSlot(48),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   moves_->AddMove(
       Location::StackSlot(48),
       Location::StackSlot(52),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   const char* expected =
       "addiu $sp, $sp, -4\n"
@@ -255,12 +255,12 @@
   moves_->AddMove(
       Location::DoubleStackSlot(56),
       Location::DoubleStackSlot(48),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   moves_->AddMove(
       Location::DoubleStackSlot(48),
       Location::DoubleStackSlot(56),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   const char* expected =
       "addiu $sp, $sp, -4\n"
@@ -282,12 +282,12 @@
   moves_->AddMove(
       Location::RegisterLocation(4),
       Location::StackSlot(48),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   moves_->AddMove(
       Location::StackSlot(48),
       Location::RegisterLocation(4),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   const char* expected =
       "or $t8, $a0, $zero\n"
@@ -300,12 +300,12 @@
   moves_->AddMove(
       Location::RegisterPairLocation(4, 5),
       Location::DoubleStackSlot(32),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   moves_->AddMove(
       Location::DoubleStackSlot(32),
       Location::RegisterPairLocation(4, 5),
-      Primitive::kPrimLong,
+      DataType::Type::kInt64,
       nullptr);
   const char* expected =
       "or $t8, $a0, $zero\n"
@@ -321,12 +321,12 @@
   moves_->AddMove(
       Location::FpuRegisterLocation(4),
       Location::StackSlot(48),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   moves_->AddMove(
       Location::StackSlot(48),
       Location::FpuRegisterLocation(4),
-      Primitive::kPrimFloat,
+      DataType::Type::kFloat32,
       nullptr);
   const char* expected =
       "mov.s $f6, $f4\n"
@@ -339,12 +339,12 @@
   moves_->AddMove(
       Location::FpuRegisterLocation(4),
       Location::DoubleStackSlot(48),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   moves_->AddMove(
       Location::DoubleStackSlot(48),
       Location::FpuRegisterLocation(4),
-      Primitive::kPrimDouble,
+      DataType::Type::kFloat64,
       nullptr);
   const char* expected =
       "mov.d $f6, $f4\n"
diff --git a/compiler/optimizing/graph_checker.cc b/compiler/optimizing/graph_checker.cc
index 327e11f..1c7d1a0 100644
--- a/compiler/optimizing/graph_checker.cc
+++ b/compiler/optimizing/graph_checker.cc
@@ -456,7 +456,7 @@
   }
 
   // Ensure that reference type instructions have reference type info.
-  if (instruction->GetType() == Primitive::kPrimNot) {
+  if (instruction->GetType() == DataType::Type::kReference) {
     if (!instruction->GetReferenceTypeInfo().IsValid()) {
       AddError(StringPrintf("Reference type instruction %s:%d does not have "
                             "valid reference type information.",
@@ -674,7 +674,7 @@
 static bool IsSameSizeConstant(const HInstruction* insn1, const HInstruction* insn2) {
   return insn1->IsConstant()
       && insn2->IsConstant()
-      && Primitive::Is64BitType(insn1->GetType()) == Primitive::Is64BitType(insn2->GetType());
+      && DataType::Is64BitType(insn1->GetType()) == DataType::Is64BitType(insn2->GetType());
 }
 
 static bool IsConstantEquivalent(const HInstruction* insn1,
@@ -721,20 +721,20 @@
   // Ensure that the inputs have the same primitive kind as the phi.
   for (size_t i = 0; i < input_records.size(); ++i) {
     HInstruction* input = input_records[i].GetInstruction();
-    if (Primitive::PrimitiveKind(input->GetType()) != Primitive::PrimitiveKind(phi->GetType())) {
+    if (DataType::Kind(input->GetType()) != DataType::Kind(phi->GetType())) {
         AddError(StringPrintf(
             "Input %d at index %zu of phi %d from block %d does not have the "
             "same kind as the phi: %s versus %s",
             input->GetId(), i, phi->GetId(), phi->GetBlock()->GetBlockId(),
-            Primitive::PrettyDescriptor(input->GetType()),
-            Primitive::PrettyDescriptor(phi->GetType())));
+            DataType::PrettyDescriptor(input->GetType()),
+            DataType::PrettyDescriptor(phi->GetType())));
     }
   }
   if (phi->GetType() != HPhi::ToPhiType(phi->GetType())) {
     AddError(StringPrintf("Phi %d in block %d does not have an expected phi type: %s",
                           phi->GetId(),
                           phi->GetBlock()->GetBlockId(),
-                          Primitive::PrettyDescriptor(phi->GetType())));
+                          DataType::PrettyDescriptor(phi->GetType())));
   }
 
   if (phi->IsCatchPhi()) {
@@ -820,7 +820,7 @@
                                 phi->GetId(),
                                 phi->GetRegNumber(),
                                 type_str.str().c_str()));
-        } else if (phi->GetType() == Primitive::kPrimNot) {
+        } else if (phi->GetType() == DataType::Type::kReference) {
           std::stringstream type_str;
           type_str << other_phi->GetType();
           AddError(StringPrintf(
@@ -859,7 +859,7 @@
           static_cast<int>(input_index),
           value));
     }
-  } else if (Primitive::PrimitiveKind(input->GetType()) != Primitive::kPrimInt) {
+  } else if (DataType::Kind(input->GetType()) != DataType::Type::kInt32) {
     // TODO: We need a data-flow analysis to determine if an input like Phi,
     //       Select or a binary operation is actually Boolean. Allow for now.
     AddError(StringPrintf(
@@ -867,7 +867,7 @@
         instruction->DebugName(),
         instruction->GetId(),
         static_cast<int>(input_index),
-        Primitive::PrettyDescriptor(input->GetType())));
+        DataType::PrettyDescriptor(input->GetType())));
   }
 }
 
@@ -904,27 +904,27 @@
 
 void GraphChecker::VisitCondition(HCondition* op) {
   VisitInstruction(op);
-  if (op->GetType() != Primitive::kPrimBoolean) {
+  if (op->GetType() != DataType::Type::kBool) {
     AddError(StringPrintf(
         "Condition %s %d has a non-Boolean result type: %s.",
         op->DebugName(), op->GetId(),
-        Primitive::PrettyDescriptor(op->GetType())));
+        DataType::PrettyDescriptor(op->GetType())));
   }
   HInstruction* lhs = op->InputAt(0);
   HInstruction* rhs = op->InputAt(1);
-  if (Primitive::PrimitiveKind(lhs->GetType()) != Primitive::PrimitiveKind(rhs->GetType())) {
+  if (DataType::Kind(lhs->GetType()) != DataType::Kind(rhs->GetType())) {
     AddError(StringPrintf(
         "Condition %s %d has inputs of different kinds: %s, and %s.",
         op->DebugName(), op->GetId(),
-        Primitive::PrettyDescriptor(lhs->GetType()),
-        Primitive::PrettyDescriptor(rhs->GetType())));
+        DataType::PrettyDescriptor(lhs->GetType()),
+        DataType::PrettyDescriptor(rhs->GetType())));
   }
   if (!op->IsEqual() && !op->IsNotEqual()) {
-    if ((lhs->GetType() == Primitive::kPrimNot)) {
+    if ((lhs->GetType() == DataType::Type::kReference)) {
       AddError(StringPrintf(
           "Condition %s %d uses an object as left-hand side input.",
           op->DebugName(), op->GetId()));
-    } else if (rhs->GetType() == Primitive::kPrimNot) {
+    } else if (rhs->GetType() == DataType::Type::kReference) {
       AddError(StringPrintf(
           "Condition %s %d uses an object as right-hand side input.",
           op->DebugName(), op->GetId()));
@@ -934,72 +934,72 @@
 
 void GraphChecker::VisitNeg(HNeg* instruction) {
   VisitInstruction(instruction);
-  Primitive::Type input_type = instruction->InputAt(0)->GetType();
-  Primitive::Type result_type = instruction->GetType();
-  if (result_type != Primitive::PrimitiveKind(input_type)) {
+  DataType::Type input_type = instruction->InputAt(0)->GetType();
+  DataType::Type result_type = instruction->GetType();
+  if (result_type != DataType::Kind(input_type)) {
     AddError(StringPrintf("Binary operation %s %d has a result type different "
                           "from its input kind: %s vs %s.",
                           instruction->DebugName(), instruction->GetId(),
-                          Primitive::PrettyDescriptor(result_type),
-                          Primitive::PrettyDescriptor(input_type)));
+                          DataType::PrettyDescriptor(result_type),
+                          DataType::PrettyDescriptor(input_type)));
   }
 }
 
 void GraphChecker::VisitBinaryOperation(HBinaryOperation* op) {
   VisitInstruction(op);
-  Primitive::Type lhs_type = op->InputAt(0)->GetType();
-  Primitive::Type rhs_type = op->InputAt(1)->GetType();
-  Primitive::Type result_type = op->GetType();
+  DataType::Type lhs_type = op->InputAt(0)->GetType();
+  DataType::Type rhs_type = op->InputAt(1)->GetType();
+  DataType::Type result_type = op->GetType();
 
   // Type consistency between inputs.
   if (op->IsUShr() || op->IsShr() || op->IsShl() || op->IsRor()) {
-    if (Primitive::PrimitiveKind(rhs_type) != Primitive::kPrimInt) {
+    if (DataType::Kind(rhs_type) != DataType::Type::kInt32) {
       AddError(StringPrintf("Shift/rotate operation %s %d has a non-int kind second input: "
                             "%s of type %s.",
                             op->DebugName(), op->GetId(),
                             op->InputAt(1)->DebugName(),
-                            Primitive::PrettyDescriptor(rhs_type)));
+                            DataType::PrettyDescriptor(rhs_type)));
     }
   } else {
-    if (Primitive::PrimitiveKind(lhs_type) != Primitive::PrimitiveKind(rhs_type)) {
+    if (DataType::Kind(lhs_type) != DataType::Kind(rhs_type)) {
       AddError(StringPrintf("Binary operation %s %d has inputs of different kinds: %s, and %s.",
                             op->DebugName(), op->GetId(),
-                            Primitive::PrettyDescriptor(lhs_type),
-                            Primitive::PrettyDescriptor(rhs_type)));
+                            DataType::PrettyDescriptor(lhs_type),
+                            DataType::PrettyDescriptor(rhs_type)));
     }
   }
 
   // Type consistency between result and input(s).
   if (op->IsCompare()) {
-    if (result_type != Primitive::kPrimInt) {
+    if (result_type != DataType::Type::kInt32) {
       AddError(StringPrintf("Compare operation %d has a non-int result type: %s.",
                             op->GetId(),
-                            Primitive::PrettyDescriptor(result_type)));
+                            DataType::PrettyDescriptor(result_type)));
     }
   } else if (op->IsUShr() || op->IsShr() || op->IsShl() || op->IsRor()) {
     // Only check the first input (value), as the second one (distance)
     // must invariably be of kind `int`.
-    if (result_type != Primitive::PrimitiveKind(lhs_type)) {
+    if (result_type != DataType::Kind(lhs_type)) {
       AddError(StringPrintf("Shift/rotate operation %s %d has a result type different "
                             "from its left-hand side (value) input kind: %s vs %s.",
                             op->DebugName(), op->GetId(),
-                            Primitive::PrettyDescriptor(result_type),
-                            Primitive::PrettyDescriptor(lhs_type)));
+                            DataType::PrettyDescriptor(result_type),
+                            DataType::PrettyDescriptor(lhs_type)));
     }
   } else {
-    if (Primitive::PrimitiveKind(result_type) != Primitive::PrimitiveKind(lhs_type)) {
+    if (DataType::Kind(result_type) != DataType::Kind(lhs_type)) {
       AddError(StringPrintf("Binary operation %s %d has a result kind different "
                             "from its left-hand side input kind: %s vs %s.",
                             op->DebugName(), op->GetId(),
-                            Primitive::PrettyDescriptor(result_type),
-                            Primitive::PrettyDescriptor(lhs_type)));
+                            DataType::PrettyDescriptor(result_type),
+                            DataType::PrettyDescriptor(lhs_type)));
     }
-    if (Primitive::PrimitiveKind(result_type) != Primitive::PrimitiveKind(rhs_type)) {
+    if (DataType::Kind(result_type) != DataType::Kind(rhs_type)) {
       AddError(StringPrintf("Binary operation %s %d has a result kind different "
                             "from its right-hand side input kind: %s vs %s.",
                             op->DebugName(), op->GetId(),
-                            Primitive::PrettyDescriptor(result_type),
-                            Primitive::PrettyDescriptor(rhs_type)));
+                            DataType::PrettyDescriptor(result_type),
+                            DataType::PrettyDescriptor(rhs_type)));
     }
   }
 }
@@ -1028,16 +1028,16 @@
 
 void GraphChecker::VisitTypeConversion(HTypeConversion* instruction) {
   VisitInstruction(instruction);
-  Primitive::Type result_type = instruction->GetResultType();
-  Primitive::Type input_type = instruction->GetInputType();
+  DataType::Type result_type = instruction->GetResultType();
+  DataType::Type input_type = instruction->GetInputType();
   // Invariant: We should never generate a conversion to a Boolean value.
-  if (result_type == Primitive::kPrimBoolean) {
+  if (result_type == DataType::Type::kBool) {
     AddError(StringPrintf(
         "%s %d converts to a %s (from a %s).",
         instruction->DebugName(),
         instruction->GetId(),
-        Primitive::PrettyDescriptor(result_type),
-        Primitive::PrettyDescriptor(input_type)));
+        DataType::PrettyDescriptor(result_type),
+        DataType::PrettyDescriptor(input_type)));
   }
 }
 
diff --git a/compiler/optimizing/graph_visualizer.cc b/compiler/optimizing/graph_visualizer.cc
index 3035e46..194f063 100644
--- a/compiler/optimizing/graph_visualizer.cc
+++ b/compiler/optimizing/graph_visualizer.cc
@@ -24,6 +24,7 @@
 #include "bounds_check_elimination.h"
 #include "builder.h"
 #include "code_generator.h"
+#include "data_type-inl.h"
 #include "dead_code_elimination.h"
 #include "disassembler.h"
 #include "inliner.h"
@@ -243,25 +244,6 @@
     }
   }
 
-  char GetTypeId(Primitive::Type type) {
-    // Note that Primitive::Descriptor would not work for us
-    // because it does not handle reference types (that is kPrimNot).
-    switch (type) {
-      case Primitive::kPrimBoolean: return 'z';
-      case Primitive::kPrimByte: return 'b';
-      case Primitive::kPrimChar: return 'c';
-      case Primitive::kPrimShort: return 's';
-      case Primitive::kPrimInt: return 'i';
-      case Primitive::kPrimLong: return 'j';
-      case Primitive::kPrimFloat: return 'f';
-      case Primitive::kPrimDouble: return 'd';
-      case Primitive::kPrimNot: return 'l';
-      case Primitive::kPrimVoid: return 'v';
-    }
-    LOG(FATAL) << "Unreachable";
-    return 'v';
-  }
-
   void PrintPredecessors(HBasicBlock* block) {
     AddIndent();
     output_ << "predecessors";
@@ -583,7 +565,7 @@
     if (!inputs.empty()) {
       StringList input_list;
       for (const HInstruction* input : inputs) {
-        input_list.NewEntryStream() << GetTypeId(input->GetType()) << input->GetId();
+        input_list.NewEntryStream() << DataType::TypeId(input->GetType()) << input->GetId();
       }
       StartAttributeStream() << input_list;
     }
@@ -597,7 +579,7 @@
         for (size_t i = 0, e = environment->Size(); i < e; ++i) {
           HInstruction* insn = environment->GetInstructionAt(i);
           if (insn != nullptr) {
-            vregs.NewEntryStream() << GetTypeId(insn->GetType()) << insn->GetId();
+            vregs.NewEntryStream() << DataType::TypeId(insn->GetType()) << insn->GetId();
           } else {
             vregs.NewEntryStream() << "_";
           }
@@ -654,7 +636,7 @@
 
     if ((IsPass(HGraphBuilder::kBuilderPassName)
         || IsPass(HInliner::kInlinerPassName))
-        && (instruction->GetType() == Primitive::kPrimNot)) {
+        && (instruction->GetType() == DataType::Type::kReference)) {
       ReferenceTypeInfo info = instruction->IsLoadClass()
         ? instruction->AsLoadClass()->GetLoadedClassRTI()
         : instruction->GetReferenceTypeInfo();
@@ -698,7 +680,7 @@
       size_t num_uses = instruction->GetUses().SizeSlow();
       AddIndent();
       output_ << bci << " " << num_uses << " "
-              << GetTypeId(instruction->GetType()) << instruction->GetId() << " ";
+              << DataType::TypeId(instruction->GetType()) << instruction->GetId() << " ";
       PrintInstruction(instruction);
       output_ << " " << kEndInstructionMarker << "\n";
     }
@@ -821,7 +803,7 @@
     for (HInstructionIterator it(block->GetPhis()); !it.Done(); it.Advance()) {
       AddIndent();
       HInstruction* instruction = it.Current();
-      output_ << instruction->GetId() << " " << GetTypeId(instruction->GetType())
+      output_ << instruction->GetId() << " " << DataType::TypeId(instruction->GetType())
               << instruction->GetId() << "[ ";
       for (const HInstruction* input : instruction->GetInputs()) {
         output_ << input->GetId() << " ";
diff --git a/compiler/optimizing/gvn_test.cc b/compiler/optimizing/gvn_test.cc
index e1ed7f6..ac0dbee 100644
--- a/compiler/optimizing/gvn_test.cc
+++ b/compiler/optimizing/gvn_test.cc
@@ -37,7 +37,7 @@
   HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
                                                              dex::TypeIndex(0),
                                                              0,
-                                                             Primitive::kPrimNot);
+                                                             DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HBasicBlock* block = new (&allocator) HBasicBlock(graph);
@@ -46,7 +46,7 @@
 
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimNot,
+                                                           DataType::Type::kReference,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -55,7 +55,7 @@
                                                            0));
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimNot,
+                                                           DataType::Type::kReference,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -65,7 +65,7 @@
   HInstruction* to_remove = block->GetLastInstruction();
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimNot,
+                                                           DataType::Type::kReference,
                                                            MemberOffset(43),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -77,7 +77,7 @@
   block->AddInstruction(new (&allocator) HInstanceFieldSet(parameter,
                                                            parameter,
                                                            nullptr,
-                                                           Primitive::kPrimNot,
+                                                           DataType::Type::kReference,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -86,7 +86,7 @@
                                                            0));
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimNot,
+                                                           DataType::Type::kReference,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -121,7 +121,7 @@
   HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
                                                              dex::TypeIndex(0),
                                                              0,
-                                                             Primitive::kPrimNot);
+                                                             DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HBasicBlock* block = new (&allocator) HBasicBlock(graph);
@@ -129,7 +129,7 @@
   entry->AddSuccessor(block);
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimBoolean,
+                                                           DataType::Type::kBool,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -152,7 +152,7 @@
 
   then->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                           nullptr,
-                                                          Primitive::kPrimBoolean,
+                                                          DataType::Type::kBool,
                                                           MemberOffset(42),
                                                           false,
                                                           kUnknownFieldIndex,
@@ -162,7 +162,7 @@
   then->AddInstruction(new (&allocator) HGoto());
   else_->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimBoolean,
+                                                           DataType::Type::kBool,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -172,7 +172,7 @@
   else_->AddInstruction(new (&allocator) HGoto());
   join->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                           nullptr,
-                                                          Primitive::kPrimBoolean,
+                                                          DataType::Type::kBool,
                                                           MemberOffset(42),
                                                           false,
                                                           kUnknownFieldIndex,
@@ -204,7 +204,7 @@
   HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
                                                              dex::TypeIndex(0),
                                                              0,
-                                                             Primitive::kPrimNot);
+                                                             DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HBasicBlock* block = new (&allocator) HBasicBlock(graph);
@@ -212,7 +212,7 @@
   entry->AddSuccessor(block);
   block->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                            nullptr,
-                                                           Primitive::kPrimBoolean,
+                                                           DataType::Type::kBool,
                                                            MemberOffset(42),
                                                            false,
                                                            kUnknownFieldIndex,
@@ -235,7 +235,7 @@
 
   loop_header->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                                  nullptr,
-                                                                 Primitive::kPrimBoolean,
+                                                                 DataType::Type::kBool,
                                                                  MemberOffset(42),
                                                                  false,
                                                                  kUnknownFieldIndex,
@@ -250,7 +250,7 @@
   loop_body->AddInstruction(new (&allocator) HInstanceFieldSet(parameter,
                                                                parameter,
                                                                nullptr,
-                                                               Primitive::kPrimBoolean,
+                                                               DataType::Type::kBool,
                                                                MemberOffset(42),
                                                                false,
                                                                kUnknownFieldIndex,
@@ -260,7 +260,7 @@
   HInstruction* field_set = loop_body->GetLastInstruction();
   loop_body->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                                nullptr,
-                                                               Primitive::kPrimBoolean,
+                                                               DataType::Type::kBool,
                                                                MemberOffset(42),
                                                                false,
                                                                kUnknownFieldIndex,
@@ -272,7 +272,7 @@
 
   exit->AddInstruction(new (&allocator) HInstanceFieldGet(parameter,
                                                           nullptr,
-                                                          Primitive::kPrimBoolean,
+                                                          DataType::Type::kBool,
                                                           MemberOffset(42),
                                                           false,
                                                           kUnknownFieldIndex,
@@ -351,7 +351,7 @@
   HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
                                                              dex::TypeIndex(0),
                                                              0,
-                                                             Primitive::kPrimBoolean);
+                                                             DataType::Type::kBool);
   entry->AddInstruction(parameter);
   entry->AddInstruction(new (&allocator) HGoto());
   outer_loop_header->AddInstruction(new (&allocator) HSuspendCheck());
@@ -374,7 +374,7 @@
     entry->AddInstruction(new (&allocator) HInstanceFieldSet(parameter,
                                                              parameter,
                                                              nullptr,
-                                                             Primitive::kPrimNot,
+                                                             DataType::Type::kReference,
                                                              MemberOffset(42),
                                                              false,
                                                              kUnknownFieldIndex,
@@ -399,7 +399,7 @@
         new (&allocator) HInstanceFieldSet(parameter,
                                            parameter,
                                            nullptr,
-                                           Primitive::kPrimNot,
+                                           DataType::Type::kReference,
                                            MemberOffset(42),
                                            false,
                                            kUnknownFieldIndex,
@@ -425,7 +425,7 @@
         new (&allocator) HInstanceFieldSet(parameter,
                                            parameter,
                                            nullptr,
-                                           Primitive::kPrimNot,
+                                           DataType::Type::kReference,
                                            MemberOffset(42),
                                            false,
                                            kUnknownFieldIndex,
diff --git a/compiler/optimizing/induction_var_analysis.cc b/compiler/optimizing/induction_var_analysis.cc
index 84b20f6..fe286ab 100644
--- a/compiler/optimizing/induction_var_analysis.cc
+++ b/compiler/optimizing/induction_var_analysis.cc
@@ -56,17 +56,17 @@
 /**
  * Returns true if the from/to types denote a narrowing, integral conversion (precision loss).
  */
-static bool IsNarrowingIntegralConversion(Primitive::Type from, Primitive::Type to) {
+static bool IsNarrowingIntegralConversion(DataType::Type from, DataType::Type to) {
   switch (from) {
-    case Primitive::kPrimLong:
-      return to == Primitive::kPrimByte || to == Primitive::kPrimShort
-          || to == Primitive::kPrimChar || to == Primitive::kPrimInt;
-    case Primitive::kPrimInt:
-      return to == Primitive::kPrimByte || to == Primitive::kPrimShort
-          || to == Primitive::kPrimChar;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-      return to == Primitive::kPrimByte;
+    case DataType::Type::kInt64:
+      return to == DataType::Type::kInt8 || to == DataType::Type::kInt16
+          || to == DataType::Type::kUint16 || to == DataType::Type::kInt32;
+    case DataType::Type::kInt32:
+      return to == DataType::Type::kInt8 || to == DataType::Type::kInt16
+          || to == DataType::Type::kUint16;
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+      return to == DataType::Type::kInt8;
     default:
       return false;
   }
@@ -75,13 +75,13 @@
 /**
  * Returns result of implicit widening type conversion done in HIR.
  */
-static Primitive::Type ImplicitConversion(Primitive::Type type) {
+static DataType::Type ImplicitConversion(DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimBoolean:
-      return Primitive::kPrimInt;
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt8:
+    case DataType::Type::kBool:
+      return DataType::Type::kInt32;
     default:
       return type;
   }
@@ -100,7 +100,7 @@
       scc_(graph->GetArena()->Adapter(kArenaAllocInductionVarAnalysis)),
       cycle_(std::less<HInstruction*>(),
              graph->GetArena()->Adapter(kArenaAllocInductionVarAnalysis)),
-      type_(Primitive::kPrimVoid),
+      type_(DataType::Type::kVoid),
       induction_(std::less<HLoopInformation*>(),
                  graph->GetArena()->Adapter(kArenaAllocInductionVarAnalysis)),
       cycles_(std::less<HPhi*>(),
@@ -520,8 +520,8 @@
 
 HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferConversion(
     InductionInfo* a,
-    Primitive::Type from,
-    Primitive::Type to) {
+    DataType::Type from,
+    DataType::Type to) {
   if (a != nullptr) {
     // Allow narrowing conversion on linear induction in certain cases:
     // induction is already at narrow type, or can be made narrower.
@@ -723,15 +723,15 @@
     HLoopInformation* loop,
     HInstruction* entry_phi,
     HTypeConversion* conversion) {
-  Primitive::Type from = conversion->GetInputType();
-  Primitive::Type to = conversion->GetResultType();
+  DataType::Type from = conversion->GetInputType();
+  DataType::Type to = conversion->GetResultType();
   // A narrowing conversion is allowed as *last* operation of the cycle of a linear induction
   // with an initial value that fits the type, provided that the narrowest encountered type is
   // recorded with the induction to account for the precision loss. The narrower induction does
   // *not* transfer to any wider operations, however, since these may yield out-of-type values
   if (entry_phi->InputCount() == 2 && conversion == entry_phi->InputAt(1)) {
-    int64_t min = Primitive::MinValueOfIntegralType(to);
-    int64_t max = Primitive::MaxValueOfIntegralType(to);
+    int64_t min = DataType::MinValueOfIntegralType(to);
+    int64_t max = DataType::MaxValueOfIntegralType(to);
     int64_t value = 0;
     InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
     if (IsNarrowingIntegralConversion(from, to) &&
@@ -761,7 +761,7 @@
       HCondition* condition = if_expr->AsCondition();
       InductionInfo* a = LookupInfo(loop, condition->InputAt(0));
       InductionInfo* b = LookupInfo(loop, condition->InputAt(1));
-      Primitive::Type type = ImplicitConversion(condition->InputAt(0)->GetType());
+      DataType::Type type = ImplicitConversion(condition->InputAt(0)->GetType());
       // Determine if the loop control uses a known sequence on an if-exit (X outside) or on
       // an if-iterate (X inside), expressed as if-iterate when passed into VisitCondition().
       if (a == nullptr || b == nullptr) {
@@ -778,7 +778,7 @@
 void HInductionVarAnalysis::VisitCondition(HLoopInformation* loop,
                                            InductionInfo* a,
                                            InductionInfo* b,
-                                           Primitive::Type type,
+                                           DataType::Type type,
                                            IfCondition cmp) {
   if (a->induction_class == kInvariant && b->induction_class == kLinear) {
     // Swap condition if induction is at right-hand-side (e.g. U > i is same as i < U).
@@ -809,7 +809,7 @@
     }
     // Only accept integral condition. A mismatch between the type of condition and the induction
     // is only allowed if the, necessarily narrower, induction range fits the narrower control.
-    if (type != Primitive::kPrimInt && type != Primitive::kPrimLong) {
+    if (type != DataType::Type::kInt32 && type != DataType::Type::kInt64) {
       return;  // not integral
     } else if (type != a->type &&
                !FitsNarrowerControl(lower_expr, upper_expr, stride_value, a->type, cmp)) {
@@ -830,7 +830,7 @@
                                            InductionInfo* upper_expr,
                                            InductionInfo* stride_expr,
                                            int64_t stride_value,
-                                           Primitive::Type type,
+                                           DataType::Type type,
                                            IfCondition cmp) {
   // Any loop of the general form:
   //
@@ -931,10 +931,10 @@
 
 bool HInductionVarAnalysis::IsFinite(InductionInfo* upper_expr,
                                      int64_t stride_value,
-                                     Primitive::Type type,
+                                     DataType::Type type,
                                      IfCondition cmp) {
-  int64_t min = Primitive::MinValueOfIntegralType(type);
-  int64_t max = Primitive::MaxValueOfIntegralType(type);
+  int64_t min = DataType::MinValueOfIntegralType(type);
+  int64_t max = DataType::MaxValueOfIntegralType(type);
   // Some rules under which it is certain at compile-time that the loop is finite.
   int64_t value;
   switch (cmp) {
@@ -957,10 +957,10 @@
 bool HInductionVarAnalysis::FitsNarrowerControl(InductionInfo* lower_expr,
                                                 InductionInfo* upper_expr,
                                                 int64_t stride_value,
-                                                Primitive::Type type,
+                                                DataType::Type type,
                                                 IfCondition cmp) {
-  int64_t min = Primitive::MinValueOfIntegralType(type);
-  int64_t max = Primitive::MaxValueOfIntegralType(type);
+  int64_t min = DataType::MinValueOfIntegralType(type);
+  int64_t max = DataType::MaxValueOfIntegralType(type);
   // Inclusive test need one extra.
   if (stride_value != 1 && stride_value != -1) {
     return false;  // non-unit stride
@@ -1008,13 +1008,13 @@
 }
 
 HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::CreateConstant(int64_t value,
-                                                                            Primitive::Type type) {
+                                                                            DataType::Type type) {
   HInstruction* constant;
   switch (type) {
-    case Primitive::kPrimDouble: constant = graph_->GetDoubleConstant(value); break;
-    case Primitive::kPrimFloat:  constant = graph_->GetFloatConstant(value);  break;
-    case Primitive::kPrimLong:   constant = graph_->GetLongConstant(value);   break;
-    default:                     constant = graph_->GetIntConstant(value);    break;
+    case DataType::Type::kFloat64: constant = graph_->GetDoubleConstant(value); break;
+    case DataType::Type::kFloat32: constant = graph_->GetFloatConstant(value);  break;
+    case DataType::Type::kInt64:   constant = graph_->GetLongConstant(value);   break;
+    default:                       constant = graph_->GetIntConstant(value);    break;
   }
   return CreateInvariantFetch(constant);
 }
@@ -1100,11 +1100,11 @@
   InductionInfo* b = LookupInfo(loop, instruction->InputAt(1));
   int64_t value = -1;
   if (IsExact(b, &value)) {
-    Primitive::Type type = instruction->InputAt(0)->GetType();
-    if (type == Primitive::kPrimInt && 0 <= value && value < 31) {
+    DataType::Type type = instruction->InputAt(0)->GetType();
+    if (type == DataType::Type::kInt32 && 0 <= value && value < 31) {
       return graph_->GetIntConstant(1 << value);
     }
-    if (type == Primitive::kPrimLong && 0 <= value && value < 63) {
+    if (type == DataType::Type::kInt64 && 0 <= value && value < 63) {
       return graph_->GetLongConstant(1L << value);
     }
   }
@@ -1142,11 +1142,11 @@
 bool HInductionVarAnalysis::IsNarrowingLinear(InductionInfo* info) {
   return info != nullptr &&
       info->induction_class == kLinear &&
-      (info->type == Primitive::kPrimByte ||
-       info->type == Primitive::kPrimShort ||
-       info->type == Primitive::kPrimChar ||
-       (info->type == Primitive::kPrimInt && (info->op_a->type == Primitive::kPrimLong ||
-                                              info->op_b->type == Primitive::kPrimLong)));
+      (info->type == DataType::Type::kInt8 ||
+       info->type == DataType::Type::kInt16 ||
+       info->type == DataType::Type::kUint16 ||
+       (info->type == DataType::Type::kInt32 && (info->op_a->type == DataType::Type::kInt64 ||
+                                                 info->op_b->type == DataType::Type::kInt64)));
 }
 
 bool HInductionVarAnalysis::InductionEqual(InductionInfo* info1,
@@ -1207,12 +1207,12 @@
         DCHECK(info->operation == kNop);
         return "(" + InductionToString(info->op_a) + " * i + " +
                      InductionToString(info->op_b) + "):" +
-                     Primitive::PrettyDescriptor(info->type);
+                     DataType::PrettyDescriptor(info->type);
       } else if (info->induction_class == kPolynomial) {
         DCHECK(info->operation == kNop);
         return "poly(sum_lt(" + InductionToString(info->op_a) + ") + " +
                                 InductionToString(info->op_b) + "):" +
-                                Primitive::PrettyDescriptor(info->type);
+                                DataType::PrettyDescriptor(info->type);
       } else if (info->induction_class == kGeometric) {
         DCHECK(info->operation == kMul || info->operation == kDiv);
         DCHECK(info->fetch != nullptr);
@@ -1220,17 +1220,17 @@
                         FetchToString(info->fetch) +
                         (info->operation == kMul ? " ^ i + " : " ^ -i + ") +
                         InductionToString(info->op_b) + "):" +
-                        Primitive::PrettyDescriptor(info->type);
+                        DataType::PrettyDescriptor(info->type);
       } else if (info->induction_class == kWrapAround) {
         DCHECK(info->operation == kNop);
         return "wrap(" + InductionToString(info->op_a) + ", " +
                          InductionToString(info->op_b) + "):" +
-                         Primitive::PrettyDescriptor(info->type);
+                         DataType::PrettyDescriptor(info->type);
       } else if (info->induction_class == kPeriodic) {
         DCHECK(info->operation == kNop);
         return "periodic(" + InductionToString(info->op_a) + ", " +
                              InductionToString(info->op_b) + "):" +
-                             Primitive::PrettyDescriptor(info->type);
+                             DataType::PrettyDescriptor(info->type);
       }
     }
   }
diff --git a/compiler/optimizing/induction_var_analysis.h b/compiler/optimizing/induction_var_analysis.h
index 39b39cd..421b3ab 100644
--- a/compiler/optimizing/induction_var_analysis.h
+++ b/compiler/optimizing/induction_var_analysis.h
@@ -103,7 +103,7 @@
                   InductionInfo* a,
                   InductionInfo* b,
                   HInstruction* f,
-                  Primitive::Type t)
+                  DataType::Type t)
         : induction_class(ic),
           operation(op),
           op_a(a),
@@ -115,7 +115,7 @@
     InductionInfo* op_a;
     InductionInfo* op_b;
     HInstruction* fetch;
-    Primitive::Type type;  // precision of operation
+    DataType::Type type;  // precision of operation
   };
 
   bool IsVisitedNode(HInstruction* instruction) const {
@@ -136,7 +136,7 @@
   InductionInfo* CreateTripCount(InductionOp op,
                                  InductionInfo* a,
                                  InductionInfo* b,
-                                 Primitive::Type type) {
+                                 DataType::Type type) {
     DCHECK(a != nullptr && b != nullptr);
     return new (graph_->GetArena()) InductionInfo(kInvariant, op, a, b, nullptr, type);
   }
@@ -146,7 +146,7 @@
                                  InductionInfo* a,
                                  InductionInfo* b,
                                  HInstruction* f,
-                                 Primitive::Type type) {
+                                 DataType::Type type) {
     DCHECK(a != nullptr && b != nullptr);
     return new (graph_->GetArena()) InductionInfo(ic, op, a, b, f, type);
   }
@@ -167,7 +167,7 @@
   InductionInfo* TransferAddSub(InductionInfo* a, InductionInfo* b, InductionOp op);
   InductionInfo* TransferNeg(InductionInfo* a);
   InductionInfo* TransferMul(InductionInfo* a, InductionInfo* b);
-  InductionInfo* TransferConversion(InductionInfo* a, Primitive::Type from, Primitive::Type to);
+  InductionInfo* TransferConversion(InductionInfo* a, DataType::Type from, DataType::Type to);
 
   // Solvers.
   InductionInfo* SolvePhi(HInstruction* phi, size_t input_index, size_t adjust_input_size);
@@ -200,30 +200,30 @@
   void VisitCondition(HLoopInformation* loop,
                       InductionInfo* a,
                       InductionInfo* b,
-                      Primitive::Type type,
+                      DataType::Type type,
                       IfCondition cmp);
   void VisitTripCount(HLoopInformation* loop,
                       InductionInfo* lower_expr,
                       InductionInfo* upper_expr,
                       InductionInfo* stride,
                       int64_t stride_value,
-                      Primitive::Type type,
+                      DataType::Type type,
                       IfCondition cmp);
   bool IsTaken(InductionInfo* lower_expr, InductionInfo* upper_expr, IfCondition cmp);
   bool IsFinite(InductionInfo* upper_expr,
                 int64_t stride_value,
-                Primitive::Type type,
+                DataType::Type type,
                 IfCondition cmp);
   bool FitsNarrowerControl(InductionInfo* lower_expr,
                            InductionInfo* upper_expr,
                            int64_t stride_value,
-                           Primitive::Type type,
+                           DataType::Type type,
                            IfCondition cmp);
 
   // Assign and lookup.
   void AssignInfo(HLoopInformation* loop, HInstruction* instruction, InductionInfo* info);
   InductionInfo* LookupInfo(HLoopInformation* loop, HInstruction* instruction);
-  InductionInfo* CreateConstant(int64_t value, Primitive::Type type);
+  InductionInfo* CreateConstant(int64_t value, DataType::Type type);
   InductionInfo* CreateSimplifiedInvariant(InductionOp op, InductionInfo* a, InductionInfo* b);
   HInstruction* GetShiftConstant(HLoopInformation* loop,
                                  HInstruction* instruction,
@@ -250,7 +250,7 @@
   ArenaSafeMap<HInstruction*, NodeInfo> map_;
   ArenaVector<HInstruction*> scc_;
   ArenaSafeMap<HInstruction*, InductionInfo*> cycle_;
-  Primitive::Type type_;
+  DataType::Type type_;
 
   /**
    * Maintains the results of the analysis as a mapping from loops to a mapping from instructions
diff --git a/compiler/optimizing/induction_var_analysis_test.cc b/compiler/optimizing/induction_var_analysis_test.cc
index 9516ccb..53c8044 100644
--- a/compiler/optimizing/induction_var_analysis_test.cc
+++ b/compiler/optimizing/induction_var_analysis_test.cc
@@ -94,7 +94,7 @@
 
     // Provide entry and exit instructions.
     parameter_ = new (&allocator_) HParameterValue(
-        graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot, true);
+        graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference, true);
     entry_->AddInstruction(parameter_);
     constant0_ = graph_->GetIntConstant(0);
     constant1_ = graph_->GetIntConstant(1);
@@ -108,13 +108,13 @@
 
     // Provide loop instructions.
     for (int d = 0; d < n; d++) {
-      basic_[d] = new (&allocator_) HPhi(&allocator_, d, 0, Primitive::kPrimInt);
+      basic_[d] = new (&allocator_) HPhi(&allocator_, d, 0, DataType::Type::kInt32);
       loop_preheader_[d]->AddInstruction(new (&allocator_) HGoto());
       loop_header_[d]->AddPhi(basic_[d]);
       HInstruction* compare = new (&allocator_) HLessThan(basic_[d], constant100_);
       loop_header_[d]->AddInstruction(compare);
       loop_header_[d]->AddInstruction(new (&allocator_) HIf(compare));
-      increment_[d] = new (&allocator_) HAdd(Primitive::kPrimInt, basic_[d], constant1_);
+      increment_[d] = new (&allocator_) HAdd(DataType::Type::kInt32, basic_[d], constant1_);
       loop_body_[d]->AddInstruction(increment_[d]);
       loop_body_[d]->AddInstruction(new (&allocator_) HGoto());
 
@@ -141,7 +141,7 @@
     *ifT = ifTrue;
     *ifF = ifFalse;
 
-    HPhi* select_phi = new (&allocator_) HPhi(&allocator_, -1, 0, Primitive::kPrimInt);
+    HPhi* select_phi = new (&allocator_) HPhi(&allocator_, -1, 0, DataType::Type::kInt32);
     loop_body_[d]->AddPhi(select_phi);
     return select_phi;
   }
@@ -154,7 +154,7 @@
 
   // Inserts a phi to loop header at depth d and returns it.
   HPhi* InsertLoopPhi(int vreg, int d) {
-    HPhi* phi = new (&allocator_) HPhi(&allocator_, vreg, 0, Primitive::kPrimInt);
+    HPhi* phi = new (&allocator_) HPhi(&allocator_, vreg, 0, DataType::Type::kInt32);
     loop_header_[d]->AddPhi(phi);
     return phi;
   }
@@ -165,7 +165,7 @@
     // ArraySet is given a float value in order to avoid SsaBuilder typing
     // it from the array's non-existent reference type info.
     return InsertInstruction(new (&allocator_) HArraySet(
-        parameter_, subscript, float_constant0_, Primitive::kPrimFloat, 0), d);
+        parameter_, subscript, float_constant0_, DataType::Type::kFloat32, 0), d);
   }
 
   // Returns induction information of instruction in loop at depth d.
@@ -265,8 +265,8 @@
   HInstruction* store = InsertArrayStore(basic_[0], 0);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("((1) * i + (0)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
-  EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(increment_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int32", GetInductionInfo(store->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (1)):Int32", GetInductionInfo(increment_[0], 0).c_str());
 
   // Offset matters!
   EXPECT_FALSE(HaveSameInduction(store->InputAt(1), increment_[0]));
@@ -286,22 +286,22 @@
   // }
   BuildLoopNest(1);
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, constant100_, basic_[0]), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, constant100_, basic_[0]), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, constant100_, basic_[0]), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, constant100_, basic_[0]), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, constant100_, basic_[0]), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, constant100_, basic_[0]), 0);
   HInstruction* shl = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, basic_[0], constant1_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, basic_[0], constant1_), 0);
   HInstruction* neg = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, basic_[0]), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, basic_[0]), 0);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("((1) * i + (100)):PrimInt", GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("(( - (1)) * i + (100)):PrimInt", GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("((100) * i + (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("((2) * i + (0)):PrimInt", GetInductionInfo(shl, 0).c_str());
-  EXPECT_STREQ("(( - (1)) * i + (0)):PrimInt", GetInductionInfo(neg, 0).c_str());
+  EXPECT_STREQ("((1) * i + (100)):Int32", GetInductionInfo(add, 0).c_str());
+  EXPECT_STREQ("(( - (1)) * i + (100)):Int32", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("((100) * i + (0)):Int32", GetInductionInfo(mul, 0).c_str());
+  EXPECT_STREQ("((2) * i + (0)):Int32", GetInductionInfo(shl, 0).c_str());
+  EXPECT_STREQ("(( - (1)) * i + (0)):Int32", GetInductionInfo(neg, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindChainInduction) {
@@ -318,19 +318,19 @@
   k_header->AddInput(constant0_);
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* store1 = InsertArrayStore(add, 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, add, constant1_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, add, constant1_), 0);
   HInstruction* store2 = InsertArrayStore(sub, 0);
   k_header->AddInput(sub);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("(((100) - (1)) * i + (0)):PrimInt",
+  EXPECT_STREQ("(((100) - (1)) * i + (0)):Int32",
                GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("(((100) - (1)) * i + (100)):PrimInt",
+  EXPECT_STREQ("(((100) - (1)) * i + (100)):Int32",
                GetInductionInfo(store1->InputAt(1), 0).c_str());
-  EXPECT_STREQ("(((100) - (1)) * i + ((100) - (1))):PrimInt",
+  EXPECT_STREQ("(((100) - (1)) * i + ((100) - (1))):Int32",
                GetInductionInfo(store2->InputAt(1), 0).c_str());
 }
 
@@ -351,11 +351,11 @@
   HPhi* k_body = BuildIf(0, &ifTrue, &ifFalse);
 
   // True-branch.
-  HInstruction* inc1 = new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_);
+  HInstruction* inc1 = new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant1_);
   ifTrue->AddInstruction(inc1);
   k_body->AddInput(inc1);
   // False-branch.
-  HInstruction* inc2 = new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_);
+  HInstruction* inc2 = new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant1_);
   ifFalse->AddInstruction(inc2);
   k_body->AddInput(inc2);
   // Merge over a phi.
@@ -363,8 +363,8 @@
   k_header->AddInput(k_body);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("((1) * i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("((1) * i + (1)):Int32", GetInductionInfo(store->InputAt(1), 0).c_str());
 
   // Both increments get same induction.
   EXPECT_TRUE(HaveSameInduction(store->InputAt(1), inc1));
@@ -384,18 +384,18 @@
   HPhi* k = BuildIf(0, &ifTrue, &ifFalse);
 
   // True-branch.
-  HInstruction* inc1 = new (&allocator_) HAdd(Primitive::kPrimInt, basic_[0], constant1_);
+  HInstruction* inc1 = new (&allocator_) HAdd(DataType::Type::kInt32, basic_[0], constant1_);
   ifTrue->AddInstruction(inc1);
   k->AddInput(inc1);
   // False-branch.
-  HInstruction* inc2 = new (&allocator_) HAdd(Primitive::kPrimInt, basic_[0], constant1_);
+  HInstruction* inc2 = new (&allocator_) HAdd(DataType::Type::kInt32, basic_[0], constant1_);
   ifFalse->AddInstruction(inc2);
   k->AddInput(inc2);
   // Merge over a phi.
   HInstruction* store = InsertArrayStore(k, 0);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (1)):Int32", GetInductionInfo(store->InputAt(1), 0).c_str());
 
   // Both increments get same induction.
   EXPECT_TRUE(HaveSameInduction(store->InputAt(1), inc1));
@@ -412,17 +412,17 @@
   BuildLoopNest(1);
 
   HInstruction* add1 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, basic_[0], basic_[0]), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, basic_[0], basic_[0]), 0);
   HInstruction* add2 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, constant7_, basic_[0]), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, constant7_, basic_[0]), 0);
   HInstruction* add3 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, add1, add2), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, add1, add2), 0);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("((1) * i + (0)):PrimInt", GetInductionInfo(basic_[0], 0).c_str());
-  EXPECT_STREQ("(((1) + (1)) * i + (0)):PrimInt", GetInductionInfo(add1, 0).c_str());
-  EXPECT_STREQ("((1) * i + (7)):PrimInt", GetInductionInfo(add2, 0).c_str());
-  EXPECT_STREQ("((((1) + (1)) + (1)) * i + (7)):PrimInt", GetInductionInfo(add3, 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int32", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("(((1) + (1)) * i + (0)):Int32", GetInductionInfo(add1, 0).c_str());
+  EXPECT_STREQ("((1) * i + (7)):Int32", GetInductionInfo(add2, 0).c_str());
+  EXPECT_STREQ("((((1) + (1)) + (1)) * i + (7)):Int32", GetInductionInfo(add3, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindPolynomialInduction) {
@@ -438,18 +438,18 @@
   k_header->AddInput(constant1_);
 
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, basic_[0], constant2_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, basic_[0], constant2_), 0);
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, constant100_, mul), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, constant100_, mul), 0);
   HInstruction* pol = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, add, k_header), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, add, k_header), 0);
   k_header->AddInput(pol);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle and the base linear induction are classified.
-  EXPECT_STREQ("poly(sum_lt(((2) * i + (100)):PrimInt) + (1)):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((2) * i + (100)):Int32) + (1)):Int32",
                GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("((2) * i + (100)):PrimInt", GetInductionInfo(add, 0).c_str());
+  EXPECT_STREQ("((2) * i + (100)):Int32", GetInductionInfo(add, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(pol, 0).c_str());
 }
 
@@ -469,32 +469,32 @@
   k_header->AddInput(constant1_);
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* neg = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, sub), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* shl = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* pol = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, basic_[0]), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, basic_[0]), 0);
   k_header->AddInput(pol);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle and derived are classified.
-  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + (1)):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):Int32) + (1)):Int32",
                GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + ((1) + (100))):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):Int32) + ((1) + (100))):Int32",
                GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + ((1) - (1))):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):Int32) + ((1) - (1))):Int32",
                GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt((( - (1)) * i + (0)):PrimInt) + ((1) - (1))):PrimInt",
+  EXPECT_STREQ("poly(sum_lt((( - (1)) * i + (0)):Int32) + ((1) - (1))):Int32",
                GetInductionInfo(neg, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt(((2) * i + (0)):PrimInt) + (2)):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((2) * i + (0)):Int32) + (2)):Int32",
                GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt(((4) * i + (0)):PrimInt) + (4)):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((4) * i + (0)):Int32) + (4)):Int32",
                GetInductionInfo(shl, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(pol, 0).c_str());
 }
@@ -512,21 +512,21 @@
   k_header->AddInput(constant7_);
 
   HInstruction* add1 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, k_header), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, k_header), 0);
   HInstruction* add2 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, add1, k_header), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, add1, k_header), 0);
   HInstruction* add3 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, basic_[0]), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, basic_[0]), 0);
   k_header->AddInput(add3);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle and added-derived are classified.
-  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + (7)):PrimInt",
+  EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):Int32) + (7)):Int32",
                GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("poly(sum_lt((((1) + (1)) * i + (0)):PrimInt) + ((7) + (7))):PrimInt",
+  EXPECT_STREQ("poly(sum_lt((((1) + (1)) * i + (0)):Int32) + ((7) + (7))):Int32",
                GetInductionInfo(add1, 0).c_str());
   EXPECT_STREQ(
-      "poly(sum_lt(((((1) + (1)) + (1)) * i + (0)):PrimInt) + (((7) + (7)) + (7))):PrimInt",
+      "poly(sum_lt(((((1) + (1)) + (1)) * i + (0)):Int32) + (((7) + (7)) + (7))):Int32",
       GetInductionInfo(add2, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(add3, 0).c_str());
 }
@@ -542,12 +542,12 @@
   k_header->AddInput(constant1_);
 
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, k_header, constant100_), 0);
   k_header->AddInput(mul);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("geo((1) * 100 ^ i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("geo((100) * 100 ^ i + (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
+  EXPECT_STREQ("geo((1) * 100 ^ i + (0)):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("geo((100) * 100 ^ i + (0)):Int32", GetInductionInfo(mul, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindGeometricShlInductionAndDerived) {
@@ -567,31 +567,31 @@
   k_header->AddInput(constant1_);
 
   HInstruction* add1 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* shl1 = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* add2 = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, shl1, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, shl1, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, shl1, constant1_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, shl1, constant1_), 0);
   HInstruction* neg = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, sub), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, shl1, constant2_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, shl1, constant2_), 0);
   HInstruction* shl2 = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, shl1, constant2_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, shl1, constant2_), 0);
   k_header->AddInput(shl1);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("geo((1) * 2 ^ i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("geo((1) * 2 ^ i + (1)):PrimInt", GetInductionInfo(add1, 0).c_str());
-  EXPECT_STREQ("geo((2) * 2 ^ i + (0)):PrimInt", GetInductionInfo(shl1, 0).c_str());
-  EXPECT_STREQ("geo((2) * 2 ^ i + (100)):PrimInt", GetInductionInfo(add2, 0).c_str());
-  EXPECT_STREQ("geo((2) * 2 ^ i + ((0) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("geo(( - (2)) * 2 ^ i + ( - ((0) - (1)))):PrimInt",
+  EXPECT_STREQ("geo((1) * 2 ^ i + (0)):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("geo((1) * 2 ^ i + (1)):Int32", GetInductionInfo(add1, 0).c_str());
+  EXPECT_STREQ("geo((2) * 2 ^ i + (0)):Int32", GetInductionInfo(shl1, 0).c_str());
+  EXPECT_STREQ("geo((2) * 2 ^ i + (100)):Int32", GetInductionInfo(add2, 0).c_str());
+  EXPECT_STREQ("geo((2) * 2 ^ i + ((0) - (1))):Int32", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("geo(( - (2)) * 2 ^ i + ( - ((0) - (1)))):Int32",
                GetInductionInfo(neg, 0).c_str());
-  EXPECT_STREQ("geo(((2) * (2)) * 2 ^ i + (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("geo(((2) * (4)) * 2 ^ i + (0)):PrimInt", GetInductionInfo(shl2, 0).c_str());
+  EXPECT_STREQ("geo(((2) * (2)) * 2 ^ i + (0)):Int32", GetInductionInfo(mul, 0).c_str());
+  EXPECT_STREQ("geo(((2) * (4)) * 2 ^ i + (0)):Int32", GetInductionInfo(shl2, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindGeometricDivInductionAndDerived) {
@@ -610,24 +610,24 @@
   k_header->AddInput(constant1_);
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* neg = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, sub), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* shl = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* div = InsertInstruction(
-      new (&allocator_) HDiv(Primitive::kPrimInt, k_header, constant100_, kNoDexPc), 0);
+      new (&allocator_) HDiv(DataType::Type::kInt32, k_header, constant100_, kNoDexPc), 0);
   k_header->AddInput(div);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle and direct additive derived are classified.
-  EXPECT_STREQ("geo((1) * 100 ^ -i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("geo((1) * 100 ^ -i + (100)):PrimInt", GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("geo((1) * 100 ^ -i + ((0) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("geo((1) * 100 ^ -i + (0)):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("geo((1) * 100 ^ -i + (100)):Int32", GetInductionInfo(add, 0).c_str());
+  EXPECT_STREQ("geo((1) * 100 ^ -i + ((0) - (1))):Int32", GetInductionInfo(sub, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(neg, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(mul, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(shl, 0).c_str());
@@ -645,12 +645,12 @@
   k_header->AddInput(constant100_);
 
   HInstruction* shr = InsertInstruction(
-      new (&allocator_) HShr(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HShr(DataType::Type::kInt32, k_header, constant1_), 0);
   k_header->AddInput(shr);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle is classified.
-  EXPECT_STREQ("geo((100) * 2 ^ -i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("geo((100) * 2 ^ -i + (0)):Int32", GetInductionInfo(k_header, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(shr, 0).c_str());
 }
 
@@ -665,7 +665,7 @@
   k_header->AddInput(constantm1_);
 
   HInstruction* shr = InsertInstruction(
-      new (&allocator_) HShr(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HShr(DataType::Type::kInt32, k_header, constant1_), 0);
   k_header->AddInput(shr);
   PerformInductionVarAnalysis();
 
@@ -689,27 +689,32 @@
   k_header->AddInput(constant100_);
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* neg = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, sub), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* shl = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, k_header, constant2_), 0);
   HInstruction* rem = InsertInstruction(
-      new (&allocator_) HRem(Primitive::kPrimInt, k_header, constant7_, kNoDexPc), 0);
+      new (&allocator_) HRem(DataType::Type::kInt32, k_header, constant7_, kNoDexPc), 0);
   k_header->AddInput(rem);
   PerformInductionVarAnalysis();
 
   // Note, only the phi in the cycle and derived are classified.
-  EXPECT_STREQ("wrap((100), ((100) % (7))):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("wrap(((100) + (100)), (((100) % (7)) + (100))):PrimInt", GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("wrap(((100) - (1)), (((100) % (7)) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("wrap(( - ((100) - (1))), ( - (((100) % (7)) - (1)))):PrimInt", GetInductionInfo(neg, 0).c_str());
-  EXPECT_STREQ("wrap(((100) * (2)), (((100) % (7)) * (2))):PrimInt", GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("wrap(((100) * (4)), (((100) % (7)) * (4))):PrimInt", GetInductionInfo(shl, 0).c_str());
+  EXPECT_STREQ("wrap((100), ((100) % (7))):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("wrap(((100) + (100)), (((100) % (7)) + (100))):Int32",
+               GetInductionInfo(add, 0).c_str());
+  EXPECT_STREQ("wrap(((100) - (1)), (((100) % (7)) - (1))):Int32",
+               GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("wrap(( - ((100) - (1))), ( - (((100) % (7)) - (1)))):Int32",
+               GetInductionInfo(neg, 0).c_str());
+  EXPECT_STREQ("wrap(((100) * (2)), (((100) % (7)) * (2))):Int32",
+               GetInductionInfo(mul, 0).c_str());
+  EXPECT_STREQ("wrap(((100) * (4)), (((100) % (7)) * (4))):Int32",
+               GetInductionInfo(shl, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(rem, 0).c_str());
 }
 
@@ -726,15 +731,15 @@
 
   HInstruction* store = InsertArrayStore(k_header, 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, constant100_, basic_[0]), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, constant100_, basic_[0]), 0);
   k_header->AddInput(sub);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):Int32):Int32",
                GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):Int32):Int32",
                GetInductionInfo(store->InputAt(1), 0).c_str());
-  EXPECT_STREQ("(( - (1)) * i + (100)):PrimInt", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("(( - (1)) * i + (100)):Int32", GetInductionInfo(sub, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindSecondOrderWrapAroundInduction) {
@@ -755,11 +760,11 @@
   HInstruction* store = InsertArrayStore(k_header, 0);
   k_header->AddInput(t);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, constant100_, basic_[0], 0), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, constant100_, basic_[0], 0), 0);
   t->AddInput(sub);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("wrap((0), wrap((100), (( - (1)) * i + (100)):PrimInt):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), wrap((100), (( - (1)) * i + (100)):Int32):Int32):Int32",
                GetInductionInfo(store->InputAt(1), 0).c_str());
 }
 
@@ -780,34 +785,34 @@
   k_header->AddInput(constant0_);
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, k_header, constant100_), 0);
   HInstruction* shl1 = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* neg1 = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, k_header), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, k_header), 0);
   HInstruction* shl2 = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, basic_[0], constant1_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, basic_[0], constant1_), 0);
   HInstruction* neg2 = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, shl2), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, shl2), 0);
   k_header->AddInput(shl2);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("wrap((100), ((2) * i + (100)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((100), ((2) * i + (100)):Int32):Int32",
                GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("wrap(((0) - (100)), ((2) * i + ((0) - (100))):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap(((0) - (100)), ((2) * i + ((0) - (100))):Int32):Int32",
                GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("wrap((0), (((2) * (100)) * i + (0)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), (((2) * (100)) * i + (0)):Int32):Int32",
                GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("wrap((0), (((2) * (2)) * i + (0)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), (((2) * (2)) * i + (0)):Int32):Int32",
                GetInductionInfo(shl1, 0).c_str());
-  EXPECT_STREQ("wrap((0), (( - (2)) * i + (0)):PrimInt):PrimInt",
+  EXPECT_STREQ("wrap((0), (( - (2)) * i + (0)):Int32):Int32",
                GetInductionInfo(neg1, 0).c_str());
-  EXPECT_STREQ("((2) * i + (0)):PrimInt", GetInductionInfo(shl2, 0).c_str());
-  EXPECT_STREQ("(( - (2)) * i + (0)):PrimInt", GetInductionInfo(neg2, 0).c_str());
+  EXPECT_STREQ("((2) * i + (0)):Int32", GetInductionInfo(shl2, 0).c_str());
+  EXPECT_STREQ("(( - (2)) * i + (0)):Int32", GetInductionInfo(neg2, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindPeriodicInduction) {
@@ -834,8 +839,8 @@
   t->AddInput(k_header);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (100)):PrimInt", GetInductionInfo(store1->InputAt(1), 0).c_str());
-  EXPECT_STREQ("periodic((100), (0)):PrimInt", GetInductionInfo(store2->InputAt(1), 0).c_str());
+  EXPECT_STREQ("periodic((0), (100)):Int32", GetInductionInfo(store1->InputAt(1), 0).c_str());
+  EXPECT_STREQ("periodic((100), (0)):Int32", GetInductionInfo(store2->InputAt(1), 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindIdiomaticPeriodicInduction) {
@@ -851,12 +856,12 @@
 
   HInstruction* store = InsertArrayStore(k_header, 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, constant1_, k_header), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, constant1_, k_header), 0);
   k_header->AddInput(sub);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimInt", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Int32", GetInductionInfo(store->InputAt(1), 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Int32", GetInductionInfo(sub, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindXorPeriodicInduction) {
@@ -872,12 +877,12 @@
 
   HInstruction* store = InsertArrayStore(k_header, 0);
   HInstruction* x = InsertInstruction(
-      new (&allocator_) HXor(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HXor(DataType::Type::kInt32, k_header, constant1_), 0);
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimInt", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Int32", GetInductionInfo(store->InputAt(1), 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Int32", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindXorConstantLeftPeriodicInduction) {
@@ -891,12 +896,12 @@
   k_header->AddInput(constant1_);
 
   HInstruction* x = InsertInstruction(
-      new (&allocator_) HXor(Primitive::kPrimInt, constant1_, k_header), 0);
+      new (&allocator_) HXor(DataType::Type::kInt32, constant1_, k_header), 0);
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((1), ((1) ^ (1))):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic(((1) ^ (1)), (1)):PrimInt", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((1), ((1) ^ (1))):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic(((1) ^ (1)), (1)):Int32", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindXor100PeriodicInduction) {
@@ -910,12 +915,12 @@
   k_header->AddInput(constant1_);
 
   HInstruction* x = InsertInstruction(
-      new (&allocator_) HXor(Primitive::kPrimInt, k_header, constant100_), 0);
+      new (&allocator_) HXor(DataType::Type::kInt32, k_header, constant100_), 0);
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((1), ((1) ^ (100))):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic(((1) ^ (100)), (1)):PrimInt", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((1), ((1) ^ (100))):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic(((1) ^ (100)), (1)):Int32", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindBooleanEqPeriodicInduction) {
@@ -932,8 +937,8 @@
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Bool", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Bool", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindBooleanEqConstantLeftPeriodicInduction) {
@@ -950,8 +955,8 @@
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Bool", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Bool", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindBooleanNePeriodicInduction) {
@@ -968,8 +973,8 @@
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Bool", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Bool", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindBooleanNeConstantLeftPeriodicInduction) {
@@ -986,8 +991,8 @@
   k_header->AddInput(x);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Bool", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Bool", GetInductionInfo(x, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindDerivedPeriodicInduction) {
@@ -1007,30 +1012,30 @@
   k_header->AddInput(constant0_);
 
   HInstruction* neg1 = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, k_header), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, k_header), 0);
   HInstruction* idiom = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, constant1_, k_header), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, constant1_, k_header), 0);
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, idiom, constant100_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, idiom, constant100_), 0);
   HInstruction* sub = InsertInstruction(
-      new (&allocator_) HSub(Primitive::kPrimInt, idiom, constant100_), 0);
+      new (&allocator_) HSub(DataType::Type::kInt32, idiom, constant100_), 0);
   HInstruction* mul = InsertInstruction(
-      new (&allocator_) HMul(Primitive::kPrimInt, idiom, constant100_), 0);
+      new (&allocator_) HMul(DataType::Type::kInt32, idiom, constant100_), 0);
   HInstruction* shl = InsertInstruction(
-      new (&allocator_) HShl(Primitive::kPrimInt, idiom, constant1_), 0);
+      new (&allocator_) HShl(DataType::Type::kInt32, idiom, constant1_), 0);
   HInstruction* neg2 = InsertInstruction(
-      new (&allocator_) HNeg(Primitive::kPrimInt, idiom), 0);
+      new (&allocator_) HNeg(DataType::Type::kInt32, idiom), 0);
   k_header->AddInput(idiom);
   PerformInductionVarAnalysis();
 
-  EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(k_header, 0).c_str());
-  EXPECT_STREQ("periodic((0), ( - (1))):PrimInt", GetInductionInfo(neg1, 0).c_str());
-  EXPECT_STREQ("periodic((1), (0)):PrimInt", GetInductionInfo(idiom, 0).c_str());
-  EXPECT_STREQ("periodic(((1) + (100)), (100)):PrimInt", GetInductionInfo(add, 0).c_str());
-  EXPECT_STREQ("periodic(((1) - (100)), ((0) - (100))):PrimInt", GetInductionInfo(sub, 0).c_str());
-  EXPECT_STREQ("periodic((100), (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
-  EXPECT_STREQ("periodic((2), (0)):PrimInt", GetInductionInfo(shl, 0).c_str());
-  EXPECT_STREQ("periodic(( - (1)), (0)):PrimInt", GetInductionInfo(neg2, 0).c_str());
+  EXPECT_STREQ("periodic((0), (1)):Int32", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("periodic((0), ( - (1))):Int32", GetInductionInfo(neg1, 0).c_str());
+  EXPECT_STREQ("periodic((1), (0)):Int32", GetInductionInfo(idiom, 0).c_str());
+  EXPECT_STREQ("periodic(((1) + (100)), (100)):Int32", GetInductionInfo(add, 0).c_str());
+  EXPECT_STREQ("periodic(((1) - (100)), ((0) - (100))):Int32", GetInductionInfo(sub, 0).c_str());
+  EXPECT_STREQ("periodic((100), (0)):Int32", GetInductionInfo(mul, 0).c_str());
+  EXPECT_STREQ("periodic((2), (0)):Int32", GetInductionInfo(shl, 0).c_str());
+  EXPECT_STREQ("periodic(( - (1)), (0)):Int32", GetInductionInfo(neg2, 0).c_str());
 }
 
 TEST_F(InductionVarAnalysisTest, FindDeepLoopInduction) {
@@ -1052,7 +1057,7 @@
   }
 
   HInstruction* inc = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, constant1_, k_header[9]), 9);
+      new (&allocator_) HAdd(DataType::Type::kInt32, constant1_, k_header[9]), 9);
   HInstruction* store = InsertArrayStore(inc, 9);
 
   for (int d = 0; d < 10; d++) {
@@ -1063,7 +1068,7 @@
 
   // Avoid exact phi number, since that depends on the SSA building phase.
   std::regex r("\\(\\(1\\) \\* i \\+ "
-               "\\(\\(1\\) \\+ \\(\\d+:Phi\\)\\)\\):PrimInt");
+               "\\(\\(1\\) \\+ \\(\\d+:Phi\\)\\)\\):Int32");
 
   for (int d = 0; d < 10; d++) {
     if (d == 9) {
@@ -1071,7 +1076,7 @@
     } else {
       EXPECT_STREQ("", GetInductionInfo(store->InputAt(1), d).c_str());
     }
-    EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(increment_[d], d).c_str());
+    EXPECT_STREQ("((1) * i + (1)):Int32", GetInductionInfo(increment_[d], d).c_str());
     // Trip-count.
     EXPECT_STREQ("((100) (TC-loop) ((0) < (100)))", GetTripCount(d).c_str());
   }
@@ -1086,15 +1091,15 @@
   // }
   BuildLoopNest(1);
   HInstruction* conv = InsertInstruction(
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, basic_[0], kNoDexPc), 0);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, basic_[0], kNoDexPc), 0);
   HInstruction* store1 = InsertArrayStore(conv, 0);
   HInstruction* store2 = InsertArrayStore(basic_[0], 0);
   PerformInductionVarAnalysis();
 
   // Regular int induction (i) is transferred over conversion into byte induction (k).
-  EXPECT_STREQ("((1) * i + (0)):PrimByte", GetInductionInfo(store1->InputAt(1), 0).c_str());
-  EXPECT_STREQ("((1) * i + (0)):PrimInt",  GetInductionInfo(store2->InputAt(1), 0).c_str());
-  EXPECT_STREQ("((1) * i + (1)):PrimInt",  GetInductionInfo(increment_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int8", GetInductionInfo(store1->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int32",  GetInductionInfo(store2->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (1)):Int32",  GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
   EXPECT_TRUE(IsNarrowingLinear(store1->InputAt(1)));
@@ -1117,17 +1122,17 @@
   // }
   BuildLoopNest(1);
   HInstruction* conv = InsertInstruction(
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, basic_[0], kNoDexPc), 0);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, basic_[0], kNoDexPc), 0);
   HInstruction* store1 = InsertArrayStore(conv, 0);
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, conv, constant1_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, conv, constant1_), 0);
   HInstruction* store2 = InsertArrayStore(add, 0);
 
   PerformInductionVarAnalysis();
 
   // Byte induction (k) is detected, but it does not transfer over the addition,
   // since this may yield out-of-type values.
-  EXPECT_STREQ("((1) * i + (0)):PrimByte", GetInductionInfo(store1->InputAt(1), 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Int8", GetInductionInfo(store1->InputAt(1), 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(store2->InputAt(1), 0).c_str());
 
   // Narrowing detected.
@@ -1147,15 +1152,15 @@
   k_header->AddInput(graph_->GetIntConstant(-128));
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* conv = InsertInstruction(
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, add, kNoDexPc), 0);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, add, kNoDexPc), 0);
   k_header->AddInput(conv);
   PerformInductionVarAnalysis();
 
   // Byte induction (k) is detected, but it does not transfer over the addition,
   // since this may yield out-of-type values.
-  EXPECT_STREQ("((1) * i + (-128)):PrimByte", GetInductionInfo(k_header, 0).c_str());
+  EXPECT_STREQ("((1) * i + (-128)):Int8", GetInductionInfo(k_header, 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(add, 0).c_str());
 
   // Narrowing detected.
@@ -1175,9 +1180,9 @@
   k_header->AddInput(graph_->GetIntConstant(-129));
 
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, k_header, constant1_), 0);
   HInstruction* conv = InsertInstruction(
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, add, kNoDexPc), 0);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, add, kNoDexPc), 0);
   k_header->AddInput(conv);
   PerformInductionVarAnalysis();
 
@@ -1197,9 +1202,9 @@
   k_header->AddInput(constant0_);
 
   HInstruction* conv = InsertInstruction(
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, k_header, kNoDexPc), 0);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, k_header, kNoDexPc), 0);
   HInstruction* add = InsertInstruction(
-      new (&allocator_) HAdd(Primitive::kPrimInt, conv, constant1_), 0);
+      new (&allocator_) HAdd(DataType::Type::kInt32, conv, constant1_), 0);
   k_header->AddInput(add);
   PerformInductionVarAnalysis();
 
@@ -1216,13 +1221,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(127), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (-128)):PrimByte", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (-128)):Int8", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
@@ -1242,13 +1247,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(128), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimByte, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt8, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (-128)):PrimByte", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (-128)):Int8", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
@@ -1268,13 +1273,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(32767), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimShort, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt16, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (-32768)):PrimShort", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (-32768)):Int16", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
@@ -1294,13 +1299,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(32768), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimShort, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kInt16, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (-32768)):PrimShort", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (-32768)):Int16", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
@@ -1319,13 +1324,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(65535), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimChar, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kUint16, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (0)):PrimChar", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Uint16", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
@@ -1344,13 +1349,13 @@
   HInstruction* ifs = loop_header_[0]->GetLastInstruction()->GetPrevious();
   ifs->ReplaceInput(graph_->GetIntConstant(65536), 1);
   HInstruction* conv =
-      new (&allocator_) HTypeConversion(Primitive::kPrimChar, increment_[0], kNoDexPc);
+      new (&allocator_) HTypeConversion(DataType::Type::kUint16, increment_[0], kNoDexPc);
   loop_body_[0]->InsertInstructionBefore(conv, increment_[0]->GetNext());
   basic_[0]->ReplaceInput(conv, 1);
   PerformInductionVarAnalysis();
 
   // Recorded at the phi, but not transferred to increment.
-  EXPECT_STREQ("((1) * i + (0)):PrimChar", GetInductionInfo(basic_[0], 0).c_str());
+  EXPECT_STREQ("((1) * i + (0)):Uint16", GetInductionInfo(basic_[0], 0).c_str());
   EXPECT_STREQ("", GetInductionInfo(increment_[0], 0).c_str());
 
   // Narrowing detected.
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index 191d3d1..92b584c 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -157,15 +157,15 @@
 }
 
 /** Corrects a value for type to account for arithmetic wrap-around in lower precision. */
-static InductionVarRange::Value CorrectForType(InductionVarRange::Value v, Primitive::Type type) {
+static InductionVarRange::Value CorrectForType(InductionVarRange::Value v, DataType::Type type) {
   switch (type) {
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimByte: {
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt8: {
       // Constants within range only.
       // TODO: maybe some room for improvement, like allowing widening conversions
-      int32_t min = Primitive::MinValueOfIntegralType(type);
-      int32_t max = Primitive::MaxValueOfIntegralType(type);
+      int32_t min = DataType::MinValueOfIntegralType(type);
+      int32_t max = DataType::MaxValueOfIntegralType(type);
       return (IsConstantValue(v) && min <= v.b_constant && v.b_constant <= max)
           ? v
           : InductionVarRange::Value();
@@ -216,10 +216,10 @@
   // bounds check elimination, will have truncated higher precision induction
   // at their use point already).
   switch (info->type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt8:
       break;
     default:
       return false;
@@ -689,8 +689,8 @@
   } else if (instruction->IsTypeConversion()) {
     // Since analysis is 32-bit (or narrower), chase beyond widening along the path.
     // For example, this discovers the length in: for (long i = 0; i < a.length; i++);
-    if (instruction->AsTypeConversion()->GetInputType() == Primitive::kPrimInt &&
-        instruction->AsTypeConversion()->GetResultType() == Primitive::kPrimLong) {
+    if (instruction->AsTypeConversion()->GetInputType() == DataType::Type::kInt32 &&
+        instruction->AsTypeConversion()->GetResultType() == DataType::Type::kInt64) {
       return GetFetch(instruction->InputAt(0), trip, in_body, is_min);
     }
   }
@@ -1051,9 +1051,9 @@
     HInstruction* c = nullptr;
     if (GenerateCode(info->op_b, nullptr, graph, block, graph ? &c : nullptr, false, false)) {
       if (graph != nullptr) {
-        Primitive::Type type = info->type;
+        DataType::Type type = info->type;
         int64_t sum = a * ((m * (m - 1)) / 2) + b * m;
-        if (type != Primitive::kPrimLong) {
+        if (type != DataType::Type::kInt64) {
           sum = static_cast<int32_t>(sum);  // okay to truncate
         }
         *result =
@@ -1081,16 +1081,16 @@
     if (GenerateCode(info->op_a, nullptr, graph, block, &opa, false, false) &&
         GenerateCode(info->op_b, nullptr, graph, block, &opb, false, false)) {
       if (graph != nullptr) {
-        Primitive::Type type = info->type;
+        DataType::Type type = info->type;
         // Compute f ^ m for known maximum index value m.
         bool overflow = false;
         int64_t fpow = IntPow(f, m, &overflow);
         if (info->operation == HInductionVarAnalysis::kDiv) {
           // For division, any overflow truncates to zero.
-          if (overflow || (type != Primitive::kPrimLong && !CanLongValueFitIntoInt(fpow))) {
+          if (overflow || (type != DataType::Type::kInt64 && !CanLongValueFitIntoInt(fpow))) {
             fpow = 0;
           }
-        } else if (type != Primitive::kPrimLong) {
+        } else if (type != DataType::Type::kInt64) {
           // For multiplication, okay to truncate to required precision.
           DCHECK(info->operation == HInductionVarAnalysis::kMul);
           fpow = static_cast<int32_t>(fpow);
@@ -1161,7 +1161,7 @@
   }
   // Don't rely on FP arithmetic to be precise, unless the full period
   // consist of pre-computed expressions only.
-  if (info->type == Primitive::kPrimFloat || info->type == Primitive::kPrimDouble) {
+  if (info->type == DataType::Type::kFloat32 || info->type == DataType::Type::kFloat64) {
     if (!all_invariants) {
       return false;
     }
@@ -1187,7 +1187,7 @@
       GenerateCode(trip->op_a, nullptr, graph, block, graph ? &t : nullptr, false, false)) {
     // During actual code generation (graph != nullptr), generate is_even ? x : y.
     if (graph != nullptr) {
-      Primitive::Type type = trip->type;
+      DataType::Type type = trip->type;
       HInstruction* msk =
           Insert(block, new (graph->GetArena()) HAnd(type, t, graph->GetConstant(type, 1)));
       HInstruction* is_even =
@@ -1224,7 +1224,7 @@
       return true;
     }
     // Handle current operation.
-    Primitive::Type type = info->type;
+    DataType::Type type = info->type;
     HInstruction* opa = nullptr;
     HInstruction* opb = nullptr;
     switch (info->induction_class) {
diff --git a/compiler/optimizing/induction_var_range_test.cc b/compiler/optimizing/induction_var_range_test.cc
index 9437014..1c84269 100644
--- a/compiler/optimizing/induction_var_range_test.cc
+++ b/compiler/optimizing/induction_var_range_test.cc
@@ -71,12 +71,12 @@
     x_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                            dex::TypeIndex(0),
                                            0,
-                                           Primitive::kPrimInt);
+                                           DataType::Type::kInt32);
     entry_block_->AddInstruction(x_);
     y_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                            dex::TypeIndex(0),
                                            0,
-                                           Primitive::kPrimInt);
+                                           DataType::Type::kInt32);
     entry_block_->AddInstruction(y_);
     // Set arbitrary range analysis hint while testing private methods.
     SetHint(x_);
@@ -101,7 +101,7 @@
     return_block->AddSuccessor(exit_block_);
     // Instructions.
     loop_preheader_->AddInstruction(new (&allocator_) HGoto());
-    HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, Primitive::kPrimInt);
+    HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, DataType::Type::kInt32);
     loop_header_->AddPhi(phi);
     phi->AddInput(graph_->GetIntConstant(lower));  // i = l
     if (stride > 0) {
@@ -111,7 +111,8 @@
     }
     loop_header_->AddInstruction(condition_);
     loop_header_->AddInstruction(new (&allocator_) HIf(condition_));
-    increment_ = new (&allocator_) HAdd(Primitive::kPrimInt, phi, graph_->GetIntConstant(stride));
+    increment_ =
+        new (&allocator_) HAdd(DataType::Type::kInt32, phi, graph_->GetIntConstant(stride));
     loop_body_->AddInstruction(increment_);  // i += s
     phi->AddInput(increment_);
     loop_body_->AddInstruction(new (&allocator_) HGoto());
@@ -173,7 +174,7 @@
     return iva_->CreateTripCount(op,
                                  CreateConst(tc),
                                  CreateInvariant('<', CreateConst(0), CreateConst(tc)),
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a linear a * i + b induction. */
@@ -183,7 +184,7 @@
                                  CreateConst(a),
                                  CreateConst(b),
                                  nullptr,
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a polynomial sum(a * i + b) + c induction. */
@@ -193,7 +194,7 @@
                                  CreateLinear(a, b),
                                  CreateConst(c),
                                  nullptr,
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a geometric a * f^i + b induction. */
@@ -204,7 +205,7 @@
                                  CreateConst(a),
                                  CreateConst(b),
                                  graph_->GetIntConstant(f),
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a range [lo, hi] using a periodic induction. */
@@ -214,7 +215,7 @@
                                  CreateConst(lo),
                                  CreateConst(hi),
                                  nullptr,
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a wrap-around induction consisting of a constant, followed by info. */
@@ -226,7 +227,7 @@
                                  CreateConst(initial),
                                  info,
                                  nullptr,
-                                 Primitive::kPrimInt);
+                                 DataType::Type::kInt32);
   }
 
   /** Constructs a wrap-around induction consisting of a constant, followed by a range. */
@@ -725,13 +726,13 @@
 
 TEST_F(InductionVarRangeTest, AddOrSubAndConstant) {
   HInstruction* add = new (&allocator_)
-      HAdd(Primitive::kPrimInt, x_, graph_->GetIntConstant(-1));
+      HAdd(DataType::Type::kInt32, x_, graph_->GetIntConstant(-1));
   HInstruction* alt = new (&allocator_)
-      HAdd(Primitive::kPrimInt, graph_->GetIntConstant(-1), x_);
+      HAdd(DataType::Type::kInt32, graph_->GetIntConstant(-1), x_);
   HInstruction* sub = new (&allocator_)
-      HSub(Primitive::kPrimInt, x_, graph_->GetIntConstant(1));
+      HSub(DataType::Type::kInt32, x_, graph_->GetIntConstant(1));
   HInstruction* rev = new (&allocator_)
-      HSub(Primitive::kPrimInt, graph_->GetIntConstant(1), x_);
+      HSub(DataType::Type::kInt32, graph_->GetIntConstant(1), x_);
   entry_block_->AddInstruction(add);
   entry_block_->AddInstruction(alt);
   entry_block_->AddInstruction(sub);
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index 793e781..90e3d2a 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -21,6 +21,7 @@
 #include "builder.h"
 #include "class_linker.h"
 #include "constant_folding.h"
+#include "data_type-inl.h"
 #include "dead_code_elimination.h"
 #include "dex/inline_method_analyser.h"
 #include "dex/verification_results.h"
@@ -707,7 +708,7 @@
   HInstanceFieldGet* result = new (graph_->GetArena()) HInstanceFieldGet(
       receiver,
       field,
-      Primitive::kPrimNot,
+      DataType::Type::kReference,
       field->GetOffset(),
       field->IsVolatile(),
       field->GetDexFieldIndex(),
@@ -1143,9 +1144,9 @@
   HInstanceFieldGet* receiver_class = BuildGetReceiverClass(
       class_linker, receiver, invoke_instruction->GetDexPc());
 
-  Primitive::Type type = Is64BitInstructionSet(graph_->GetInstructionSet())
-      ? Primitive::kPrimLong
-      : Primitive::kPrimInt;
+  DataType::Type type = Is64BitInstructionSet(graph_->GetInstructionSet())
+      ? DataType::Type::kInt64
+      : DataType::Type::kInt32;
   HClassTableGet* class_table_get = new (graph_->GetArena()) HClassTableGet(
       receiver_class,
       type,
@@ -1155,7 +1156,7 @@
       invoke_instruction->GetDexPc());
 
   HConstant* constant;
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     constant = graph_->GetLongConstant(
         reinterpret_cast<intptr_t>(actual_method), invoke_instruction->GetDexPc());
   } else {
@@ -1253,7 +1254,7 @@
       }
       invoke_instruction->GetBlock()->InsertInstructionBefore(new_invoke, invoke_instruction);
       new_invoke->CopyEnvironmentFrom(invoke_instruction->GetEnvironment());
-      if (invoke_instruction->GetType() == Primitive::kPrimNot) {
+      if (invoke_instruction->GetType() == DataType::Type::kReference) {
         new_invoke->SetReferenceTypeInfo(invoke_instruction->GetReferenceTypeInfo());
       }
       return_replacement = new_invoke;
@@ -1403,7 +1404,7 @@
   size_t input_index = 0;
   for (size_t i = 0; i < arg_vreg_index; ++i, ++input_index) {
     DCHECK_LT(input_index, invoke_instruction->GetNumberOfArguments());
-    if (Primitive::Is64BitType(invoke_instruction->InputAt(input_index)->GetType())) {
+    if (DataType::Is64BitType(invoke_instruction->InputAt(input_index)->GetType())) {
       ++i;
       DCHECK_NE(i, arg_vreg_index);
     }
@@ -1423,7 +1424,7 @@
 
   switch (inline_method.opcode) {
     case kInlineOpNop:
-      DCHECK_EQ(invoke_instruction->GetType(), Primitive::kPrimVoid);
+      DCHECK_EQ(invoke_instruction->GetType(), DataType::Type::kVoid);
       *return_replacement = nullptr;
       break;
     case kInlineOpReturnArg:
@@ -1541,7 +1542,7 @@
   HInstanceFieldGet* iget = new (graph_->GetArena()) HInstanceFieldGet(
       obj,
       resolved_field,
-      resolved_field->GetTypeAsPrimitiveType(),
+      DataType::FromShorty(resolved_field->GetTypeDescriptor()[0]),
       resolved_field->GetOffset(),
       resolved_field->IsVolatile(),
       field_index,
@@ -1550,7 +1551,7 @@
       // Read barrier generates a runtime call in slow path and we need a valid
       // dex pc for the associated stack map. 0 is bogus but valid. Bug: 26854537.
       /* dex_pc */ 0);
-  if (iget->GetType() == Primitive::kPrimNot) {
+  if (iget->GetType() == DataType::Type::kReference) {
     // Use the same dex_cache that we used for field lookup as the hint_dex_cache.
     Handle<mirror::DexCache> dex_cache = handles_->NewHandle(referrer->GetDexCache());
     ReferenceTypePropagation rtp(graph_,
@@ -1582,7 +1583,7 @@
       obj,
       value,
       resolved_field,
-      resolved_field->GetTypeAsPrimitiveType(),
+      DataType::FromShorty(resolved_field->GetTypeDescriptor()[0]),
       resolved_field->GetOffset(),
       resolved_field->IsVolatile(),
       field_index,
@@ -1667,8 +1668,6 @@
   HGraphBuilder builder(callee_graph,
                         &dex_compilation_unit,
                         &outer_compilation_unit_,
-                        resolved_method->GetDexFile(),
-                        *code_item,
                         compiler_driver_,
                         codegen_,
                         inline_stats_,
@@ -1711,7 +1710,7 @@
       } else if (argument->IsDoubleConstant()) {
         current->ReplaceWith(
             callee_graph->GetDoubleConstant(argument->AsDoubleConstant()->GetValue()));
-      } else if (argument->GetType() == Primitive::kPrimNot) {
+      } else if (argument->GetType() == DataType::Type::kReference) {
         if (!resolved_method->IsStatic() && parameter_index == 0 && receiver_type.IsValid()) {
           run_rtp = true;
           current->SetReferenceTypeInfo(receiver_type);
@@ -1975,7 +1974,7 @@
        param_idx < e;
        ++param_idx, ++input_idx) {
     HInstruction* input = invoke_instruction->InputAt(input_idx);
-    if (input->GetType() == Primitive::kPrimNot) {
+    if (input->GetType() == DataType::Type::kReference) {
       ObjPtr<mirror::Class> param_cls = resolved_method->LookupResolvedClassFromTypeIndex(
           param_list->GetTypeItem(param_idx).type_idx_);
       if (IsReferenceTypeRefinement(GetClassRTI(param_cls),
@@ -1993,7 +1992,7 @@
                                       HInstruction* return_replacement) {
   // Check the integrity of reference types and run another type propagation if needed.
   if (return_replacement != nullptr) {
-    if (return_replacement->GetType() == Primitive::kPrimNot) {
+    if (return_replacement->GetType() == DataType::Type::kReference) {
       // Test if the return type is a refinement of the declared return type.
       if (IsReferenceTypeRefinement(invoke_instruction->GetReferenceTypeInfo(),
                                     /* declared_can_be_null */ true,
@@ -2019,7 +2018,7 @@
 void HInliner::FixUpReturnReferenceType(ArtMethod* resolved_method,
                                         HInstruction* return_replacement) {
   if (return_replacement != nullptr) {
-    if (return_replacement->GetType() == Primitive::kPrimNot) {
+    if (return_replacement->GetType() == DataType::Type::kReference) {
       if (!return_replacement->GetReferenceTypeInfo().IsValid()) {
         // Make sure that we have a valid type for the return. We may get an invalid one when
         // we inline invokes with multiple branches and create a Phi for the result.
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index 6532ec1..6ad8036 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -19,6 +19,7 @@
 #include "art_method-inl.h"
 #include "bytecode_utils.h"
 #include "class_linker.h"
+#include "data_type-inl.h"
 #include "dex_instruction-inl.h"
 #include "driver/compiler_options.h"
 #include "imtable-inl.h"
@@ -221,7 +222,7 @@
 }
 
 HInstruction* HInstructionBuilder::LoadNullCheckedLocal(uint32_t register_index, uint32_t dex_pc) {
-  HInstruction* ref = LoadLocal(register_index, Primitive::kPrimNot);
+  HInstruction* ref = LoadLocal(register_index, DataType::Type::kReference);
   if (!ref->CanBeNull()) {
     return ref;
   }
@@ -367,17 +368,16 @@
   };
   dex_file_->DecodeDebugPositionInfo(&code_item_, Callback::Position, locations);
   // Instruction-specific tweaks.
-  const Instruction* const begin = Instruction::At(code_item_.insns_);
-  const Instruction* const end = begin->RelativeAt(code_item_.insns_size_in_code_units_);
-  for (const Instruction* inst = begin; inst < end; inst = inst->Next()) {
-    switch (inst->Opcode()) {
+  IterationRange<DexInstructionIterator> instructions = code_item_.Instructions();
+  for (const Instruction& inst : instructions) {
+    switch (inst.Opcode()) {
       case Instruction::MOVE_EXCEPTION: {
         // Stop in native debugger after the exception has been moved.
         // The compiler also expects the move at the start of basic block so
         // we do not want to interfere by inserting native-debug-info before it.
-        locations->ClearBit(inst->GetDexPc(code_item_.insns_));
-        const Instruction* next = inst->Next();
-        if (next < end) {
+        locations->ClearBit(inst.GetDexPc(code_item_.insns_));
+        const Instruction* next = inst.Next();
+        if (DexInstructionIterator(next) != instructions.end()) {
           locations->SetBit(next->GetDexPc(code_item_.insns_));
         }
         break;
@@ -388,15 +388,15 @@
   }
 }
 
-HInstruction* HInstructionBuilder::LoadLocal(uint32_t reg_number, Primitive::Type type) const {
+HInstruction* HInstructionBuilder::LoadLocal(uint32_t reg_number, DataType::Type type) const {
   HInstruction* value = (*current_locals_)[reg_number];
   DCHECK(value != nullptr);
 
   // If the operation requests a specific type, we make sure its input is of that type.
   if (type != value->GetType()) {
-    if (Primitive::IsFloatingPointType(type)) {
+    if (DataType::IsFloatingPointType(type)) {
       value = ssa_builder_->GetFloatOrDoubleEquivalent(value, type);
-    } else if (type == Primitive::kPrimNot) {
+    } else if (type == DataType::Type::kReference) {
       value = ssa_builder_->GetReferenceTypeEquivalent(value);
     }
     DCHECK(value != nullptr);
@@ -406,8 +406,8 @@
 }
 
 void HInstructionBuilder::UpdateLocal(uint32_t reg_number, HInstruction* stored_value) {
-  Primitive::Type stored_type = stored_value->GetType();
-  DCHECK_NE(stored_type, Primitive::kPrimVoid);
+  DataType::Type stored_type = stored_value->GetType();
+  DCHECK_NE(stored_type, DataType::Type::kVoid);
 
   // Storing into vreg `reg_number` may implicitly invalidate the surrounding
   // registers. Consider the following cases:
@@ -420,7 +420,7 @@
 
   if (reg_number != 0) {
     HInstruction* local_low = (*current_locals_)[reg_number - 1];
-    if (local_low != nullptr && Primitive::Is64BitType(local_low->GetType())) {
+    if (local_low != nullptr && DataType::Is64BitType(local_low->GetType())) {
       // The vreg we are storing into was previously the high vreg of a pair.
       // We need to invalidate its low vreg.
       DCHECK((*current_locals_)[reg_number] == nullptr);
@@ -429,7 +429,7 @@
   }
 
   (*current_locals_)[reg_number] = stored_value;
-  if (Primitive::Is64BitType(stored_type)) {
+  if (DataType::Is64BitType(stored_type)) {
     // We are storing a pair. Invalidate the instruction in the high vreg.
     (*current_locals_)[reg_number + 1] = nullptr;
   }
@@ -455,7 +455,7 @@
     HParameterValue* parameter = new (arena_) HParameterValue(*dex_file_,
                                                               referrer_method_id.class_idx_,
                                                               parameter_index++,
-                                                              Primitive::kPrimNot,
+                                                              DataType::Type::kReference,
                                                               /* is_this */ true);
     AppendInstruction(parameter);
     UpdateLocal(locals_index++, parameter);
@@ -472,14 +472,14 @@
         *dex_file_,
         arg_types->GetTypeItem(shorty_pos - 1).type_idx_,
         parameter_index++,
-        Primitive::GetType(shorty[shorty_pos]),
+        DataType::FromShorty(shorty[shorty_pos]),
         /* is_this */ false);
     ++shorty_pos;
     AppendInstruction(parameter);
     // Store the parameter value in the local that the dex code will use
     // to reference that parameter.
     UpdateLocal(locals_index++, parameter);
-    if (Primitive::Is64BitType(parameter->GetType())) {
+    if (DataType::Is64BitType(parameter->GetType())) {
       i++;
       locals_index++;
       parameter_index++;
@@ -489,8 +489,8 @@
 
 template<typename T>
 void HInstructionBuilder::If_22t(const Instruction& instruction, uint32_t dex_pc) {
-  HInstruction* first = LoadLocal(instruction.VRegA(), Primitive::kPrimInt);
-  HInstruction* second = LoadLocal(instruction.VRegB(), Primitive::kPrimInt);
+  HInstruction* first = LoadLocal(instruction.VRegA(), DataType::Type::kInt32);
+  HInstruction* second = LoadLocal(instruction.VRegB(), DataType::Type::kInt32);
   T* comparison = new (arena_) T(first, second, dex_pc);
   AppendInstruction(comparison);
   AppendInstruction(new (arena_) HIf(comparison, dex_pc));
@@ -499,7 +499,7 @@
 
 template<typename T>
 void HInstructionBuilder::If_21t(const Instruction& instruction, uint32_t dex_pc) {
-  HInstruction* value = LoadLocal(instruction.VRegA(), Primitive::kPrimInt);
+  HInstruction* value = LoadLocal(instruction.VRegA(), DataType::Type::kInt32);
   T* comparison = new (arena_) T(value, graph_->GetIntConstant(0, dex_pc), dex_pc);
   AppendInstruction(comparison);
   AppendInstruction(new (arena_) HIf(comparison, dex_pc));
@@ -508,7 +508,7 @@
 
 template<typename T>
 void HInstructionBuilder::Unop_12x(const Instruction& instruction,
-                                   Primitive::Type type,
+                                   DataType::Type type,
                                    uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegB(), type);
   AppendInstruction(new (arena_) T(type, first, dex_pc));
@@ -516,8 +516,8 @@
 }
 
 void HInstructionBuilder::Conversion_12x(const Instruction& instruction,
-                                         Primitive::Type input_type,
-                                         Primitive::Type result_type,
+                                         DataType::Type input_type,
+                                         DataType::Type result_type,
                                          uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegB(), input_type);
   AppendInstruction(new (arena_) HTypeConversion(result_type, first, dex_pc));
@@ -526,7 +526,7 @@
 
 template<typename T>
 void HInstructionBuilder::Binop_23x(const Instruction& instruction,
-                                    Primitive::Type type,
+                                    DataType::Type type,
                                     uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegB(), type);
   HInstruction* second = LoadLocal(instruction.VRegC(), type);
@@ -536,16 +536,16 @@
 
 template<typename T>
 void HInstructionBuilder::Binop_23x_shift(const Instruction& instruction,
-                                          Primitive::Type type,
+                                          DataType::Type type,
                                           uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegB(), type);
-  HInstruction* second = LoadLocal(instruction.VRegC(), Primitive::kPrimInt);
+  HInstruction* second = LoadLocal(instruction.VRegC(), DataType::Type::kInt32);
   AppendInstruction(new (arena_) T(type, first, second, dex_pc));
   UpdateLocal(instruction.VRegA(), current_block_->GetLastInstruction());
 }
 
 void HInstructionBuilder::Binop_23x_cmp(const Instruction& instruction,
-                                        Primitive::Type type,
+                                        DataType::Type type,
                                         ComparisonBias bias,
                                         uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegB(), type);
@@ -556,17 +556,17 @@
 
 template<typename T>
 void HInstructionBuilder::Binop_12x_shift(const Instruction& instruction,
-                                          Primitive::Type type,
+                                          DataType::Type type,
                                           uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegA(), type);
-  HInstruction* second = LoadLocal(instruction.VRegB(), Primitive::kPrimInt);
+  HInstruction* second = LoadLocal(instruction.VRegB(), DataType::Type::kInt32);
   AppendInstruction(new (arena_) T(type, first, second, dex_pc));
   UpdateLocal(instruction.VRegA(), current_block_->GetLastInstruction());
 }
 
 template<typename T>
 void HInstructionBuilder::Binop_12x(const Instruction& instruction,
-                                    Primitive::Type type,
+                                    DataType::Type type,
                                     uint32_t dex_pc) {
   HInstruction* first = LoadLocal(instruction.VRegA(), type);
   HInstruction* second = LoadLocal(instruction.VRegB(), type);
@@ -576,23 +576,23 @@
 
 template<typename T>
 void HInstructionBuilder::Binop_22s(const Instruction& instruction, bool reverse, uint32_t dex_pc) {
-  HInstruction* first = LoadLocal(instruction.VRegB(), Primitive::kPrimInt);
+  HInstruction* first = LoadLocal(instruction.VRegB(), DataType::Type::kInt32);
   HInstruction* second = graph_->GetIntConstant(instruction.VRegC_22s(), dex_pc);
   if (reverse) {
     std::swap(first, second);
   }
-  AppendInstruction(new (arena_) T(Primitive::kPrimInt, first, second, dex_pc));
+  AppendInstruction(new (arena_) T(DataType::Type::kInt32, first, second, dex_pc));
   UpdateLocal(instruction.VRegA(), current_block_->GetLastInstruction());
 }
 
 template<typename T>
 void HInstructionBuilder::Binop_22b(const Instruction& instruction, bool reverse, uint32_t dex_pc) {
-  HInstruction* first = LoadLocal(instruction.VRegB(), Primitive::kPrimInt);
+  HInstruction* first = LoadLocal(instruction.VRegB(), DataType::Type::kInt32);
   HInstruction* second = graph_->GetIntConstant(instruction.VRegC_22b(), dex_pc);
   if (reverse) {
     std::swap(first, second);
   }
-  AppendInstruction(new (arena_) T(Primitive::kPrimInt, first, second, dex_pc));
+  AppendInstruction(new (arena_) T(DataType::Type::kInt32, first, second, dex_pc));
   UpdateLocal(instruction.VRegA(), current_block_->GetLastInstruction());
 }
 
@@ -624,7 +624,7 @@
 }
 
 void HInstructionBuilder::BuildSwitch(const Instruction& instruction, uint32_t dex_pc) {
-  HInstruction* value = LoadLocal(instruction.VRegA(), Primitive::kPrimInt);
+  HInstruction* value = LoadLocal(instruction.VRegA(), DataType::Type::kInt32);
   DexSwitchTable table(instruction, dex_pc);
 
   if (table.GetNumEntries() == 0) {
@@ -651,9 +651,9 @@
 }
 
 void HInstructionBuilder::BuildReturn(const Instruction& instruction,
-                                      Primitive::Type type,
+                                      DataType::Type type,
                                       uint32_t dex_pc) {
-  if (type == Primitive::kPrimVoid) {
+  if (type == DataType::Type::kVoid) {
     // Only <init> (which is a return-void) could possibly have a constructor fence.
     // This may insert additional redundant constructor fences from the super constructors.
     // TODO: remove redundant constructor fences (b/36656456).
@@ -802,7 +802,7 @@
                                       uint32_t register_index) {
   InvokeType invoke_type = GetInvokeTypeFromOpCode(instruction.Opcode());
   const char* descriptor = dex_file_->GetMethodShorty(method_idx);
-  Primitive::Type return_type = Primitive::GetType(descriptor[0]);
+  DataType::Type return_type = DataType::FromShorty(descriptor[0]);
 
   // Remove the return type from the 'proto'.
   size_t number_of_arguments = strlen(descriptor) - 1;
@@ -844,7 +844,7 @@
     HInvoke* invoke = new (arena_) HInvokeStaticOrDirect(
         arena_,
         number_of_arguments - 1,
-        Primitive::kPrimNot /*return_type */,
+        DataType::Type::kReference /*return_type */,
         dex_pc,
         method_idx,
         nullptr,
@@ -938,7 +938,7 @@
                                                  uint32_t register_index) {
   const char* descriptor = dex_file_->GetShorty(proto_idx);
   DCHECK_EQ(1 + ArtMethod::NumArgRegisters(descriptor), number_of_vreg_arguments);
-  Primitive::Type return_type = Primitive::GetType(descriptor[0]);
+  DataType::Type return_type = DataType::FromShorty(descriptor[0]);
   size_t number_of_arguments = strlen(descriptor);
   HInvoke* invoke = new (arena_) HInvokePolymorphic(arena_,
                                                     number_of_arguments,
@@ -1113,8 +1113,8 @@
        // it hasn't been properly checked.
        (i < number_of_vreg_arguments) && (*argument_index < invoke->GetNumberOfArguments());
        i++, (*argument_index)++) {
-    Primitive::Type type = Primitive::GetType(descriptor[descriptor_index++]);
-    bool is_wide = (type == Primitive::kPrimLong) || (type == Primitive::kPrimDouble);
+    DataType::Type type = DataType::FromShorty(descriptor[descriptor_index++]);
+    bool is_wide = (type == DataType::Type::kInt64) || (type == DataType::Type::kFloat64);
     if (!is_range
         && is_wide
         && ((i + 1 == number_of_vreg_arguments) || (args[i] + 1 != args[i + 1]))) {
@@ -1169,7 +1169,7 @@
   if (invoke->GetInvokeType() != InvokeType::kStatic) {  // Instance call.
     uint32_t obj_reg = is_range ? register_index : args[0];
     HInstruction* arg = is_unresolved
-        ? LoadLocal(obj_reg, Primitive::kPrimNot)
+        ? LoadLocal(obj_reg, DataType::Type::kReference)
         : LoadNullCheckedLocal(obj_reg, invoke->GetDexPc());
     invoke->SetArgumentAt(0, arg);
     start_index = 1;
@@ -1229,7 +1229,7 @@
   // This is a StringFactory call, not an actual String constructor. Its result
   // replaces the empty String pre-allocated by NewInstance.
   uint32_t orig_this_reg = is_range ? register_index : args[0];
-  HInstruction* arg_this = LoadLocal(orig_this_reg, Primitive::kPrimNot);
+  HInstruction* arg_this = LoadLocal(orig_this_reg, DataType::Type::kReference);
 
   // Replacing the NewInstance might render it redundant. Keep a list of these
   // to be visited once it is clear whether it is has remaining uses.
@@ -1251,10 +1251,10 @@
   return true;
 }
 
-static Primitive::Type GetFieldAccessType(const DexFile& dex_file, uint16_t field_index) {
+static DataType::Type GetFieldAccessType(const DexFile& dex_file, uint16_t field_index) {
   const DexFile::FieldId& field_id = dex_file.GetFieldId(field_index);
   const char* type = dex_file.GetFieldTypeDescriptor(field_id);
-  return Primitive::GetType(type[0]);
+  return DataType::FromShorty(type[0]);
 }
 
 bool HInstructionBuilder::BuildInstanceFieldAccess(const Instruction& instruction,
@@ -1280,12 +1280,10 @@
   // is unresolved. In that case, we rely on the runtime to perform various
   // checks first, followed by a null check.
   HInstruction* object = (resolved_field == nullptr)
-      ? LoadLocal(obj_reg, Primitive::kPrimNot)
+      ? LoadLocal(obj_reg, DataType::Type::kReference)
       : LoadNullCheckedLocal(obj_reg, dex_pc);
 
-  Primitive::Type field_type = (resolved_field == nullptr)
-      ? GetFieldAccessType(*dex_file_, field_index)
-      : resolved_field->GetTypeAsPrimitiveType();
+  DataType::Type field_type = GetFieldAccessType(*dex_file_, field_index);
   if (is_put) {
     HInstruction* value = LoadLocal(source_or_dest_reg, field_type);
     HInstruction* field_set = nullptr;
@@ -1377,7 +1375,7 @@
 void HInstructionBuilder::BuildUnresolvedStaticFieldAccess(const Instruction& instruction,
                                                            uint32_t dex_pc,
                                                            bool is_put,
-                                                           Primitive::Type field_type) {
+                                                           DataType::Type field_type) {
   uint32_t source_or_dest_reg = instruction.VRegA_21c();
   uint16_t field_index = instruction.VRegB_21c();
 
@@ -1452,12 +1450,12 @@
   if (resolved_field == nullptr) {
     MaybeRecordStat(compilation_stats_,
                     MethodCompilationStat::kUnresolvedField);
-    Primitive::Type field_type = GetFieldAccessType(*dex_file_, field_index);
+    DataType::Type field_type = GetFieldAccessType(*dex_file_, field_index);
     BuildUnresolvedStaticFieldAccess(instruction, dex_pc, is_put, field_type);
     return true;
   }
 
-  Primitive::Type field_type = resolved_field->GetTypeAsPrimitiveType();
+  DataType::Type field_type = GetFieldAccessType(*dex_file_, field_index);
 
   Handle<mirror::Class> klass = handles_->NewHandle(resolved_field->GetDeclaringClass());
   HLoadClass* constant = BuildLoadClass(klass->GetDexTypeIndex(),
@@ -1515,15 +1513,15 @@
                                        uint16_t first_vreg,
                                        int64_t second_vreg_or_constant,
                                        uint32_t dex_pc,
-                                       Primitive::Type type,
+                                       DataType::Type type,
                                        bool second_is_constant,
                                        bool isDiv) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   HInstruction* first = LoadLocal(first_vreg, type);
   HInstruction* second = nullptr;
   if (second_is_constant) {
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       second = graph_->GetIntConstant(second_vreg_or_constant, dex_pc);
     } else {
       second = graph_->GetLongConstant(second_vreg_or_constant, dex_pc);
@@ -1533,8 +1531,8 @@
   }
 
   if (!second_is_constant
-      || (type == Primitive::kPrimInt && second->AsIntConstant()->GetValue() == 0)
-      || (type == Primitive::kPrimLong && second->AsLongConstant()->GetValue() == 0)) {
+      || (type == DataType::Type::kInt32 && second->AsIntConstant()->GetValue() == 0)
+      || (type == DataType::Type::kInt64 && second->AsLongConstant()->GetValue() == 0)) {
     second = new (arena_) HDivZeroCheck(second, dex_pc);
     AppendInstruction(second);
   }
@@ -1550,7 +1548,7 @@
 void HInstructionBuilder::BuildArrayAccess(const Instruction& instruction,
                                            uint32_t dex_pc,
                                            bool is_put,
-                                           Primitive::Type anticipated_type) {
+                                           DataType::Type anticipated_type) {
   uint8_t source_or_dest_reg = instruction.VRegA_23x();
   uint8_t array_reg = instruction.VRegB_23x();
   uint8_t index_reg = instruction.VRegC_23x();
@@ -1558,7 +1556,7 @@
   HInstruction* object = LoadNullCheckedLocal(array_reg, dex_pc);
   HInstruction* length = new (arena_) HArrayLength(object, dex_pc);
   AppendInstruction(length);
-  HInstruction* index = LoadLocal(index_reg, Primitive::kPrimInt);
+  HInstruction* index = LoadLocal(index_reg, DataType::Type::kInt32);
   index = new (arena_) HBoundsCheck(index, length, dex_pc);
   AppendInstruction(index);
   if (is_put) {
@@ -1594,7 +1592,7 @@
       || primitive == 'L'
       || primitive == '[') << descriptor;
   bool is_reference_array = (primitive == 'L') || (primitive == '[');
-  Primitive::Type type = is_reference_array ? Primitive::kPrimNot : Primitive::kPrimInt;
+  DataType::Type type = is_reference_array ? DataType::Type::kReference : DataType::Type::kInt32;
 
   for (size_t i = 0; i < number_of_vreg_arguments; ++i) {
     HInstruction* value = LoadLocal(is_range ? register_index + i : args[i], type);
@@ -1612,7 +1610,7 @@
 void HInstructionBuilder::BuildFillArrayData(HInstruction* object,
                                              const T* data,
                                              uint32_t element_count,
-                                             Primitive::Type anticipated_type,
+                                             DataType::Type anticipated_type,
                                              uint32_t dex_pc) {
   for (uint32_t i = 0; i < element_count; ++i) {
     HInstruction* index = graph_->GetIntConstant(i, dex_pc);
@@ -1650,21 +1648,21 @@
       BuildFillArrayData(array,
                          reinterpret_cast<const int8_t*>(data),
                          element_count,
-                         Primitive::kPrimByte,
+                         DataType::Type::kInt8,
                          dex_pc);
       break;
     case 2:
       BuildFillArrayData(array,
                          reinterpret_cast<const int16_t*>(data),
                          element_count,
-                         Primitive::kPrimShort,
+                         DataType::Type::kInt16,
                          dex_pc);
       break;
     case 4:
       BuildFillArrayData(array,
                          reinterpret_cast<const int32_t*>(data),
                          element_count,
-                         Primitive::kPrimInt,
+                         DataType::Type::kInt32,
                          dex_pc);
       break;
     case 8:
@@ -1686,7 +1684,7 @@
   for (uint32_t i = 0; i < element_count; ++i) {
     HInstruction* index = graph_->GetIntConstant(i, dex_pc);
     HInstruction* value = graph_->GetLongConstant(data[i], dex_pc);
-    HArraySet* aset = new (arena_) HArraySet(object, index, value, Primitive::kPrimLong, dex_pc);
+    HArraySet* aset = new (arena_) HArraySet(object, index, value, DataType::Type::kInt64, dex_pc);
     ssa_builder_->MaybeAddAmbiguousArraySet(aset);
     AppendInstruction(aset);
   }
@@ -1783,7 +1781,7 @@
                                          uint8_t reference,
                                          dex::TypeIndex type_index,
                                          uint32_t dex_pc) {
-  HInstruction* object = LoadLocal(reference, Primitive::kPrimNot);
+  HInstruction* object = LoadLocal(reference, DataType::Type::kReference);
   HLoadClass* cls = BuildLoadClass(type_index, dex_pc);
 
   ScopedObjectAccess soa(Thread::Current());
@@ -1889,7 +1887,7 @@
     case Instruction::MOVE:
     case Instruction::MOVE_FROM16:
     case Instruction::MOVE_16: {
-      HInstruction* value = LoadLocal(instruction.VRegB(), Primitive::kPrimInt);
+      HInstruction* value = LoadLocal(instruction.VRegB(), DataType::Type::kInt32);
       UpdateLocal(instruction.VRegA(), value);
       break;
     }
@@ -1898,7 +1896,7 @@
     case Instruction::MOVE_WIDE:
     case Instruction::MOVE_WIDE_FROM16:
     case Instruction::MOVE_WIDE_16: {
-      HInstruction* value = LoadLocal(instruction.VRegB(), Primitive::kPrimLong);
+      HInstruction* value = LoadLocal(instruction.VRegB(), DataType::Type::kInt64);
       UpdateLocal(instruction.VRegA(), value);
       break;
     }
@@ -1916,9 +1914,10 @@
       if (value->IsIntConstant()) {
         DCHECK_EQ(value->AsIntConstant()->GetValue(), 0);
       } else if (value->IsPhi()) {
-        DCHECK(value->GetType() == Primitive::kPrimInt || value->GetType() == Primitive::kPrimNot);
+        DCHECK(value->GetType() == DataType::Type::kInt32 ||
+               value->GetType() == DataType::Type::kReference);
       } else {
-        value = LoadLocal(reg_number, Primitive::kPrimNot);
+        value = LoadLocal(reg_number, DataType::Type::kReference);
       }
       UpdateLocal(instruction.VRegA(), value);
       break;
@@ -1926,7 +1925,7 @@
 
     case Instruction::RETURN_VOID_NO_BARRIER:
     case Instruction::RETURN_VOID: {
-      BuildReturn(instruction, Primitive::kPrimVoid, dex_pc);
+      BuildReturn(instruction, DataType::Type::kVoid, dex_pc);
       break;
     }
 
@@ -2045,435 +2044,435 @@
     }
 
     case Instruction::NEG_INT: {
-      Unop_12x<HNeg>(instruction, Primitive::kPrimInt, dex_pc);
+      Unop_12x<HNeg>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::NEG_LONG: {
-      Unop_12x<HNeg>(instruction, Primitive::kPrimLong, dex_pc);
+      Unop_12x<HNeg>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::NEG_FLOAT: {
-      Unop_12x<HNeg>(instruction, Primitive::kPrimFloat, dex_pc);
+      Unop_12x<HNeg>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::NEG_DOUBLE: {
-      Unop_12x<HNeg>(instruction, Primitive::kPrimDouble, dex_pc);
+      Unop_12x<HNeg>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::NOT_INT: {
-      Unop_12x<HNot>(instruction, Primitive::kPrimInt, dex_pc);
+      Unop_12x<HNot>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::NOT_LONG: {
-      Unop_12x<HNot>(instruction, Primitive::kPrimLong, dex_pc);
+      Unop_12x<HNot>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_LONG: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimLong, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_FLOAT: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimFloat, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_DOUBLE: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimDouble, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::LONG_TO_INT: {
-      Conversion_12x(instruction, Primitive::kPrimLong, Primitive::kPrimInt, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt64, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::LONG_TO_FLOAT: {
-      Conversion_12x(instruction, Primitive::kPrimLong, Primitive::kPrimFloat, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt64, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::LONG_TO_DOUBLE: {
-      Conversion_12x(instruction, Primitive::kPrimLong, Primitive::kPrimDouble, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt64, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::FLOAT_TO_INT: {
-      Conversion_12x(instruction, Primitive::kPrimFloat, Primitive::kPrimInt, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat32, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::FLOAT_TO_LONG: {
-      Conversion_12x(instruction, Primitive::kPrimFloat, Primitive::kPrimLong, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat32, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::FLOAT_TO_DOUBLE: {
-      Conversion_12x(instruction, Primitive::kPrimFloat, Primitive::kPrimDouble, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat32, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::DOUBLE_TO_INT: {
-      Conversion_12x(instruction, Primitive::kPrimDouble, Primitive::kPrimInt, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat64, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::DOUBLE_TO_LONG: {
-      Conversion_12x(instruction, Primitive::kPrimDouble, Primitive::kPrimLong, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat64, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::DOUBLE_TO_FLOAT: {
-      Conversion_12x(instruction, Primitive::kPrimDouble, Primitive::kPrimFloat, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kFloat64, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_BYTE: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimByte, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kInt8, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_SHORT: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimShort, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kInt16, dex_pc);
       break;
     }
 
     case Instruction::INT_TO_CHAR: {
-      Conversion_12x(instruction, Primitive::kPrimInt, Primitive::kPrimChar, dex_pc);
+      Conversion_12x(instruction, DataType::Type::kInt32, DataType::Type::kUint16, dex_pc);
       break;
     }
 
     case Instruction::ADD_INT: {
-      Binop_23x<HAdd>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HAdd>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::ADD_LONG: {
-      Binop_23x<HAdd>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HAdd>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::ADD_DOUBLE: {
-      Binop_23x<HAdd>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_23x<HAdd>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::ADD_FLOAT: {
-      Binop_23x<HAdd>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_23x<HAdd>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::SUB_INT: {
-      Binop_23x<HSub>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HSub>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SUB_LONG: {
-      Binop_23x<HSub>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HSub>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::SUB_FLOAT: {
-      Binop_23x<HSub>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_23x<HSub>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::SUB_DOUBLE: {
-      Binop_23x<HSub>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_23x<HSub>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::ADD_INT_2ADDR: {
-      Binop_12x<HAdd>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HAdd>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::MUL_INT: {
-      Binop_23x<HMul>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HMul>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::MUL_LONG: {
-      Binop_23x<HMul>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HMul>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::MUL_FLOAT: {
-      Binop_23x<HMul>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_23x<HMul>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::MUL_DOUBLE: {
-      Binop_23x<HMul>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_23x<HMul>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::DIV_INT: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimInt, false, true);
+                         dex_pc, DataType::Type::kInt32, false, true);
       break;
     }
 
     case Instruction::DIV_LONG: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimLong, false, true);
+                         dex_pc, DataType::Type::kInt64, false, true);
       break;
     }
 
     case Instruction::DIV_FLOAT: {
-      Binop_23x<HDiv>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_23x<HDiv>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::DIV_DOUBLE: {
-      Binop_23x<HDiv>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_23x<HDiv>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::REM_INT: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimInt, false, false);
+                         dex_pc, DataType::Type::kInt32, false, false);
       break;
     }
 
     case Instruction::REM_LONG: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimLong, false, false);
+                         dex_pc, DataType::Type::kInt64, false, false);
       break;
     }
 
     case Instruction::REM_FLOAT: {
-      Binop_23x<HRem>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_23x<HRem>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::REM_DOUBLE: {
-      Binop_23x<HRem>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_23x<HRem>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::AND_INT: {
-      Binop_23x<HAnd>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HAnd>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::AND_LONG: {
-      Binop_23x<HAnd>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HAnd>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::SHL_INT: {
-      Binop_23x_shift<HShl>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x_shift<HShl>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SHL_LONG: {
-      Binop_23x_shift<HShl>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x_shift<HShl>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::SHR_INT: {
-      Binop_23x_shift<HShr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x_shift<HShr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SHR_LONG: {
-      Binop_23x_shift<HShr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x_shift<HShr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::USHR_INT: {
-      Binop_23x_shift<HUShr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x_shift<HUShr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::USHR_LONG: {
-      Binop_23x_shift<HUShr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x_shift<HUShr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::OR_INT: {
-      Binop_23x<HOr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HOr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::OR_LONG: {
-      Binop_23x<HOr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HOr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::XOR_INT: {
-      Binop_23x<HXor>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_23x<HXor>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::XOR_LONG: {
-      Binop_23x<HXor>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_23x<HXor>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::ADD_LONG_2ADDR: {
-      Binop_12x<HAdd>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HAdd>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::ADD_DOUBLE_2ADDR: {
-      Binop_12x<HAdd>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_12x<HAdd>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::ADD_FLOAT_2ADDR: {
-      Binop_12x<HAdd>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_12x<HAdd>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::SUB_INT_2ADDR: {
-      Binop_12x<HSub>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HSub>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SUB_LONG_2ADDR: {
-      Binop_12x<HSub>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HSub>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::SUB_FLOAT_2ADDR: {
-      Binop_12x<HSub>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_12x<HSub>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::SUB_DOUBLE_2ADDR: {
-      Binop_12x<HSub>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_12x<HSub>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::MUL_INT_2ADDR: {
-      Binop_12x<HMul>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HMul>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::MUL_LONG_2ADDR: {
-      Binop_12x<HMul>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HMul>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::MUL_FLOAT_2ADDR: {
-      Binop_12x<HMul>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_12x<HMul>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::MUL_DOUBLE_2ADDR: {
-      Binop_12x<HMul>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_12x<HMul>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::DIV_INT_2ADDR: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegA(), instruction.VRegB(),
-                         dex_pc, Primitive::kPrimInt, false, true);
+                         dex_pc, DataType::Type::kInt32, false, true);
       break;
     }
 
     case Instruction::DIV_LONG_2ADDR: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegA(), instruction.VRegB(),
-                         dex_pc, Primitive::kPrimLong, false, true);
+                         dex_pc, DataType::Type::kInt64, false, true);
       break;
     }
 
     case Instruction::REM_INT_2ADDR: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegA(), instruction.VRegB(),
-                         dex_pc, Primitive::kPrimInt, false, false);
+                         dex_pc, DataType::Type::kInt32, false, false);
       break;
     }
 
     case Instruction::REM_LONG_2ADDR: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegA(), instruction.VRegB(),
-                         dex_pc, Primitive::kPrimLong, false, false);
+                         dex_pc, DataType::Type::kInt64, false, false);
       break;
     }
 
     case Instruction::REM_FLOAT_2ADDR: {
-      Binop_12x<HRem>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_12x<HRem>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::REM_DOUBLE_2ADDR: {
-      Binop_12x<HRem>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_12x<HRem>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::SHL_INT_2ADDR: {
-      Binop_12x_shift<HShl>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x_shift<HShl>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SHL_LONG_2ADDR: {
-      Binop_12x_shift<HShl>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x_shift<HShl>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::SHR_INT_2ADDR: {
-      Binop_12x_shift<HShr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x_shift<HShr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::SHR_LONG_2ADDR: {
-      Binop_12x_shift<HShr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x_shift<HShr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::USHR_INT_2ADDR: {
-      Binop_12x_shift<HUShr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x_shift<HUShr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::USHR_LONG_2ADDR: {
-      Binop_12x_shift<HUShr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x_shift<HUShr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::DIV_FLOAT_2ADDR: {
-      Binop_12x<HDiv>(instruction, Primitive::kPrimFloat, dex_pc);
+      Binop_12x<HDiv>(instruction, DataType::Type::kFloat32, dex_pc);
       break;
     }
 
     case Instruction::DIV_DOUBLE_2ADDR: {
-      Binop_12x<HDiv>(instruction, Primitive::kPrimDouble, dex_pc);
+      Binop_12x<HDiv>(instruction, DataType::Type::kFloat64, dex_pc);
       break;
     }
 
     case Instruction::AND_INT_2ADDR: {
-      Binop_12x<HAnd>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HAnd>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::AND_LONG_2ADDR: {
-      Binop_12x<HAnd>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HAnd>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::OR_INT_2ADDR: {
-      Binop_12x<HOr>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HOr>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::OR_LONG_2ADDR: {
-      Binop_12x<HOr>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HOr>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
     case Instruction::XOR_INT_2ADDR: {
-      Binop_12x<HXor>(instruction, Primitive::kPrimInt, dex_pc);
+      Binop_12x<HXor>(instruction, DataType::Type::kInt32, dex_pc);
       break;
     }
 
     case Instruction::XOR_LONG_2ADDR: {
-      Binop_12x<HXor>(instruction, Primitive::kPrimLong, dex_pc);
+      Binop_12x<HXor>(instruction, DataType::Type::kInt64, dex_pc);
       break;
     }
 
@@ -2540,14 +2539,14 @@
     case Instruction::DIV_INT_LIT16:
     case Instruction::DIV_INT_LIT8: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimInt, true, true);
+                         dex_pc, DataType::Type::kInt32, true, true);
       break;
     }
 
     case Instruction::REM_INT_LIT16:
     case Instruction::REM_INT_LIT8: {
       BuildCheckedDivRem(instruction.VRegA(), instruction.VRegB(), instruction.VRegC(),
-                         dex_pc, Primitive::kPrimInt, true, false);
+                         dex_pc, DataType::Type::kInt32, true, false);
       break;
     }
 
@@ -2578,7 +2577,7 @@
 
     case Instruction::NEW_ARRAY: {
       dex::TypeIndex type_index(instruction.VRegC_22c());
-      HInstruction* length = LoadLocal(instruction.VRegB_22c(), Primitive::kPrimInt);
+      HInstruction* length = LoadLocal(instruction.VRegB_22c(), DataType::Type::kInt32);
       HLoadClass* cls = BuildLoadClass(type_index, dex_pc);
 
       HNewArray* new_array = new (arena_) HNewArray(cls, length, dex_pc);
@@ -2632,27 +2631,27 @@
     }
 
     case Instruction::CMP_LONG: {
-      Binop_23x_cmp(instruction, Primitive::kPrimLong, ComparisonBias::kNoBias, dex_pc);
+      Binop_23x_cmp(instruction, DataType::Type::kInt64, ComparisonBias::kNoBias, dex_pc);
       break;
     }
 
     case Instruction::CMPG_FLOAT: {
-      Binop_23x_cmp(instruction, Primitive::kPrimFloat, ComparisonBias::kGtBias, dex_pc);
+      Binop_23x_cmp(instruction, DataType::Type::kFloat32, ComparisonBias::kGtBias, dex_pc);
       break;
     }
 
     case Instruction::CMPG_DOUBLE: {
-      Binop_23x_cmp(instruction, Primitive::kPrimDouble, ComparisonBias::kGtBias, dex_pc);
+      Binop_23x_cmp(instruction, DataType::Type::kFloat64, ComparisonBias::kGtBias, dex_pc);
       break;
     }
 
     case Instruction::CMPL_FLOAT: {
-      Binop_23x_cmp(instruction, Primitive::kPrimFloat, ComparisonBias::kLtBias, dex_pc);
+      Binop_23x_cmp(instruction, DataType::Type::kFloat32, ComparisonBias::kLtBias, dex_pc);
       break;
     }
 
     case Instruction::CMPL_DOUBLE: {
-      Binop_23x_cmp(instruction, Primitive::kPrimDouble, ComparisonBias::kLtBias, dex_pc);
+      Binop_23x_cmp(instruction, DataType::Type::kFloat64, ComparisonBias::kLtBias, dex_pc);
       break;
     }
 
@@ -2735,13 +2734,13 @@
       break;                                                                      \
     }
 
-    ARRAY_XX(, Primitive::kPrimInt);
-    ARRAY_XX(_WIDE, Primitive::kPrimLong);
-    ARRAY_XX(_OBJECT, Primitive::kPrimNot);
-    ARRAY_XX(_BOOLEAN, Primitive::kPrimBoolean);
-    ARRAY_XX(_BYTE, Primitive::kPrimByte);
-    ARRAY_XX(_CHAR, Primitive::kPrimChar);
-    ARRAY_XX(_SHORT, Primitive::kPrimShort);
+    ARRAY_XX(, DataType::Type::kInt32);
+    ARRAY_XX(_WIDE, DataType::Type::kInt64);
+    ARRAY_XX(_OBJECT, DataType::Type::kReference);
+    ARRAY_XX(_BOOLEAN, DataType::Type::kBool);
+    ARRAY_XX(_BYTE, DataType::Type::kInt8);
+    ARRAY_XX(_CHAR, DataType::Type::kUint16);
+    ARRAY_XX(_SHORT, DataType::Type::kInt16);
 
     case Instruction::ARRAY_LENGTH: {
       HInstruction* object = LoadNullCheckedLocal(instruction.VRegB_12x(), dex_pc);
@@ -2781,7 +2780,7 @@
     }
 
     case Instruction::THROW: {
-      HInstruction* exception = LoadLocal(instruction.VRegA_11x(), Primitive::kPrimNot);
+      HInstruction* exception = LoadLocal(instruction.VRegA_11x(), DataType::Type::kReference);
       AppendInstruction(new (arena_) HThrow(exception, dex_pc));
       // We finished building this block. Set the current block to null to avoid
       // adding dead instructions to it.
@@ -2806,7 +2805,7 @@
 
     case Instruction::MONITOR_ENTER: {
       AppendInstruction(new (arena_) HMonitorOperation(
-          LoadLocal(instruction.VRegA_11x(), Primitive::kPrimNot),
+          LoadLocal(instruction.VRegA_11x(), DataType::Type::kReference),
           HMonitorOperation::OperationKind::kEnter,
           dex_pc));
       break;
@@ -2814,7 +2813,7 @@
 
     case Instruction::MONITOR_EXIT: {
       AppendInstruction(new (arena_) HMonitorOperation(
-          LoadLocal(instruction.VRegA_11x(), Primitive::kPrimNot),
+          LoadLocal(instruction.VRegA_11x(), DataType::Type::kReference),
           HMonitorOperation::OperationKind::kExit,
           dex_pc));
       break;
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index b7fa394..a684bf4 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -42,7 +42,7 @@
                       SsaBuilder* ssa_builder,
                       const DexFile* dex_file,
                       const DexFile::CodeItem& code_item,
-                      Primitive::Type return_type,
+                      DataType::Type return_type,
                       DexCompilationUnit* dex_compilation_unit,
                       const DexCompilationUnit* const outer_compilation_unit,
                       CompilerDriver* driver,
@@ -96,7 +96,7 @@
   ArenaVector<HInstruction*>* GetLocalsForWithAllocation(
       HBasicBlock* block, ArenaVector<HInstruction*>* locals, const size_t vregs);
   HInstruction* ValueOfLocalAt(HBasicBlock* block, size_t local);
-  HInstruction* LoadLocal(uint32_t register_index, Primitive::Type type) const;
+  HInstruction* LoadLocal(uint32_t register_index, DataType::Type type) const;
   HInstruction* LoadNullCheckedLocal(uint32_t register_index, uint32_t dex_pc);
   void UpdateLocal(uint32_t register_index, HInstruction* instruction);
 
@@ -112,24 +112,24 @@
       REQUIRES_SHARED(Locks::mutator_lock_);
 
   template<typename T>
-  void Unop_12x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void Unop_12x(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   template<typename T>
-  void Binop_23x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void Binop_23x(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   template<typename T>
-  void Binop_23x_shift(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void Binop_23x_shift(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   void Binop_23x_cmp(const Instruction& instruction,
-                     Primitive::Type type,
+                     DataType::Type type,
                      ComparisonBias bias,
                      uint32_t dex_pc);
 
   template<typename T>
-  void Binop_12x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void Binop_12x(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   template<typename T>
-  void Binop_12x_shift(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void Binop_12x_shift(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   template<typename T>
   void Binop_22b(const Instruction& instruction, bool reverse, uint32_t dex_pc);
@@ -141,19 +141,19 @@
   template<typename T> void If_22t(const Instruction& instruction, uint32_t dex_pc);
 
   void Conversion_12x(const Instruction& instruction,
-                      Primitive::Type input_type,
-                      Primitive::Type result_type,
+                      DataType::Type input_type,
+                      DataType::Type result_type,
                       uint32_t dex_pc);
 
   void BuildCheckedDivRem(uint16_t out_reg,
                           uint16_t first_reg,
                           int64_t second_reg_or_constant,
                           uint32_t dex_pc,
-                          Primitive::Type type,
+                          DataType::Type type,
                           bool second_is_lit,
                           bool is_div);
 
-  void BuildReturn(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
+  void BuildReturn(const Instruction& instruction, DataType::Type type, uint32_t dex_pc);
 
   // Builds an instance field access node and returns whether the instruction is supported.
   bool BuildInstanceFieldAccess(const Instruction& instruction,
@@ -164,14 +164,14 @@
   void BuildUnresolvedStaticFieldAccess(const Instruction& instruction,
                                         uint32_t dex_pc,
                                         bool is_put,
-                                        Primitive::Type field_type);
+                                        DataType::Type field_type);
   // Builds a static field access node and returns whether the instruction is supported.
   bool BuildStaticFieldAccess(const Instruction& instruction, uint32_t dex_pc, bool is_put);
 
   void BuildArrayAccess(const Instruction& instruction,
                         uint32_t dex_pc,
                         bool is_get,
-                        Primitive::Type anticipated_type);
+                        DataType::Type anticipated_type);
 
   // Builds an invocation node and returns whether the instruction is supported.
   bool BuildInvoke(const Instruction& instruction,
@@ -210,7 +210,7 @@
   void BuildFillArrayData(HInstruction* object,
                           const T* data,
                           uint32_t element_count,
-                          Primitive::Type anticipated_type,
+                          DataType::Type anticipated_type,
                           uint32_t dex_pc);
 
   // Fills the given object with data as specified in the fill-array-data
@@ -321,7 +321,7 @@
   const DexFile::CodeItem& code_item_;
 
   // The return type of the method being compiled.
-  const Primitive::Type return_type_;
+  const DataType::Type return_type_;
 
   HBasicBlockBuilder* block_builder_;
   SsaBuilder* ssa_builder_;
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 337177f..1a2494a 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -18,6 +18,7 @@
 
 #include "art_method-inl.h"
 #include "class_linker-inl.h"
+#include "data_type-inl.h"
 #include "escape.h"
 #include "intrinsics.h"
 #include "mirror/class-inl.h"
@@ -103,10 +104,10 @@
 
   bool CanEnsureNotNullAt(HInstruction* instr, HInstruction* at) const;
 
-  void SimplifyRotate(HInvoke* invoke, bool is_left, Primitive::Type type);
+  void SimplifyRotate(HInvoke* invoke, bool is_left, DataType::Type type);
   void SimplifySystemArrayCopy(HInvoke* invoke);
   void SimplifyStringEquals(HInvoke* invoke);
-  void SimplifyCompare(HInvoke* invoke, bool is_signum, Primitive::Type type);
+  void SimplifyCompare(HInvoke* invoke, bool is_signum, DataType::Type type);
   void SimplifyIsNaN(HInvoke* invoke);
   void SimplifyFP2Int(HInvoke* invoke);
   void SimplifyStringCharAt(HInvoke* invoke);
@@ -178,7 +179,7 @@
   // Note that we cannot optimize `(-a) + (-b)` to `-(a + b)` for floating-point.
   // When `a` is `-0.0` and `b` is `0.0`, the former expression yields `0.0`,
   // while the later yields `-0.0`.
-  if (!Primitive::IsIntegralType(binop->GetType())) {
+  if (!DataType::IsIntegralType(binop->GetType())) {
     return false;
   }
   binop->ReplaceInput(left_neg->GetInput(), 0);
@@ -194,7 +195,7 @@
 
 bool InstructionSimplifierVisitor::TryDeMorganNegationFactoring(HBinaryOperation* op) {
   DCHECK(op->IsAnd() || op->IsOr()) << op->DebugName();
-  Primitive::Type type = op->GetType();
+  DataType::Type type = op->GetType();
   HInstruction* left = op->GetLeft();
   HInstruction* right = op->GetRight();
 
@@ -246,24 +247,24 @@
 }
 
 bool InstructionSimplifierVisitor::TryCombineVecMultiplyAccumulate(HVecMul* mul) {
-  Primitive::Type type = mul->GetPackedType();
+  DataType::Type type = mul->GetPackedType();
   InstructionSet isa = codegen_->GetInstructionSet();
   switch (isa) {
     case kArm64:
-      if (!(type == Primitive::kPrimByte ||
-            type == Primitive::kPrimChar ||
-            type == Primitive::kPrimShort ||
-            type == Primitive::kPrimInt)) {
+      if (!(type == DataType::Type::kInt8 ||
+            type == DataType::Type::kUint16 ||
+            type == DataType::Type::kInt16 ||
+            type == DataType::Type::kInt32)) {
         return false;
       }
       break;
     case kMips:
     case kMips64:
-      if (!(type == Primitive::kPrimByte ||
-            type == Primitive::kPrimChar ||
-            type == Primitive::kPrimShort ||
-            type == Primitive::kPrimInt ||
-            type == Primitive::kPrimLong)) {
+      if (!(type == DataType::Type::kInt8 ||
+            type == DataType::Type::kUint16 ||
+            type == DataType::Type::kInt16 ||
+            type == DataType::Type::kInt32 ||
+            type == DataType::Type::kInt64)) {
         return false;
       }
       break;
@@ -328,7 +329,7 @@
   HInstruction* shift_amount = instruction->GetRight();
   HInstruction* value = instruction->GetLeft();
 
-  int64_t implicit_mask = (value->GetType() == Primitive::kPrimLong)
+  int64_t implicit_mask = (value->GetType() == DataType::Type::kInt64)
       ? kMaxLongShiftDistance
       : kMaxIntShiftDistance;
 
@@ -351,7 +352,7 @@
       //    SHL dst, value, cst & implicit_mask
       // (as defined by shift semantics). This ensures other
       // optimizations do not need to special case for such situations.
-      DCHECK_EQ(shift_amount->GetType(), Primitive::kPrimInt);
+      DCHECK_EQ(shift_amount->GetType(), DataType::Type::kInt32);
       instruction->ReplaceInput(GetGraph()->GetIntConstant(masked_cst), /* index */ 1);
       RecordSimplification();
       return;
@@ -412,7 +413,7 @@
   if ((left->IsUShr() && right->IsShl()) || (left->IsShl() && right->IsUShr())) {
     HUShr* ushr = left->IsUShr() ? left->AsUShr() : right->AsUShr();
     HShl* shl = left->IsShl() ? left->AsShl() : right->AsShl();
-    DCHECK(Primitive::IsIntOrLongType(ushr->GetType()));
+    DCHECK(DataType::IsIntOrLongType(ushr->GetType()));
     if (ushr->GetType() == shl->GetType() &&
         ushr->GetLeft() == shl->GetLeft()) {
       if (ushr->GetRight()->IsConstant() && shl->GetRight()->IsConstant()) {
@@ -445,7 +446,7 @@
                                                                        HUShr* ushr,
                                                                        HShl* shl) {
   DCHECK(op->IsAdd() || op->IsXor() || op->IsOr());
-  size_t reg_bits = Primitive::ComponentSize(ushr->GetType()) * kBitsPerByte;
+  size_t reg_bits = DataType::Size(ushr->GetType()) * kBitsPerByte;
   size_t rdist = Int64FromConstant(ushr->GetRight()->AsConstant());
   size_t ldist = Int64FromConstant(shl->GetRight()->AsConstant());
   if (((ldist + rdist) & (reg_bits - 1)) == 0) {
@@ -506,7 +507,7 @@
                                                                           HShl* shl) {
   DCHECK(op->IsAdd() || op->IsXor() || op->IsOr());
   DCHECK(ushr->GetRight()->IsSub() || shl->GetRight()->IsSub());
-  size_t reg_bits = Primitive::ComponentSize(ushr->GetType()) * kBitsPerByte;
+  size_t reg_bits = DataType::Size(ushr->GetType()) * kBitsPerByte;
   HInstruction* shl_shift = shl->GetRight();
   HInstruction* ushr_shift = ushr->GetRight();
   if ((shl_shift->IsSub() && IsSubRegBitsMinusOther(shl_shift->AsSub(), reg_bits, ushr_shift)) ||
@@ -664,14 +665,14 @@
 }
 
 void InstructionSimplifierVisitor::VisitInstanceFieldSet(HInstanceFieldSet* instruction) {
-  if ((instruction->GetValue()->GetType() == Primitive::kPrimNot)
+  if ((instruction->GetValue()->GetType() == DataType::Type::kReference)
       && CanEnsureNotNullAt(instruction->GetValue(), instruction)) {
     instruction->ClearValueCanBeNull();
   }
 }
 
 void InstructionSimplifierVisitor::VisitStaticFieldSet(HStaticFieldSet* instruction) {
-  if ((instruction->GetValue()->GetType() == Primitive::kPrimNot)
+  if ((instruction->GetValue()->GetType() == DataType::Type::kReference)
       && CanEnsureNotNullAt(instruction->GetValue(), instruction)) {
     instruction->ClearValueCanBeNull();
   }
@@ -708,7 +709,7 @@
 }
 
 static bool CmpHasBoolType(HInstruction* input, HInstruction* cmp) {
-  if (input->GetType() == Primitive::kPrimBoolean) {
+  if (input->GetType() == DataType::Type::kBool) {
     return true;  // input has direct boolean type
   } else if (cmp->GetUses().HasExactlyOneElement()) {
     // Comparison also has boolean type if both its input and the instruction
@@ -801,7 +802,7 @@
   } else if (input->IsCondition() &&
              // Don't change FP compares. The definition of compares involving
              // NaNs forces the compares to be done as written by the user.
-             !Primitive::IsFloatingPointType(input->InputAt(0)->GetType())) {
+             !DataType::IsFloatingPointType(input->InputAt(0)->GetType())) {
     // Replace condition with its opposite.
     replace_with = GetGraph()->InsertOppositeCondition(input->AsCondition(), bool_not);
   }
@@ -815,8 +816,8 @@
 
 // Constructs a new ABS(x) node in the HIR.
 static HInstruction* NewIntegralAbs(ArenaAllocator* arena, HInstruction* x, HInstruction* cursor) {
-  Primitive::Type type = x->GetType();
-  DCHECK(type == Primitive::kPrimInt || type ==  Primitive::kPrimLong);
+  DataType::Type type = x->GetType();
+  DCHECK(type == DataType::Type::kInt32 || type ==  DataType::Type::kInt64);
   // Construct a fake intrinsic with as much context as is needed to allocate one.
   // The intrinsic will always be lowered into code later anyway.
   // TODO: b/65164101 : moving towards a real HAbs node makes more sense.
@@ -837,8 +838,8 @@
       MethodReference(nullptr, dex::kDexNoIndex),
       HInvokeStaticOrDirect::ClinitCheckRequirement::kNone);
   invoke->SetArgumentAt(0, x);
-  invoke->SetIntrinsic(type == Primitive::kPrimInt ? Intrinsics::kMathAbsInt
-                                                   : Intrinsics::kMathAbsLong,
+  invoke->SetIntrinsic(type == DataType::Type::kInt32 ? Intrinsics::kMathAbsInt
+                                                      : Intrinsics::kMathAbsLong,
                        kNoEnvironmentOrCache,
                        kNoSideEffects,
                        kNoThrow);
@@ -848,20 +849,20 @@
 
 // Returns true if operands a and b consists of widening type conversions
 // (either explicit or implicit) to the given to_type.
-static bool AreLowerPrecisionArgs(Primitive::Type to_type, HInstruction* a, HInstruction* b) {
+static bool AreLowerPrecisionArgs(DataType::Type to_type, HInstruction* a, HInstruction* b) {
   if (a->IsTypeConversion() && a->GetType() == to_type) {
     a = a->InputAt(0);
   }
   if (b->IsTypeConversion() && b->GetType() == to_type) {
     b = b->InputAt(0);
   }
-  Primitive::Type type1 = a->GetType();
-  Primitive::Type type2 = b->GetType();
-  return (type1 == Primitive::kPrimByte  && type2 == Primitive::kPrimByte) ||
-         (type1 == Primitive::kPrimShort && type2 == Primitive::kPrimShort) ||
-         (type1 == Primitive::kPrimChar  && type2 == Primitive::kPrimChar) ||
-         (type1 == Primitive::kPrimInt   && type2 == Primitive::kPrimInt &&
-          to_type == Primitive::kPrimLong);
+  DataType::Type type1 = a->GetType();
+  DataType::Type type2 = b->GetType();
+  return (type1 == DataType::Type::kInt8  && type2 == DataType::Type::kInt8) ||
+         (type1 == DataType::Type::kInt16 && type2 == DataType::Type::kInt16) ||
+         (type1 == DataType::Type::kUint16  && type2 == DataType::Type::kUint16) ||
+         (type1 == DataType::Type::kInt32   && type2 == DataType::Type::kInt32 &&
+          to_type == DataType::Type::kInt64);
 }
 
 void InstructionSimplifierVisitor::VisitSelect(HSelect* select) {
@@ -904,11 +905,12 @@
     IfCondition cmp = condition->AsCondition()->GetCondition();
     HInstruction* a = condition->InputAt(0);
     HInstruction* b = condition->InputAt(1);
-    Primitive::Type t_type = true_value->GetType();
-    Primitive::Type f_type = false_value->GetType();
+    DataType::Type t_type = true_value->GetType();
+    DataType::Type f_type = false_value->GetType();
     // Here we have a <cmp> b ? true_value : false_value.
     // Test if both values are same-typed int or long.
-    if (t_type == f_type && (t_type == Primitive::kPrimInt || t_type == Primitive::kPrimLong)) {
+    if (t_type == f_type &&
+        (t_type == DataType::Type::kInt32 || t_type == DataType::Type::kInt64)) {
       // Try to replace typical integral ABS constructs.
       if (true_value->IsNeg()) {
         HInstruction* negated = true_value->InputAt(0);
@@ -974,7 +976,9 @@
 
 void InstructionSimplifierVisitor::VisitArraySet(HArraySet* instruction) {
   HInstruction* value = instruction->GetValue();
-  if (value->GetType() != Primitive::kPrimNot) return;
+  if (value->GetType() != DataType::Type::kReference) {
+    return;
+  }
 
   if (CanEnsureNotNullAt(value, instruction)) {
     instruction->ClearValueCanBeNull();
@@ -1014,39 +1018,39 @@
   }
 }
 
-static bool IsTypeConversionImplicit(Primitive::Type input_type, Primitive::Type result_type) {
+static bool IsTypeConversionImplicit(DataType::Type input_type, DataType::Type result_type) {
   // Invariant: We should never generate a conversion to a Boolean value.
-  DCHECK_NE(Primitive::kPrimBoolean, result_type);
+  DCHECK_NE(DataType::Type::kBool, result_type);
 
   // Besides conversion to the same type, widening integral conversions are implicit,
   // excluding conversions to long and the byte->char conversion where we need to
   // clear the high 16 bits of the 32-bit sign-extended representation of byte.
   return result_type == input_type ||
-      (result_type == Primitive::kPrimInt && (input_type == Primitive::kPrimBoolean ||
-                                              input_type == Primitive::kPrimByte ||
-                                              input_type == Primitive::kPrimShort ||
-                                              input_type == Primitive::kPrimChar)) ||
-      (result_type == Primitive::kPrimChar && input_type == Primitive::kPrimBoolean) ||
-      (result_type == Primitive::kPrimShort && (input_type == Primitive::kPrimBoolean ||
-                                                input_type == Primitive::kPrimByte)) ||
-      (result_type == Primitive::kPrimByte && input_type == Primitive::kPrimBoolean);
+      (result_type == DataType::Type::kInt32 && (input_type == DataType::Type::kBool ||
+                                                 input_type == DataType::Type::kInt8 ||
+                                                 input_type == DataType::Type::kInt16 ||
+                                                 input_type == DataType::Type::kUint16)) ||
+      (result_type == DataType::Type::kUint16 && input_type == DataType::Type::kBool) ||
+      (result_type == DataType::Type::kInt16 && (input_type == DataType::Type::kBool ||
+                                                 input_type == DataType::Type::kInt8)) ||
+      (result_type == DataType::Type::kInt8 && input_type == DataType::Type::kBool);
 }
 
-static bool IsTypeConversionLossless(Primitive::Type input_type, Primitive::Type result_type) {
+static bool IsTypeConversionLossless(DataType::Type input_type, DataType::Type result_type) {
   // The conversion to a larger type is loss-less with the exception of two cases,
-  //   - conversion to char, the only unsigned type, where we may lose some bits, and
+  //   - conversion to Uint16, the only unsigned type, where we may lose some bits, and
   //   - conversion from float to long, the only FP to integral conversion with smaller FP type.
   // For integral to FP conversions this holds because the FP mantissa is large enough.
   DCHECK_NE(input_type, result_type);
-  return Primitive::ComponentSize(result_type) > Primitive::ComponentSize(input_type) &&
-      result_type != Primitive::kPrimChar &&
-      !(result_type == Primitive::kPrimLong && input_type == Primitive::kPrimFloat);
+  return DataType::Size(result_type) > DataType::Size(input_type) &&
+      result_type != DataType::Type::kUint16 &&
+      !(result_type == DataType::Type::kInt64 && input_type == DataType::Type::kFloat32);
 }
 
 void InstructionSimplifierVisitor::VisitTypeConversion(HTypeConversion* instruction) {
   HInstruction* input = instruction->GetInput();
-  Primitive::Type input_type = input->GetType();
-  Primitive::Type result_type = instruction->GetResultType();
+  DataType::Type input_type = input->GetType();
+  DataType::Type result_type = instruction->GetResultType();
   if (IsTypeConversionImplicit(input_type, result_type)) {
     // Remove the implicit conversion; this includes conversion to the same type.
     instruction->ReplaceWith(input);
@@ -1058,7 +1062,7 @@
   if (input->IsTypeConversion()) {
     HTypeConversion* input_conversion = input->AsTypeConversion();
     HInstruction* original_input = input_conversion->GetInput();
-    Primitive::Type original_type = original_input->GetType();
+    DataType::Type original_type = original_input->GetType();
 
     // When the first conversion is lossless, a direct conversion from the original type
     // to the final type yields the same result, even for a lossy second conversion, for
@@ -1069,10 +1073,10 @@
     // doesn't need, i.e. the final type is no wider than the intermediate. If so, direct
     // conversion yields the same result, for example long->int->short or int->char->short.
     bool integral_conversions_with_non_widening_second =
-        Primitive::IsIntegralType(input_type) &&
-        Primitive::IsIntegralType(original_type) &&
-        Primitive::IsIntegralType(result_type) &&
-        Primitive::ComponentSize(result_type) <= Primitive::ComponentSize(input_type);
+        DataType::IsIntegralType(input_type) &&
+        DataType::IsIntegralType(original_type) &&
+        DataType::IsIntegralType(result_type) &&
+        DataType::Size(result_type) <= DataType::Size(input_type);
 
     if (is_first_conversion_lossless || integral_conversions_with_non_widening_second) {
       // If the merged conversion is implicit, do the simplification unconditionally.
@@ -1094,15 +1098,15 @@
         return;
       }
     }
-  } else if (input->IsAnd() && Primitive::IsIntegralType(result_type)) {
-    DCHECK(Primitive::IsIntegralType(input_type));
+  } else if (input->IsAnd() && DataType::IsIntegralType(result_type)) {
+    DCHECK(DataType::IsIntegralType(input_type));
     HAnd* input_and = input->AsAnd();
     HConstant* constant = input_and->GetConstantRight();
     if (constant != nullptr) {
       int64_t value = Int64FromConstant(constant);
       DCHECK_NE(value, -1);  // "& -1" would have been optimized away in VisitAnd().
       size_t trailing_ones = CTZ(~static_cast<uint64_t>(value));
-      if (trailing_ones >= kBitsPerByte * Primitive::ComponentSize(result_type)) {
+      if (trailing_ones >= kBitsPerByte * DataType::Size(result_type)) {
         // The `HAnd` is useless, for example in `(byte) (x & 0xff)`, get rid of it.
         HInstruction* original_input = input_and->GetLeastConstantLeft();
         if (IsTypeConversionImplicit(original_input->GetType(), result_type)) {
@@ -1124,7 +1128,7 @@
 void InstructionSimplifierVisitor::VisitAdd(HAdd* instruction) {
   HConstant* input_cst = instruction->GetConstantRight();
   HInstruction* input_other = instruction->GetLeastConstantLeft();
-  bool integral_type = Primitive::IsIntegralType(instruction->GetType());
+  bool integral_type = DataType::IsIntegralType(instruction->GetType());
   if ((input_cst != nullptr) && input_cst->IsArithmeticZero()) {
     // Replace code looking like
     //    ADD dst, src, 0
@@ -1226,7 +1230,7 @@
     // can be non-zero after UShr. Transform Shr+And to UShr if the And-mask
     // precisely clears the shifted-in sign bits.
     if ((input_other->IsUShr() || input_other->IsShr()) && input_other->InputAt(1)->IsConstant()) {
-      size_t reg_bits = (instruction->GetResultType() == Primitive::kPrimLong) ? 64 : 32;
+      size_t reg_bits = (instruction->GetResultType() == DataType::Type::kInt64) ? 64 : 32;
       size_t shift = Int64FromConstant(input_other->InputAt(1)->AsConstant()) & (reg_bits - 1);
       size_t num_tail_bits_set = CTZ(value + 1);
       if ((num_tail_bits_set >= reg_bits - shift) && input_other->IsUShr()) {
@@ -1447,7 +1451,7 @@
 void InstructionSimplifierVisitor::VisitDiv(HDiv* instruction) {
   HConstant* input_cst = instruction->GetConstantRight();
   HInstruction* input_other = instruction->GetLeastConstantLeft();
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   if ((input_cst != nullptr) && input_cst->IsOne()) {
     // Replace code looking like
@@ -1471,19 +1475,19 @@
     return;
   }
 
-  if ((input_cst != nullptr) && Primitive::IsFloatingPointType(type)) {
+  if ((input_cst != nullptr) && DataType::IsFloatingPointType(type)) {
     // Try replacing code looking like
     //    DIV dst, src, constant
     // with
     //    MUL dst, src, 1 / constant
     HConstant* reciprocal = nullptr;
-    if (type == Primitive::Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       double value = input_cst->AsDoubleConstant()->GetValue();
       if (CanDivideByReciprocalMultiplyDouble(bit_cast<int64_t, double>(value))) {
         reciprocal = GetGraph()->GetDoubleConstant(1.0 / value);
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimFloat);
+      DCHECK_EQ(type, DataType::Type::kFloat32);
       float value = input_cst->AsFloatConstant()->GetValue();
       if (CanDivideByReciprocalMultiplyFloat(bit_cast<int32_t, float>(value))) {
         reciprocal = GetGraph()->GetFloatConstant(1.0f / value);
@@ -1502,7 +1506,7 @@
 void InstructionSimplifierVisitor::VisitMul(HMul* instruction) {
   HConstant* input_cst = instruction->GetConstantRight();
   HInstruction* input_other = instruction->GetLeastConstantLeft();
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   HBasicBlock* block = instruction->GetBlock();
   ArenaAllocator* allocator = GetGraph()->GetArena();
 
@@ -1522,7 +1526,7 @@
   }
 
   if (input_cst->IsMinusOne() &&
-      (Primitive::IsFloatingPointType(type) || Primitive::IsIntOrLongType(type))) {
+      (DataType::IsFloatingPointType(type) || DataType::IsIntOrLongType(type))) {
     // Replace code looking like
     //    MUL dst, src, -1
     // with
@@ -1533,7 +1537,7 @@
     return;
   }
 
-  if (Primitive::IsFloatingPointType(type) &&
+  if (DataType::IsFloatingPointType(type) &&
       ((input_cst->IsFloatConstant() && input_cst->AsFloatConstant()->GetValue() == 2.0f) ||
        (input_cst->IsDoubleConstant() && input_cst->AsDoubleConstant()->GetValue() == 2.0))) {
     // Replace code looking like
@@ -1547,7 +1551,7 @@
     return;
   }
 
-  if (Primitive::IsIntOrLongType(type)) {
+  if (DataType::IsIntOrLongType(type)) {
     int64_t factor = Int64FromConstant(input_cst);
     // Even though constant propagation also takes care of the zero case, other
     // optimizations can lead to having a zero multiplication.
@@ -1630,7 +1634,7 @@
   }
 
   if (input->IsSub() && input->HasOnlyOneNonEnvironmentUse() &&
-      !Primitive::IsFloatingPointType(input->GetType())) {
+      !DataType::IsFloatingPointType(input->GetType())) {
     // Replace code looking like
     //    SUB tmp, a, b
     //    NEG dst, tmp
@@ -1726,8 +1730,8 @@
   HConstant* input_cst = instruction->GetConstantRight();
   HInstruction* input_other = instruction->GetLeastConstantLeft();
 
-  Primitive::Type type = instruction->GetType();
-  if (Primitive::IsFloatingPointType(type)) {
+  DataType::Type type = instruction->GetType();
+  if (DataType::IsFloatingPointType(type)) {
     return;
   }
 
@@ -1818,7 +1822,7 @@
     // SUB instruction is not needed in this case, we may use
     // one of inputs of ADD instead.
     // It is applicable to integral types only.
-    DCHECK(Primitive::IsIntegralType(type));
+    DCHECK(DataType::IsIntegralType(type));
     if (left->InputAt(1) == right) {
       instruction->ReplaceWith(left->InputAt(0));
       RecordSimplification();
@@ -1853,7 +1857,7 @@
   }
 
   if ((input_cst != nullptr) && input_cst->IsOne()
-      && input_other->GetType() == Primitive::kPrimBoolean) {
+      && input_other->GetType() == DataType::Type::kBool) {
     // Replace code looking like
     //    XOR dst, src, 1
     // with
@@ -1930,7 +1934,7 @@
 
 void InstructionSimplifierVisitor::SimplifyRotate(HInvoke* invoke,
                                                   bool is_left,
-                                                  Primitive::Type type) {
+                                                  DataType::Type type) {
   DCHECK(invoke->IsInvokeStaticOrDirect());
   DCHECK_EQ(invoke->GetInvokeType(), InvokeType::kStatic);
   HInstruction* value = invoke->InputAt(0);
@@ -1940,7 +1944,7 @@
     // Unconditionally set the type of the negated distance to `int`,
     // as shift and rotate operations expect a 32-bit (or narrower)
     // value for their distance input.
-    distance = new (GetGraph()->GetArena()) HNeg(Primitive::kPrimInt, distance);
+    distance = new (GetGraph()->GetArena()) HNeg(DataType::Type::kInt32, distance);
     invoke->GetBlock()->InsertInstructionBefore(distance, invoke);
   }
   HRor* ror = new (GetGraph()->GetArena()) HRor(type, value, distance);
@@ -1993,8 +1997,8 @@
 
   {
     ScopedObjectAccess soa(Thread::Current());
-    Primitive::Type source_component_type = Primitive::kPrimVoid;
-    Primitive::Type destination_component_type = Primitive::kPrimVoid;
+    DataType::Type source_component_type = DataType::Type::kVoid;
+    DataType::Type destination_component_type = DataType::Type::kVoid;
     ReferenceTypeInfo destination_rti = destination->GetReferenceTypeInfo();
     if (destination_rti.IsValid()) {
       if (destination_rti.IsObjectArray()) {
@@ -2004,8 +2008,8 @@
         optimizations.SetDestinationIsTypedObjectArray();
       }
       if (destination_rti.IsPrimitiveArrayClass()) {
-        destination_component_type =
-            destination_rti.GetTypeHandle()->GetComponentType()->GetPrimitiveType();
+        destination_component_type = DataTypeFromPrimitive(
+            destination_rti.GetTypeHandle()->GetComponentType()->GetPrimitiveType());
         optimizations.SetDestinationIsPrimitiveArray();
       } else if (destination_rti.IsNonPrimitiveArrayClass()) {
         optimizations.SetDestinationIsNonPrimitiveArray();
@@ -2018,13 +2022,14 @@
       }
       if (source_rti.IsPrimitiveArrayClass()) {
         optimizations.SetSourceIsPrimitiveArray();
-        source_component_type = source_rti.GetTypeHandle()->GetComponentType()->GetPrimitiveType();
+        source_component_type = DataTypeFromPrimitive(
+            source_rti.GetTypeHandle()->GetComponentType()->GetPrimitiveType());
       } else if (source_rti.IsNonPrimitiveArrayClass()) {
         optimizations.SetSourceIsNonPrimitiveArray();
       }
     }
     // For primitive arrays, use their optimized ArtMethod implementations.
-    if ((source_component_type != Primitive::kPrimVoid) &&
+    if ((source_component_type != DataType::Type::kVoid) &&
         (source_component_type == destination_component_type)) {
       ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
       PointerSize image_size = class_linker->GetImagePointerSize();
@@ -2032,28 +2037,28 @@
       mirror::Class* system = invoke->GetResolvedMethod()->GetDeclaringClass();
       ArtMethod* method = nullptr;
       switch (source_component_type) {
-        case Primitive::kPrimBoolean:
+        case DataType::Type::kBool:
           method = system->FindClassMethod("arraycopy", "([ZI[ZII)V", image_size);
           break;
-        case Primitive::kPrimByte:
+        case DataType::Type::kInt8:
           method = system->FindClassMethod("arraycopy", "([BI[BII)V", image_size);
           break;
-        case Primitive::kPrimChar:
+        case DataType::Type::kUint16:
           method = system->FindClassMethod("arraycopy", "([CI[CII)V", image_size);
           break;
-        case Primitive::kPrimShort:
+        case DataType::Type::kInt16:
           method = system->FindClassMethod("arraycopy", "([SI[SII)V", image_size);
           break;
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           method = system->FindClassMethod("arraycopy", "([II[III)V", image_size);
           break;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           method = system->FindClassMethod("arraycopy", "([FI[FII)V", image_size);
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           method = system->FindClassMethod("arraycopy", "([JI[JII)V", image_size);
           break;
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           method = system->FindClassMethod("arraycopy", "([DI[DII)V", image_size);
           break;
         default:
@@ -2074,14 +2079,14 @@
 
 void InstructionSimplifierVisitor::SimplifyCompare(HInvoke* invoke,
                                                    bool is_signum,
-                                                   Primitive::Type type) {
+                                                   DataType::Type type) {
   DCHECK(invoke->IsInvokeStaticOrDirect());
   uint32_t dex_pc = invoke->GetDexPc();
   HInstruction* left = invoke->InputAt(0);
   HInstruction* right;
   if (!is_signum) {
     right = invoke->InputAt(1);
-  } else if (type == Primitive::kPrimLong) {
+  } else if (type == DataType::Type::kInt64) {
     right = GetGraph()->GetLongConstant(0);
   } else {
     right = GetGraph()->GetIntConstant(0);
@@ -2105,17 +2110,17 @@
   DCHECK(invoke->IsInvokeStaticOrDirect());
   uint32_t dex_pc = invoke->GetDexPc();
   HInstruction* x = invoke->InputAt(0);
-  Primitive::Type type = x->GetType();
+  DataType::Type type = x->GetType();
   // Set proper bit pattern for NaN and replace intrinsic with raw version.
   HInstruction* nan;
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     nan = GetGraph()->GetLongConstant(0x7ff8000000000000L);
     invoke->SetIntrinsic(Intrinsics::kDoubleDoubleToRawLongBits,
                          kNeedsEnvironmentOrCache,
                          kNoSideEffects,
                          kNoThrow);
   } else {
-    DCHECK_EQ(type, Primitive::kPrimFloat);
+    DCHECK_EQ(type, DataType::Type::kFloat32);
     nan = GetGraph()->GetIntConstant(0x7fc00000);
     invoke->SetIntrinsic(Intrinsics::kFloatFloatToRawIntBits,
                          kNeedsEnvironmentOrCache,
@@ -2145,7 +2150,7 @@
       index, length, dex_pc, invoke->GetDexMethodIndex());
   invoke->GetBlock()->InsertInstructionBefore(bounds_check, invoke);
   HArrayGet* array_get = new (arena) HArrayGet(
-      str, bounds_check, Primitive::kPrimChar, dex_pc, /* is_string_char_at */ true);
+      str, bounds_check, DataType::Type::kUint16, dex_pc, /* is_string_char_at */ true);
   invoke->GetBlock()->ReplaceAndRemoveInstructionWith(invoke, array_get);
   bounds_check->CopyEnvironmentFrom(invoke->GetEnvironment());
   GetGraph()->SetHasBoundsChecks(true);
@@ -2248,28 +2253,28 @@
       SimplifySystemArrayCopy(instruction);
       break;
     case Intrinsics::kIntegerRotateRight:
-      SimplifyRotate(instruction, /* is_left */ false, Primitive::kPrimInt);
+      SimplifyRotate(instruction, /* is_left */ false, DataType::Type::kInt32);
       break;
     case Intrinsics::kLongRotateRight:
-      SimplifyRotate(instruction, /* is_left */ false, Primitive::kPrimLong);
+      SimplifyRotate(instruction, /* is_left */ false, DataType::Type::kInt64);
       break;
     case Intrinsics::kIntegerRotateLeft:
-      SimplifyRotate(instruction, /* is_left */ true, Primitive::kPrimInt);
+      SimplifyRotate(instruction, /* is_left */ true, DataType::Type::kInt32);
       break;
     case Intrinsics::kLongRotateLeft:
-      SimplifyRotate(instruction, /* is_left */ true, Primitive::kPrimLong);
+      SimplifyRotate(instruction, /* is_left */ true, DataType::Type::kInt64);
       break;
     case Intrinsics::kIntegerCompare:
-      SimplifyCompare(instruction, /* is_signum */ false, Primitive::kPrimInt);
+      SimplifyCompare(instruction, /* is_signum */ false, DataType::Type::kInt32);
       break;
     case Intrinsics::kLongCompare:
-      SimplifyCompare(instruction, /* is_signum */ false, Primitive::kPrimLong);
+      SimplifyCompare(instruction, /* is_signum */ false, DataType::Type::kInt64);
       break;
     case Intrinsics::kIntegerSignum:
-      SimplifyCompare(instruction, /* is_signum */ true, Primitive::kPrimInt);
+      SimplifyCompare(instruction, /* is_signum */ true, DataType::Type::kInt32);
       break;
     case Intrinsics::kLongSignum:
-      SimplifyCompare(instruction, /* is_signum */ true, Primitive::kPrimLong);
+      SimplifyCompare(instruction, /* is_signum */ true, DataType::Type::kInt64);
       break;
     case Intrinsics::kFloatIsNaN:
     case Intrinsics::kDoubleIsNaN:
@@ -2337,7 +2342,7 @@
     HBinaryOperation* instruction) {
   DCHECK(instruction->IsCommutative());
 
-  if (!Primitive::IsIntegralType(instruction->GetType())) {
+  if (!DataType::IsIntegralType(instruction->GetType())) {
     return false;
   }
 
@@ -2387,12 +2392,12 @@
 }
 
 // Helper function that performs addition statically, considering the result type.
-static int64_t ComputeAddition(Primitive::Type type, int64_t x, int64_t y) {
+static int64_t ComputeAddition(DataType::Type type, int64_t x, int64_t y) {
   // Use the Compute() method for consistency with TryStaticEvaluation().
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     return HAdd::Compute<int32_t>(x, y);
   } else {
-    DCHECK_EQ(type, Primitive::kPrimLong);
+    DCHECK_EQ(type, DataType::Type::kInt64);
     return HAdd::Compute<int64_t>(x, y);
   }
 }
@@ -2414,8 +2419,8 @@
     HBinaryOperation* instruction) {
   DCHECK(instruction->IsAdd() || instruction->IsSub()) << instruction->DebugName();
 
-  Primitive::Type type = instruction->GetType();
-  if (!Primitive::IsIntegralType(type)) {
+  DataType::Type type = instruction->GetType();
+  if (!DataType::IsIntegralType(type)) {
     return false;
   }
 
diff --git a/compiler/optimizing/instruction_simplifier_arm.cc b/compiler/optimizing/instruction_simplifier_arm.cc
index a32d0ce..efd7cb4 100644
--- a/compiler/optimizing/instruction_simplifier_arm.cc
+++ b/compiler/optimizing/instruction_simplifier_arm.cc
@@ -38,8 +38,8 @@
   DCHECK(CanFitInShifterOperand(bitfield_op));
   DCHECK(!bitfield_op->HasEnvironmentUses());
 
-  Primitive::Type type = use->GetType();
-  if (type != Primitive::kPrimInt && type != Primitive::kPrimLong) {
+  DataType::Type type = use->GetType();
+  if (type != DataType::Type::kInt32 && type != DataType::Type::kInt64) {
     return false;
   }
 
@@ -70,17 +70,17 @@
   int shift_amount = 0;
 
   HDataProcWithShifterOp::GetOpInfoFromInstruction(bitfield_op, &op_kind, &shift_amount);
-  shift_amount &= use->GetType() == Primitive::kPrimInt
+  shift_amount &= use->GetType() == DataType::Type::kInt32
       ? kMaxIntShiftDistance
       : kMaxLongShiftDistance;
 
   if (HDataProcWithShifterOp::IsExtensionOp(op_kind)) {
-    if (!use->IsAdd() && (!use->IsSub() || use->GetType() != Primitive::kPrimLong)) {
+    if (!use->IsAdd() && (!use->IsSub() || use->GetType() != DataType::Type::kInt64)) {
       return false;
     }
   // Shift by 1 is a special case that results in the same number and type of instructions
   // as this simplification, but potentially shorter code.
-  } else if (type == Primitive::kPrimLong && shift_amount == 1) {
+  } else if (type == DataType::Type::kInt64 && shift_amount == 1) {
     return false;
   }
 
@@ -143,7 +143,7 @@
 
 void InstructionSimplifierArmVisitor::VisitArrayGet(HArrayGet* instruction) {
   size_t data_offset = CodeGenerator::GetArrayDataOffset(instruction);
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
 
   // TODO: Implement reading (length + compression) for String compression feature from
   // negative offset (count_offset - data_offset). Thumb2Assembler (now removed) did
@@ -153,9 +153,9 @@
     return;
   }
 
-  if (type == Primitive::kPrimLong
-      || type == Primitive::kPrimFloat
-      || type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kInt64
+      || type == DataType::Type::kFloat32
+      || type == DataType::Type::kFloat64) {
     // T32 doesn't support ShiftedRegOffset mem address mode for these types
     // to enable optimization.
     return;
@@ -170,13 +170,13 @@
 }
 
 void InstructionSimplifierArmVisitor::VisitArraySet(HArraySet* instruction) {
-  size_t access_size = Primitive::ComponentSize(instruction->GetComponentType());
+  size_t access_size = DataType::Size(instruction->GetComponentType());
   size_t data_offset = mirror::Array::DataOffset(access_size).Uint32Value();
-  Primitive::Type type = instruction->GetComponentType();
+  DataType::Type type = instruction->GetComponentType();
 
-  if (type == Primitive::kPrimLong
-      || type == Primitive::kPrimFloat
-      || type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kInt64
+      || type == DataType::Type::kFloat32
+      || type == DataType::Type::kFloat64) {
     // T32 doesn't support ShiftedRegOffset mem address mode for these types
     // to enable optimization.
     return;
@@ -215,15 +215,15 @@
 }
 
 void InstructionSimplifierArmVisitor::VisitTypeConversion(HTypeConversion* instruction) {
-  Primitive::Type result_type = instruction->GetResultType();
-  Primitive::Type input_type = instruction->GetInputType();
+  DataType::Type result_type = instruction->GetResultType();
+  DataType::Type input_type = instruction->GetInputType();
 
   if (input_type == result_type) {
     // We let the arch-independent code handle this.
     return;
   }
 
-  if (Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type)) {
+  if (DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type)) {
     TryMergeIntoUsersShifterOperand(instruction);
   }
 }
diff --git a/compiler/optimizing/instruction_simplifier_arm64.cc b/compiler/optimizing/instruction_simplifier_arm64.cc
index 7c9bfb1..1c3b79d 100644
--- a/compiler/optimizing/instruction_simplifier_arm64.cc
+++ b/compiler/optimizing/instruction_simplifier_arm64.cc
@@ -38,8 +38,8 @@
   DCHECK(CanFitInShifterOperand(bitfield_op));
   DCHECK(!bitfield_op->HasEnvironmentUses());
 
-  Primitive::Type type = use->GetType();
-  if (type != Primitive::kPrimInt && type != Primitive::kPrimLong) {
+  DataType::Type type = use->GetType();
+  if (type != DataType::Type::kInt32 && type != DataType::Type::kInt64) {
     return false;
   }
 
@@ -150,7 +150,7 @@
 }
 
 void InstructionSimplifierArm64Visitor::VisitArraySet(HArraySet* instruction) {
-  size_t access_size = Primitive::ComponentSize(instruction->GetComponentType());
+  size_t access_size = DataType::Size(instruction->GetComponentType());
   size_t data_offset = mirror::Array::DataOffset(access_size).Uint32Value();
   if (TryExtractArrayAccessAddress(instruction,
                                    instruction->GetArray(),
@@ -185,15 +185,15 @@
 }
 
 void InstructionSimplifierArm64Visitor::VisitTypeConversion(HTypeConversion* instruction) {
-  Primitive::Type result_type = instruction->GetResultType();
-  Primitive::Type input_type = instruction->GetInputType();
+  DataType::Type result_type = instruction->GetResultType();
+  DataType::Type input_type = instruction->GetInputType();
 
   if (input_type == result_type) {
     // We let the arch-independent code handle this.
     return;
   }
 
-  if (Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type)) {
+  if (DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type)) {
     TryMergeIntoUsersShifterOperand(instruction);
   }
 }
diff --git a/compiler/optimizing/instruction_simplifier_shared.cc b/compiler/optimizing/instruction_simplifier_shared.cc
index 7a759b9..73d866f 100644
--- a/compiler/optimizing/instruction_simplifier_shared.cc
+++ b/compiler/optimizing/instruction_simplifier_shared.cc
@@ -25,7 +25,7 @@
 bool TrySimpleMultiplyAccumulatePatterns(HMul* mul,
                                          HBinaryOperation* input_binop,
                                          HInstruction* input_other) {
-  DCHECK(Primitive::IsIntOrLongType(mul->GetType()));
+  DCHECK(DataType::IsIntOrLongType(mul->GetType()));
   DCHECK(input_binop->IsAdd() || input_binop->IsSub());
   DCHECK_NE(input_binop, input_other);
   if (!input_binop->HasOnlyOneNonEnvironmentUse()) {
@@ -88,16 +88,16 @@
 }  // namespace
 
 bool TryCombineMultiplyAccumulate(HMul* mul, InstructionSet isa) {
-  Primitive::Type type = mul->GetType();
+  DataType::Type type = mul->GetType();
   switch (isa) {
     case kArm:
     case kThumb2:
-      if (type != Primitive::kPrimInt) {
+      if (type != DataType::Type::kInt32) {
         return false;
       }
       break;
     case kArm64:
-      if (!Primitive::IsIntOrLongType(type)) {
+      if (!DataType::IsIntOrLongType(type)) {
         return false;
       }
       break;
@@ -240,13 +240,13 @@
     return false;
   }
   if (access->IsArraySet() &&
-      access->AsArraySet()->GetValue()->GetType() == Primitive::kPrimNot) {
+      access->AsArraySet()->GetValue()->GetType() == DataType::Type::kReference) {
     // The access may require a runtime call or the original array pointer.
     return false;
   }
   if (kEmitCompilerReadBarrier &&
       access->IsArrayGet() &&
-      access->GetType() == Primitive::kPrimNot) {
+      access->GetType() == DataType::Type::kReference) {
     // For object arrays, the read barrier instrumentation requires
     // the original array pointer.
     // TODO: This can be relaxed for Baker CC.
@@ -290,10 +290,10 @@
 
   HGraph* graph = access->GetBlock()->GetGraph();
   ArenaAllocator* arena = graph->GetArena();
-  Primitive::Type packed_type = access->GetPackedType();
+  DataType::Type packed_type = access->GetPackedType();
   uint32_t data_offset = mirror::Array::DataOffset(
-      Primitive::ComponentSize(packed_type)).Uint32Value();
-  size_t component_shift = Primitive::ComponentSizeShift(packed_type);
+      DataType::Size(packed_type)).Uint32Value();
+  size_t component_shift = DataType::SizeShift(packed_type);
 
   bool is_extracting_beneficial = false;
   // It is beneficial to extract index intermediate address only if there are at least 2 users.
@@ -301,10 +301,10 @@
     HInstruction* user = use.GetUser();
     if (user->IsVecMemoryOperation() && user != access) {
       HVecMemoryOperation* another_access = user->AsVecMemoryOperation();
-      Primitive::Type another_packed_type = another_access->GetPackedType();
+      DataType::Type another_packed_type = another_access->GetPackedType();
       uint32_t another_data_offset = mirror::Array::DataOffset(
-          Primitive::ComponentSize(another_packed_type)).Uint32Value();
-      size_t another_component_shift = Primitive::ComponentSizeShift(another_packed_type);
+          DataType::Size(another_packed_type)).Uint32Value();
+      size_t another_component_shift = DataType::SizeShift(another_packed_type);
       if (another_data_offset == data_offset && another_component_shift == component_shift) {
         is_extracting_beneficial = true;
         break;
diff --git a/compiler/optimizing/instruction_simplifier_shared.h b/compiler/optimizing/instruction_simplifier_shared.h
index 31e2383..b016a87 100644
--- a/compiler/optimizing/instruction_simplifier_shared.h
+++ b/compiler/optimizing/instruction_simplifier_shared.h
@@ -26,10 +26,10 @@
 inline bool CanFitInShifterOperand(HInstruction* instruction) {
   if (instruction->IsTypeConversion()) {
     HTypeConversion* conversion = instruction->AsTypeConversion();
-    Primitive::Type result_type = conversion->GetResultType();
-    Primitive::Type input_type = conversion->GetInputType();
+    DataType::Type result_type = conversion->GetResultType();
+    DataType::Type input_type = conversion->GetInputType();
     // We don't expect to see the same type as input and result.
-    return Primitive::IsIntegralType(result_type) && Primitive::IsIntegralType(input_type) &&
+    return DataType::IsIntegralType(result_type) && DataType::IsIntegralType(input_type) &&
         (result_type != input_type);
   } else {
     return (instruction->IsShl() && instruction->AsShl()->InputAt(1)->IsIntConstant()) ||
diff --git a/compiler/optimizing/intrinsics_arm64.cc b/compiler/optimizing/intrinsics_arm64.cc
index 96efe7f..75a1ce7 100644
--- a/compiler/optimizing/intrinsics_arm64.cc
+++ b/compiler/optimizing/intrinsics_arm64.cc
@@ -76,16 +76,16 @@
 #define __ codegen->GetVIXLAssembler()->
 
 static void MoveFromReturnRegister(Location trg,
-                                   Primitive::Type type,
+                                   DataType::Type type,
                                    CodeGeneratorARM64* codegen) {
   if (!trg.IsValid()) {
-    DCHECK(type == Primitive::kPrimVoid);
+    DCHECK(type == DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
-  if (Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) {
+  if (DataType::IsIntegralType(type) || type == DataType::Type::kReference) {
     Register trg_reg = RegisterFrom(trg, type);
     Register res_reg = RegisterFrom(ARM64ReturnLocation(type), type);
     __ Mov(trg_reg, res_reg, kDiscardForSameWReg);
@@ -173,7 +173,7 @@
     DCHECK(instruction_->GetLocations()->Intrinsified());
     DCHECK_EQ(instruction_->AsInvoke()->GetIntrinsic(), Intrinsics::kSystemArrayCopy);
 
-    const int32_t element_size = Primitive::ComponentSize(Primitive::kPrimNot);
+    const int32_t element_size = DataType::Size(DataType::Type::kReference);
 
     Register src_curr_addr = XRegisterFrom(locations->GetTemp(0));
     Register dst_curr_addr = XRegisterFrom(locations->GetTemp(1));
@@ -303,18 +303,18 @@
 }
 
 static void GenReverseBytes(LocationSummary* locations,
-                            Primitive::Type type,
+                            DataType::Type type,
                             MacroAssembler* masm) {
   Location in = locations->InAt(0);
   Location out = locations->Out();
 
   switch (type) {
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ Rev16(WRegisterFrom(out), WRegisterFrom(in));
       __ Sxth(WRegisterFrom(out), WRegisterFrom(out));
       break;
-    case Primitive::kPrimInt:
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt32:
+    case DataType::Type::kInt64:
       __ Rev(RegisterFrom(out, type), RegisterFrom(in, type));
       break;
     default:
@@ -328,7 +328,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimInt, GetVIXLAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongReverseBytes(HInvoke* invoke) {
@@ -336,7 +336,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimLong, GetVIXLAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt64, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitShortReverseBytes(HInvoke* invoke) {
@@ -344,7 +344,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitShortReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimShort, GetVIXLAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt16, GetVIXLAssembler());
 }
 
 static void CreateIntIntToIntLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -357,9 +357,9 @@
 }
 
 static void GenNumberOfLeadingZeros(LocationSummary* locations,
-                                    Primitive::Type type,
+                                    DataType::Type type,
                                     MacroAssembler* masm) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   Location in = locations->InAt(0);
   Location out = locations->Out();
@@ -372,7 +372,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerNumberOfLeadingZeros(HInvoke* invoke) {
-  GenNumberOfLeadingZeros(invoke->GetLocations(), Primitive::kPrimInt, GetVIXLAssembler());
+  GenNumberOfLeadingZeros(invoke->GetLocations(), DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongNumberOfLeadingZeros(HInvoke* invoke) {
@@ -380,13 +380,13 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongNumberOfLeadingZeros(HInvoke* invoke) {
-  GenNumberOfLeadingZeros(invoke->GetLocations(), Primitive::kPrimLong, GetVIXLAssembler());
+  GenNumberOfLeadingZeros(invoke->GetLocations(), DataType::Type::kInt64, GetVIXLAssembler());
 }
 
 static void GenNumberOfTrailingZeros(LocationSummary* locations,
-                                     Primitive::Type type,
+                                     DataType::Type type,
                                      MacroAssembler* masm) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   Location in = locations->InAt(0);
   Location out = locations->Out();
@@ -400,7 +400,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerNumberOfTrailingZeros(HInvoke* invoke) {
-  GenNumberOfTrailingZeros(invoke->GetLocations(), Primitive::kPrimInt, GetVIXLAssembler());
+  GenNumberOfTrailingZeros(invoke->GetLocations(), DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongNumberOfTrailingZeros(HInvoke* invoke) {
@@ -408,13 +408,13 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongNumberOfTrailingZeros(HInvoke* invoke) {
-  GenNumberOfTrailingZeros(invoke->GetLocations(), Primitive::kPrimLong, GetVIXLAssembler());
+  GenNumberOfTrailingZeros(invoke->GetLocations(), DataType::Type::kInt64, GetVIXLAssembler());
 }
 
 static void GenReverse(LocationSummary* locations,
-                       Primitive::Type type,
+                       DataType::Type type,
                        MacroAssembler* masm) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   Location in = locations->InAt(0);
   Location out = locations->Out();
@@ -427,7 +427,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerReverse(HInvoke* invoke) {
-  GenReverse(invoke->GetLocations(), Primitive::kPrimInt, GetVIXLAssembler());
+  GenReverse(invoke->GetLocations(), DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongReverse(HInvoke* invoke) {
@@ -435,19 +435,19 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongReverse(HInvoke* invoke) {
-  GenReverse(invoke->GetLocations(), Primitive::kPrimLong, GetVIXLAssembler());
+  GenReverse(invoke->GetLocations(), DataType::Type::kInt64, GetVIXLAssembler());
 }
 
-static void GenBitCount(HInvoke* instr, Primitive::Type type, MacroAssembler* masm) {
-  DCHECK(Primitive::IsIntOrLongType(type)) << type;
-  DCHECK_EQ(instr->GetType(), Primitive::kPrimInt);
-  DCHECK_EQ(Primitive::PrimitiveKind(instr->InputAt(0)->GetType()), type);
+static void GenBitCount(HInvoke* instr, DataType::Type type, MacroAssembler* masm) {
+  DCHECK(DataType::IsIntOrLongType(type)) << type;
+  DCHECK_EQ(instr->GetType(), DataType::Type::kInt32);
+  DCHECK_EQ(DataType::Kind(instr->InputAt(0)->GetType()), type);
 
   UseScratchRegisterScope temps(masm);
 
   Register src = InputRegisterAt(instr, 0);
   Register dst = RegisterFrom(instr->GetLocations()->Out(), type);
-  FPRegister fpr = (type == Primitive::kPrimLong) ? temps.AcquireD() : temps.AcquireS();
+  FPRegister fpr = (type == DataType::Type::kInt64) ? temps.AcquireD() : temps.AcquireS();
 
   __ Fmov(fpr, src);
   __ Cnt(fpr.V8B(), fpr.V8B());
@@ -460,7 +460,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongBitCount(HInvoke* invoke) {
-  GenBitCount(invoke, Primitive::kPrimLong, GetVIXLAssembler());
+  GenBitCount(invoke, DataType::Type::kInt64, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitIntegerBitCount(HInvoke* invoke) {
@@ -468,19 +468,19 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerBitCount(HInvoke* invoke) {
-  GenBitCount(invoke, Primitive::kPrimInt, GetVIXLAssembler());
+  GenBitCount(invoke, DataType::Type::kInt32, GetVIXLAssembler());
 }
 
-static void GenHighestOneBit(HInvoke* invoke, Primitive::Type type, MacroAssembler* masm) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+static void GenHighestOneBit(HInvoke* invoke, DataType::Type type, MacroAssembler* masm) {
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   UseScratchRegisterScope temps(masm);
 
   Register src = InputRegisterAt(invoke, 0);
   Register dst = RegisterFrom(invoke->GetLocations()->Out(), type);
-  Register temp = (type == Primitive::kPrimLong) ? temps.AcquireX() : temps.AcquireW();
-  size_t high_bit = (type == Primitive::kPrimLong) ? 63u : 31u;
-  size_t clz_high_bit = (type == Primitive::kPrimLong) ? 6u : 5u;
+  Register temp = (type == DataType::Type::kInt64) ? temps.AcquireX() : temps.AcquireW();
+  size_t high_bit = (type == DataType::Type::kInt64) ? 63u : 31u;
+  size_t clz_high_bit = (type == DataType::Type::kInt64) ? 6u : 5u;
 
   __ Clz(temp, src);
   __ Mov(dst, UINT64_C(1) << high_bit);  // MOV (bitmask immediate)
@@ -493,7 +493,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke, Primitive::kPrimInt, GetVIXLAssembler());
+  GenHighestOneBit(invoke, DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongHighestOneBit(HInvoke* invoke) {
@@ -501,17 +501,17 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke, Primitive::kPrimLong, GetVIXLAssembler());
+  GenHighestOneBit(invoke, DataType::Type::kInt64, GetVIXLAssembler());
 }
 
-static void GenLowestOneBit(HInvoke* invoke, Primitive::Type type, MacroAssembler* masm) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+static void GenLowestOneBit(HInvoke* invoke, DataType::Type type, MacroAssembler* masm) {
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   UseScratchRegisterScope temps(masm);
 
   Register src = InputRegisterAt(invoke, 0);
   Register dst = RegisterFrom(invoke->GetLocations()->Out(), type);
-  Register temp = (type == Primitive::kPrimLong) ? temps.AcquireX() : temps.AcquireW();
+  Register temp = (type == DataType::Type::kInt64) ? temps.AcquireX() : temps.AcquireW();
 
   __ Neg(temp, src);
   __ And(dst, temp, src);
@@ -522,7 +522,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitIntegerLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke, Primitive::kPrimInt, GetVIXLAssembler());
+  GenLowestOneBit(invoke, DataType::Type::kInt32, GetVIXLAssembler());
 }
 
 void IntrinsicLocationsBuilderARM64::VisitLongLowestOneBit(HInvoke* invoke) {
@@ -530,7 +530,7 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitLongLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke, Primitive::kPrimLong, GetVIXLAssembler());
+  GenLowestOneBit(invoke, DataType::Type::kInt64, GetVIXLAssembler());
 }
 
 static void CreateFPToFPLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -902,18 +902,18 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitThreadCurrentThread(HInvoke* invoke) {
-  codegen_->Load(Primitive::kPrimNot, WRegisterFrom(invoke->GetLocations()->Out()),
+  codegen_->Load(DataType::Type::kReference, WRegisterFrom(invoke->GetLocations()->Out()),
                  MemOperand(tr, Thread::PeerOffset<kArm64PointerSize>().Int32Value()));
 }
 
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          CodeGeneratorARM64* codegen) {
   LocationSummary* locations = invoke->GetLocations();
-  DCHECK((type == Primitive::kPrimInt) ||
-         (type == Primitive::kPrimLong) ||
-         (type == Primitive::kPrimNot));
+  DCHECK((type == DataType::Type::kInt32) ||
+         (type == DataType::Type::kInt64) ||
+         (type == DataType::Type::kReference));
   Location base_loc = locations->InAt(1);
   Register base = WRegisterFrom(base_loc);      // Object pointer.
   Location offset_loc = locations->InAt(2);
@@ -921,7 +921,7 @@
   Location trg_loc = locations->Out();
   Register trg = RegisterFrom(trg_loc, type);
 
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // UnsafeGetObject/UnsafeGetObjectVolatile with Baker's read barrier case.
     Register temp = WRegisterFrom(locations->GetTemp(0));
     codegen->GenerateReferenceLoadWithBakerReadBarrier(invoke,
@@ -942,7 +942,7 @@
       codegen->Load(type, trg, mem_op);
     }
 
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       DCHECK(trg.IsW());
       codegen->MaybeGenerateReadBarrierSlow(invoke, trg_loc, trg_loc, base_loc, 0u, offset_loc);
     }
@@ -991,22 +991,22 @@
 }
 
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 
 static void CreateIntIntIntIntToVoid(ArenaAllocator* arena, HInvoke* invoke) {
@@ -1048,7 +1048,7 @@
 }
 
 static void GenUnsafePut(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          bool is_ordered,
                          CodeGeneratorARM64* codegen) {
@@ -1066,7 +1066,7 @@
     // freeing the temporary registers so they can be used in `MarkGCCard`.
     UseScratchRegisterScope temps(masm);
 
-    if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+    if (kPoisonHeapReferences && type == DataType::Type::kReference) {
       DCHECK(value.IsW());
       Register temp = temps.AcquireW();
       __ Mov(temp.W(), value.W());
@@ -1081,7 +1081,7 @@
     }
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(base, value, value_can_be_null);
   }
@@ -1089,63 +1089,63 @@
 
 void IntrinsicCodeGeneratorARM64::VisitUnsafePut(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutObject(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutLong(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafePutLongVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke,
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
@@ -1153,7 +1153,7 @@
 
 static void CreateIntIntIntIntIntToInt(ArenaAllocator* arena,
                                        HInvoke* invoke,
-                                       Primitive::Type type) {
+                                       DataType::Type type) {
   bool can_call = kEmitCompilerReadBarrier &&
       kUseBakerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeCASObject);
@@ -1172,17 +1172,17 @@
   // operations to potentially clobber the output. Likewise when
   // emitting a (Baker) read barrier, which may call.
   Location::OutputOverlap overlaps =
-      ((kPoisonHeapReferences && type == Primitive::kPrimNot) || can_call)
+      ((kPoisonHeapReferences && type == DataType::Type::kReference) || can_call)
       ? Location::kOutputOverlap
       : Location::kNoOutputOverlap;
   locations->SetOut(Location::RequiresRegister(), overlaps);
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // Temporary register for (Baker) read barrier.
     locations->AddTemp(Location::RequiresRegister());
   }
 }
 
-static void GenCas(HInvoke* invoke, Primitive::Type type, CodeGeneratorARM64* codegen) {
+static void GenCas(HInvoke* invoke, DataType::Type type, CodeGeneratorARM64* codegen) {
   MacroAssembler* masm = codegen->GetVIXLAssembler();
   LocationSummary* locations = invoke->GetLocations();
 
@@ -1196,7 +1196,7 @@
   Register value = RegisterFrom(locations->InAt(4), type);         // Value.
 
   // This needs to be before the temp registers, as MarkGCCard also uses VIXL temps.
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Mark card for object assuming new value is stored.
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(base, value, value_can_be_null);
@@ -1228,7 +1228,7 @@
 
   __ Add(tmp_ptr, base.X(), Operand(offset));
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     codegen->GetAssembler()->PoisonHeapReference(expected);
     if (value.Is(expected)) {
       // Do not poison `value`, as it is the same register as
@@ -1253,7 +1253,7 @@
   __ Bind(&exit_loop);
   __ Cset(out, eq);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     codegen->GetAssembler()->UnpoisonHeapReference(expected);
     if (value.Is(expected)) {
       // Do not unpoison `value`, as it is the same register as
@@ -1265,10 +1265,10 @@
 }
 
 void IntrinsicLocationsBuilderARM64::VisitUnsafeCASInt(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntIntIntToInt(arena_, invoke, DataType::Type::kInt32);
 }
 void IntrinsicLocationsBuilderARM64::VisitUnsafeCASLong(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntIntIntToInt(arena_, invoke, DataType::Type::kInt64);
 }
 void IntrinsicLocationsBuilderARM64::VisitUnsafeCASObject(HInvoke* invoke) {
   // The only read barrier implementation supporting the
@@ -1277,21 +1277,21 @@
     return;
   }
 
-  CreateIntIntIntIntIntToInt(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntIntIntToInt(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorARM64::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimInt, codegen_);
+  GenCas(invoke, DataType::Type::kInt32, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeCASLong(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimLong, codegen_);
+  GenCas(invoke, DataType::Type::kInt64, codegen_);
 }
 void IntrinsicCodeGeneratorARM64::VisitUnsafeCASObject(HInvoke* invoke) {
   // The only read barrier implementation supporting the
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCas(invoke, Primitive::kPrimNot, codegen_);
+  GenCas(invoke, DataType::Type::kReference, codegen_);
 }
 
 void IntrinsicLocationsBuilderARM64::VisitStringCompareTo(HInvoke* invoke) {
@@ -1397,7 +1397,7 @@
   DCHECK_ALIGNED(value_offset, 8);
   static_assert(IsAligned<8>(kObjectAlignment), "String of odd length is not zero padded");
 
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   // Promote temp2 to an X reg, ready for LDR.
@@ -1457,7 +1457,7 @@
     __ Bind(&different_compression);
 
     // Comparison for different compression style.
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
     temp1 = temp1.W();
     temp2 = temp2.W();
@@ -1731,7 +1731,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     Register char_reg = WRegisterFrom(locations->InAt(1));
     __ Tst(char_reg, 0xFFFF0000);
     slow_path = new (allocator) IntrinsicSlowPathARM64(invoke);
@@ -1762,7 +1762,7 @@
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimInt));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kInt32));
 
   // Need to send start_index=0.
   locations->AddTemp(LocationFrom(calling_convention.GetRegisterAt(2)));
@@ -1783,7 +1783,7 @@
   locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, LocationFrom(calling_convention.GetRegisterAt(2)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimInt));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kInt32));
 }
 
 void IntrinsicCodeGeneratorARM64::VisitStringIndexOfAfter(HInvoke* invoke) {
@@ -1800,7 +1800,7 @@
   locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, LocationFrom(calling_convention.GetRegisterAt(2)));
   locations->SetInAt(3, LocationFrom(calling_convention.GetRegisterAt(3)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void IntrinsicCodeGeneratorARM64::VisitStringNewStringFromBytes(HInvoke* invoke) {
@@ -1826,7 +1826,7 @@
   locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, LocationFrom(calling_convention.GetRegisterAt(2)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void IntrinsicCodeGeneratorARM64::VisitStringNewStringFromChars(HInvoke* invoke) {
@@ -1846,7 +1846,7 @@
                                                             kIntrinsified);
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kReference));
 }
 
 void IntrinsicCodeGeneratorARM64::VisitStringNewStringFromString(HInvoke* invoke) {
@@ -1866,8 +1866,8 @@
 
 static void CreateFPToFPCallLocations(ArenaAllocator* arena, HInvoke* invoke) {
   DCHECK_EQ(invoke->GetNumberOfArguments(), 1U);
-  DCHECK(Primitive::IsFloatingPointType(invoke->InputAt(0)->GetType()));
-  DCHECK(Primitive::IsFloatingPointType(invoke->GetType()));
+  DCHECK(DataType::IsFloatingPointType(invoke->InputAt(0)->GetType()));
+  DCHECK(DataType::IsFloatingPointType(invoke->GetType()));
 
   LocationSummary* const locations = new (arena) LocationSummary(invoke,
                                                                  LocationSummary::kCallOnMainOnly,
@@ -1880,9 +1880,9 @@
 
 static void CreateFPFPToFPCallLocations(ArenaAllocator* arena, HInvoke* invoke) {
   DCHECK_EQ(invoke->GetNumberOfArguments(), 2U);
-  DCHECK(Primitive::IsFloatingPointType(invoke->InputAt(0)->GetType()));
-  DCHECK(Primitive::IsFloatingPointType(invoke->InputAt(1)->GetType()));
-  DCHECK(Primitive::IsFloatingPointType(invoke->GetType()));
+  DCHECK(DataType::IsFloatingPointType(invoke->InputAt(0)->GetType()));
+  DCHECK(DataType::IsFloatingPointType(invoke->InputAt(1)->GetType()));
+  DCHECK(DataType::IsFloatingPointType(invoke->GetType()));
 
   LocationSummary* const locations = new (arena) LocationSummary(invoke,
                                                                  LocationSummary::kCallOnMainOnly,
@@ -2056,7 +2056,7 @@
   LocationSummary* locations = invoke->GetLocations();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   // Location of data in char array buffer.
@@ -2135,7 +2135,7 @@
   __ B(&done);
 
   if (mirror::kUseStringCompression) {
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
     __ Bind(&compressed_string_preloop);
     __ Add(src_ptr, src_ptr, Operand(srcBegin));
@@ -2219,7 +2219,7 @@
       if (!length_is_input_length) {
         // Check that length(input) >= length.
         __ Ldr(temp, MemOperand(input, length_offset));
-        __ Cmp(temp, OperandFrom(length, Primitive::kPrimInt));
+        __ Cmp(temp, OperandFrom(length, DataType::Type::kInt32));
         __ B(slow_path->GetEntryLabel(), lt);
       }
     } else {
@@ -2229,7 +2229,7 @@
       __ B(slow_path->GetEntryLabel(), lt);
 
       // Check that (length(input) - pos) >= length.
-      __ Cmp(temp, OperandFrom(length, Primitive::kPrimInt));
+      __ Cmp(temp, OperandFrom(length, DataType::Type::kInt32));
       __ B(slow_path->GetEntryLabel(), lt);
     }
   } else if (length_is_input_length) {
@@ -2244,7 +2244,7 @@
     __ Ldr(temp, MemOperand(input, length_offset));
     __ Subs(temp, temp, pos_reg);
     // Ccmp if length(input) >= pos, else definitely bail to slow path (N!=V == lt).
-    __ Ccmp(temp, OperandFrom(length, Primitive::kPrimInt), NFlag, ge);
+    __ Ccmp(temp, OperandFrom(length, DataType::Type::kInt32), NFlag, ge);
     __ B(slow_path->GetEntryLabel(), lt);
   }
 }
@@ -2253,7 +2253,7 @@
 // source address for System.arraycopy* intrinsics in `src_base`,
 // `dst_base` and `src_end` respectively.
 static void GenSystemArrayCopyAddresses(MacroAssembler* masm,
-                                        Primitive::Type type,
+                                        DataType::Type type,
                                         const Register& src,
                                         const Location& src_pos,
                                         const Register& dst,
@@ -2263,10 +2263,10 @@
                                         const Register& dst_base,
                                         const Register& src_end) {
   // This routine is used by the SystemArrayCopy and the SystemArrayCopyChar intrinsics.
-  DCHECK(type == Primitive::kPrimNot || type == Primitive::kPrimChar)
+  DCHECK(type == DataType::Type::kReference || type == DataType::Type::kUint16)
       << "Unexpected element type: " << type;
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const int32_t element_size_shift = Primitive::ComponentSizeShift(type);
+  const int32_t element_size = DataType::Size(type);
+  const int32_t element_size_shift = DataType::SizeShift(type);
   const uint32_t data_offset = mirror::Array::DataOffset(element_size).Uint32Value();
 
   if (src_pos.IsConstant()) {
@@ -2353,7 +2353,7 @@
   src_stop_addr = src_stop_addr.X();
 
   GenSystemArrayCopyAddresses(masm,
-                              Primitive::kPrimChar,
+                              DataType::Type::kUint16,
                               src,
                               src_pos,
                               dst,
@@ -2364,7 +2364,7 @@
                               src_stop_addr);
 
   // Iterate over the arrays and do a raw copy of the chars.
-  const int32_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const int32_t char_size = DataType::Size(DataType::Type::kUint16);
   UseScratchRegisterScope temps(masm);
   Register tmp = temps.AcquireW();
   vixl::aarch64::Label loop, done;
@@ -2781,8 +2781,8 @@
       Register dst_curr_addr = temp2.X();
       Register src_stop_addr = temp3.X();
       vixl::aarch64::Label done;
-      const Primitive::Type type = Primitive::kPrimNot;
-      const int32_t element_size = Primitive::ComponentSize(type);
+      const DataType::Type type = DataType::Type::kReference;
+      const int32_t element_size = DataType::Size(type);
 
       if (length.IsRegister()) {
         // Don't enter the copy loop if the length is null.
@@ -2957,7 +2957,7 @@
   IntrinsicVisitor::ComputeIntegerValueOfLocations(
       invoke,
       codegen_,
-      calling_convention.GetReturnLocation(Primitive::kPrimNot),
+      calling_convention.GetReturnLocation(DataType::Type::kReference),
       Location::RegisterLocation(calling_convention.GetRegisterAt(0).GetCode()));
 }
 
@@ -2966,7 +2966,7 @@
   LocationSummary* locations = invoke->GetLocations();
   MacroAssembler* masm = GetVIXLAssembler();
 
-  Register out = RegisterFrom(locations->Out(), Primitive::kPrimNot);
+  Register out = RegisterFrom(locations->Out(), DataType::Type::kReference);
   UseScratchRegisterScope temps(masm);
   Register temp = temps.AcquireW();
   InvokeRuntimeCallingConvention calling_convention;
@@ -2996,7 +2996,7 @@
       codegen_->GenerateMemoryBarrier(MemBarrierKind::kStoreStore);
     }
   } else {
-    Register in = RegisterFrom(locations->InAt(0), Primitive::kPrimInt);
+    Register in = RegisterFrom(locations->InAt(0), DataType::Type::kInt32);
     // Check bounds of our cache.
     __ Add(out.W(), in.W(), -info.low);
     __ Cmp(out.W(), info.high - info.low + 1);
@@ -3007,8 +3007,8 @@
     uint32_t address = dchecked_integral_cast<uint32_t>(reinterpret_cast<uintptr_t>(info.cache));
     __ Ldr(temp.W(), codegen_->DeduplicateBootImageAddressLiteral(data_offset + address));
     MemOperand source = HeapOperand(
-        temp, out.X(), LSL, Primitive::ComponentSizeShift(Primitive::kPrimNot));
-    codegen_->Load(Primitive::kPrimNot, out, source);
+        temp, out.X(), LSL, DataType::SizeShift(DataType::Type::kReference));
+    codegen_->Load(DataType::Type::kReference, out, source);
     codegen_->GetAssembler()->MaybeUnpoisonHeapReference(out);
     __ B(&done);
     __ Bind(&allocate);
@@ -3034,7 +3034,7 @@
 
 void IntrinsicCodeGeneratorARM64::VisitThreadInterrupted(HInvoke* invoke) {
   MacroAssembler* masm = GetVIXLAssembler();
-  Register out = RegisterFrom(invoke->GetLocations()->Out(), Primitive::kPrimInt);
+  Register out = RegisterFrom(invoke->GetLocations()->Out(), DataType::Type::kInt32);
   UseScratchRegisterScope temps(masm);
   Register temp = temps.AcquireX();
 
diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc
index e2494f0..7ce576c 100644
--- a/compiler/optimizing/intrinsics_arm_vixl.cc
+++ b/compiler/optimizing/intrinsics_arm_vixl.cc
@@ -126,16 +126,16 @@
 
 // Compute base address for the System.arraycopy intrinsic in `base`.
 static void GenSystemArrayCopyBaseAddress(ArmVIXLAssembler* assembler,
-                                          Primitive::Type type,
+                                          DataType::Type type,
                                           const vixl32::Register& array,
                                           const Location& pos,
                                           const vixl32::Register& base) {
   // This routine is only used by the SystemArrayCopy intrinsic at the
-  // moment. We can allow Primitive::kPrimNot as `type` to implement
+  // moment. We can allow DataType::Type::kReference as `type` to implement
   // the SystemArrayCopyChar intrinsic.
-  DCHECK_EQ(type, Primitive::kPrimNot);
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const uint32_t element_size_shift = Primitive::ComponentSizeShift(type);
+  DCHECK_EQ(type, DataType::Type::kReference);
+  const int32_t element_size = DataType::Size(type);
+  const uint32_t element_size_shift = DataType::SizeShift(type);
   const uint32_t data_offset = mirror::Array::DataOffset(element_size).Uint32Value();
 
   if (pos.IsConstant()) {
@@ -149,16 +149,16 @@
 
 // Compute end address for the System.arraycopy intrinsic in `end`.
 static void GenSystemArrayCopyEndAddress(ArmVIXLAssembler* assembler,
-                                         Primitive::Type type,
+                                         DataType::Type type,
                                          const Location& copy_length,
                                          const vixl32::Register& base,
                                          const vixl32::Register& end) {
   // This routine is only used by the SystemArrayCopy intrinsic at the
-  // moment. We can allow Primitive::kPrimNot as `type` to implement
+  // moment. We can allow DataType::Type::kReference as `type` to implement
   // the SystemArrayCopyChar intrinsic.
-  DCHECK_EQ(type, Primitive::kPrimNot);
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const uint32_t element_size_shift = Primitive::ComponentSizeShift(type);
+  DCHECK_EQ(type, DataType::Type::kReference);
+  const int32_t element_size = DataType::Size(type);
+  const uint32_t element_size_shift = DataType::SizeShift(type);
 
   if (copy_length.IsConstant()) {
     int32_t constant = Int32ConstantFrom(copy_length);
@@ -188,8 +188,8 @@
     DCHECK(instruction_->GetLocations()->Intrinsified());
     DCHECK_EQ(instruction_->AsInvoke()->GetIntrinsic(), Intrinsics::kSystemArrayCopy);
 
-    Primitive::Type type = Primitive::kPrimNot;
-    const int32_t element_size = Primitive::ComponentSize(type);
+    DataType::Type type = DataType::Type::kReference;
+    const int32_t element_size = DataType::Size(type);
 
     vixl32::Register dest = InputRegisterAt(instruction_, 2);
     Location dest_pos = locations->InAt(3);
@@ -349,16 +349,16 @@
 }
 
 static void GenNumberOfLeadingZeros(HInvoke* invoke,
-                                    Primitive::Type type,
+                                    DataType::Type type,
                                     CodeGeneratorARMVIXL* codegen) {
   ArmVIXLAssembler* assembler = codegen->GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
   Location in = locations->InAt(0);
   vixl32::Register out = RegisterFrom(locations->Out());
 
-  DCHECK((type == Primitive::kPrimInt) || (type == Primitive::kPrimLong));
+  DCHECK((type == DataType::Type::kInt32) || (type == DataType::Type::kInt64));
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     vixl32::Register in_reg_lo = LowRegisterFrom(in);
     vixl32::Register in_reg_hi = HighRegisterFrom(in);
     vixl32::Label end;
@@ -380,7 +380,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitIntegerNumberOfLeadingZeros(HInvoke* invoke) {
-  GenNumberOfLeadingZeros(invoke, Primitive::kPrimInt, codegen_);
+  GenNumberOfLeadingZeros(invoke, DataType::Type::kInt32, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitLongNumberOfLeadingZeros(HInvoke* invoke) {
@@ -388,19 +388,19 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitLongNumberOfLeadingZeros(HInvoke* invoke) {
-  GenNumberOfLeadingZeros(invoke, Primitive::kPrimLong, codegen_);
+  GenNumberOfLeadingZeros(invoke, DataType::Type::kInt64, codegen_);
 }
 
 static void GenNumberOfTrailingZeros(HInvoke* invoke,
-                                     Primitive::Type type,
+                                     DataType::Type type,
                                      CodeGeneratorARMVIXL* codegen) {
-  DCHECK((type == Primitive::kPrimInt) || (type == Primitive::kPrimLong));
+  DCHECK((type == DataType::Type::kInt32) || (type == DataType::Type::kInt64));
 
   ArmVIXLAssembler* assembler = codegen->GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
   vixl32::Register out = RegisterFrom(locations->Out());
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     vixl32::Register in_reg_lo = LowRegisterFrom(locations->InAt(0));
     vixl32::Register in_reg_hi = HighRegisterFrom(locations->InAt(0));
     vixl32::Label end;
@@ -426,7 +426,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitIntegerNumberOfTrailingZeros(HInvoke* invoke) {
-  GenNumberOfTrailingZeros(invoke, Primitive::kPrimInt, codegen_);
+  GenNumberOfTrailingZeros(invoke, DataType::Type::kInt32, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitLongNumberOfTrailingZeros(HInvoke* invoke) {
@@ -434,7 +434,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitLongNumberOfTrailingZeros(HInvoke* invoke) {
-  GenNumberOfTrailingZeros(invoke, Primitive::kPrimLong, codegen_);
+  GenNumberOfTrailingZeros(invoke, DataType::Type::kInt64, codegen_);
 }
 
 static void MathAbsFP(HInvoke* invoke, ArmVIXLAssembler* assembler) {
@@ -963,7 +963,7 @@
 }
 
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          CodeGeneratorARMVIXL* codegen) {
   LocationSummary* locations = invoke->GetLocations();
@@ -975,7 +975,7 @@
   Location trg_loc = locations->Out();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       vixl32::Register trg = RegisterFrom(trg_loc);
       __ Ldr(trg, MemOperand(base, offset));
       if (is_volatile) {
@@ -984,7 +984,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       vixl32::Register trg = RegisterFrom(trg_loc);
       if (kEmitCompilerReadBarrier) {
         if (kUseBakerReadBarrier) {
@@ -1011,7 +1011,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       vixl32::Register trg_lo = LowRegisterFrom(trg_loc);
       vixl32::Register trg_hi = HighRegisterFrom(trg_loc);
       if (is_volatile && !codegen->GetInstructionSetFeatures().HasAtomicLdrdAndStrd()) {
@@ -1036,7 +1036,7 @@
 
 static void CreateIntIntIntToIntLocations(ArenaAllocator* arena,
                                           HInvoke* invoke,
-                                          Primitive::Type type) {
+                                          DataType::Type type) {
   bool can_call = kEmitCompilerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObject ||
        invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObjectVolatile);
@@ -1053,7 +1053,7 @@
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetOut(Location::RequiresRegister(),
                     (can_call ? Location::kOutputOverlap : Location::kNoOutputOverlap));
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // We need a temporary register for the read barrier marking slow
     // path in CodeGeneratorARMVIXL::GenerateReferenceLoadWithBakerReadBarrier.
     locations->AddTemp(Location::RequiresRegister());
@@ -1061,46 +1061,46 @@
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGet(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGetLong(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGetObject(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 
 static void CreateIntIntIntIntToVoid(ArenaAllocator* arena,
                                      const ArmInstructionSetFeatures& features,
-                                     Primitive::Type type,
+                                     DataType::Type type,
                                      bool is_volatile,
                                      HInvoke* invoke) {
   LocationSummary* locations = new (arena) LocationSummary(invoke,
@@ -1111,13 +1111,13 @@
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetInAt(3, Location::RequiresRegister());
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     // Potentially need temps for ldrexd-strexd loop.
     if (is_volatile && !features.HasAtomicLdrdAndStrd()) {
       locations->AddTemp(Location::RequiresRegister());  // Temp_lo.
       locations->AddTemp(Location::RequiresRegister());  // Temp_hi.
     }
-  } else if (type == Primitive::kPrimNot) {
+  } else if (type == DataType::Type::kReference) {
     // Temps for card-marking.
     locations->AddTemp(Location::RequiresRegister());  // Temp.
     locations->AddTemp(Location::RequiresRegister());  // Card.
@@ -1125,38 +1125,44 @@
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePut(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimInt, /* is_volatile */ false, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kInt32, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutOrdered(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimInt, /* is_volatile */ false, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kInt32, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutVolatile(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimInt, /* is_volatile */ true, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kInt32, /* is_volatile */ true, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutObject(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimNot, /* is_volatile */ false, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kReference, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimNot, /* is_volatile */ false, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kReference, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntIntToVoid(arena_, features_, Primitive::kPrimNot, /* is_volatile */ true, invoke);
+  CreateIntIntIntIntToVoid(
+      arena_, features_, DataType::Type::kReference, /* is_volatile */ true, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutLong(HInvoke* invoke) {
   CreateIntIntIntIntToVoid(
-      arena_, features_, Primitive::kPrimLong, /* is_volatile */ false, invoke);
+      arena_, features_, DataType::Type::kInt64, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   CreateIntIntIntIntToVoid(
-      arena_, features_, Primitive::kPrimLong, /* is_volatile */ false, invoke);
+      arena_, features_, DataType::Type::kInt64, /* is_volatile */ false, invoke);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafePutLongVolatile(HInvoke* invoke) {
   CreateIntIntIntIntToVoid(
-      arena_, features_, Primitive::kPrimLong, /* is_volatile */ true, invoke);
+      arena_, features_, DataType::Type::kInt64, /* is_volatile */ true, invoke);
 }
 
 static void GenUnsafePut(LocationSummary* locations,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          bool is_ordered,
                          CodeGeneratorARMVIXL* codegen) {
@@ -1170,7 +1176,7 @@
     __ Dmb(vixl32::ISH);
   }
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     vixl32::Register value_lo = LowRegisterFrom(locations->InAt(3));
     vixl32::Register value_hi = HighRegisterFrom(locations->InAt(3));
     value = value_lo;
@@ -1193,7 +1199,7 @@
   } else {
     value = RegisterFrom(locations->InAt(3));
     vixl32::Register source = value;
-    if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+    if (kPoisonHeapReferences && type == DataType::Type::kReference) {
       vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
       __ Mov(temp, value);
       assembler->PoisonHeapReference(temp);
@@ -1206,7 +1212,7 @@
     __ Dmb(vixl32::ISH);
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
     vixl32::Register card = RegisterFrom(locations->GetTemp(1));
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
@@ -1216,63 +1222,63 @@
 
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePut(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutObject(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutLong(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafePutLongVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
@@ -1280,7 +1286,7 @@
 
 static void CreateIntIntIntIntIntToIntPlusTemps(ArenaAllocator* arena,
                                                 HInvoke* invoke,
-                                                Primitive::Type type) {
+                                                DataType::Type type) {
   bool can_call = kEmitCompilerReadBarrier &&
       kUseBakerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeCASObject);
@@ -1299,7 +1305,7 @@
   // operations to potentially clobber the output. Likewise when
   // emitting a (Baker) read barrier, which may call.
   Location::OutputOverlap overlaps =
-      ((kPoisonHeapReferences && type == Primitive::kPrimNot) || can_call)
+      ((kPoisonHeapReferences && type == DataType::Type::kReference) || can_call)
       ? Location::kOutputOverlap
       : Location::kNoOutputOverlap;
   locations->SetOut(Location::RequiresRegister(), overlaps);
@@ -1311,8 +1317,8 @@
   locations->AddTemp(Location::RequiresRegister());  // Temp 1.
 }
 
-static void GenCas(HInvoke* invoke, Primitive::Type type, CodeGeneratorARMVIXL* codegen) {
-  DCHECK_NE(type, Primitive::kPrimLong);
+static void GenCas(HInvoke* invoke, DataType::Type type, CodeGeneratorARMVIXL* codegen) {
+  DCHECK_NE(type, DataType::Type::kInt64);
 
   ArmVIXLAssembler* assembler = codegen->GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
@@ -1330,7 +1336,7 @@
   vixl32::Register tmp_ptr = RegisterFrom(tmp_ptr_loc);               // Pointer to actual memory.
   vixl32::Register tmp = RegisterFrom(locations->GetTemp(1));         // Value in memory.
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // The only read barrier implementation supporting the
     // UnsafeCASObject intrinsic is the Baker-style read barriers.
     DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
@@ -1362,7 +1368,7 @@
 
   __ Add(tmp_ptr, base, offset);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     codegen->GetAssembler()->PoisonHeapReference(expected);
     if (value.Is(expected)) {
       // Do not poison `value`, as it is the same register as
@@ -1409,7 +1415,7 @@
     __ mov(cc, out, 0);
   }
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     codegen->GetAssembler()->UnpoisonHeapReference(expected);
     if (value.Is(expected)) {
       // Do not unpoison `value`, as it is the same register as
@@ -1421,7 +1427,7 @@
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeCASInt(HInvoke* invoke) {
-  CreateIntIntIntIntIntToIntPlusTemps(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntIntIntToIntPlusTemps(arena_, invoke, DataType::Type::kInt32);
 }
 void IntrinsicLocationsBuilderARMVIXL::VisitUnsafeCASObject(HInvoke* invoke) {
   // The only read barrier implementation supporting the
@@ -1430,17 +1436,17 @@
     return;
   }
 
-  CreateIntIntIntIntIntToIntPlusTemps(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntIntIntToIntPlusTemps(arena_, invoke, DataType::Type::kReference);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimInt, codegen_);
+  GenCas(invoke, DataType::Type::kInt32, codegen_);
 }
 void IntrinsicCodeGeneratorARMVIXL::VisitUnsafeCASObject(HInvoke* invoke) {
   // The only read barrier implementation supporting the
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCas(invoke, Primitive::kPrimNot, codegen_);
+  GenCas(invoke, DataType::Type::kReference, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitStringCompareTo(HInvoke* invoke) {
@@ -1558,7 +1564,7 @@
   static_assert(IsAligned<8>(kObjectAlignment),
                 "String data must be 8-byte aligned for unrolled CompareTo loop.");
 
-  const unsigned char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const unsigned char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
@@ -1645,7 +1651,7 @@
     __ Bind(&different_compression);
 
     // Comparison for different compression style.
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
 
     // We want to free up the temp3, currently holding `str.count`, for comparison.
@@ -1943,7 +1949,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     vixl32::Register char_reg = InputRegisterAt(invoke, 1);
     // 0xffff is not modified immediate but 0x10000 is, so use `>= 0x10000` instead of `> 0xffff`.
     __ Cmp(char_reg, static_cast<uint32_t>(std::numeric_limits<uint16_t>::max()) + 1);
@@ -2450,8 +2456,8 @@
     // Null constant length: not need to emit the loop code at all.
   } else {
     vixl32::Label done;
-    const Primitive::Type type = Primitive::kPrimNot;
-    const int32_t element_size = Primitive::ComponentSize(type);
+    const DataType::Type type = DataType::Type::kReference;
+    const int32_t element_size = DataType::Size(type);
 
     if (length.IsRegister()) {
       // Don't enter the copy loop if the length is null.
@@ -2576,8 +2582,8 @@
   }
 
   DCHECK_EQ(invoke->GetNumberOfArguments(), 1U);
-  DCHECK_EQ(invoke->InputAt(0)->GetType(), Primitive::kPrimDouble);
-  DCHECK_EQ(invoke->GetType(), Primitive::kPrimDouble);
+  DCHECK_EQ(invoke->InputAt(0)->GetType(), DataType::Type::kFloat64);
+  DCHECK_EQ(invoke->GetType(), DataType::Type::kFloat64);
 
   LocationSummary* const locations = new (arena) LocationSummary(invoke,
                                                                  LocationSummary::kCallOnMainOnly,
@@ -2602,9 +2608,9 @@
   }
 
   DCHECK_EQ(invoke->GetNumberOfArguments(), 2U);
-  DCHECK_EQ(invoke->InputAt(0)->GetType(), Primitive::kPrimDouble);
-  DCHECK_EQ(invoke->InputAt(1)->GetType(), Primitive::kPrimDouble);
-  DCHECK_EQ(invoke->GetType(), Primitive::kPrimDouble);
+  DCHECK_EQ(invoke->InputAt(0)->GetType(), DataType::Type::kFloat64);
+  DCHECK_EQ(invoke->InputAt(1)->GetType(), DataType::Type::kFloat64);
+  DCHECK_EQ(invoke->GetType(), DataType::Type::kFloat64);
 
   LocationSummary* const locations = new (arena) LocationSummary(invoke,
                                                                  LocationSummary::kCallOnMainOnly,
@@ -2859,12 +2865,12 @@
   __ Revsh(OutputRegister(invoke), InputRegisterAt(invoke, 0));
 }
 
-static void GenBitCount(HInvoke* instr, Primitive::Type type, ArmVIXLAssembler* assembler) {
-  DCHECK(Primitive::IsIntOrLongType(type)) << type;
-  DCHECK_EQ(instr->GetType(), Primitive::kPrimInt);
-  DCHECK_EQ(Primitive::PrimitiveKind(instr->InputAt(0)->GetType()), type);
+static void GenBitCount(HInvoke* instr, DataType::Type type, ArmVIXLAssembler* assembler) {
+  DCHECK(DataType::IsIntOrLongType(type)) << type;
+  DCHECK_EQ(instr->GetType(), DataType::Type::kInt32);
+  DCHECK_EQ(DataType::Kind(instr->InputAt(0)->GetType()), type);
 
-  bool is_long = type == Primitive::kPrimLong;
+  bool is_long = type == DataType::Type::kInt64;
   LocationSummary* locations = instr->GetLocations();
   Location in = locations->InAt(0);
   vixl32::Register src_0 = is_long ? LowRegisterFrom(in) : RegisterFrom(in);
@@ -2893,7 +2899,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitIntegerBitCount(HInvoke* invoke) {
-  GenBitCount(invoke, Primitive::kPrimInt, GetAssembler());
+  GenBitCount(invoke, DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitLongBitCount(HInvoke* invoke) {
@@ -2901,19 +2907,19 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitLongBitCount(HInvoke* invoke) {
-  GenBitCount(invoke, Primitive::kPrimLong, GetAssembler());
+  GenBitCount(invoke, DataType::Type::kInt64, GetAssembler());
 }
 
 static void GenHighestOneBit(HInvoke* invoke,
-                             Primitive::Type type,
+                             DataType::Type type,
                              CodeGeneratorARMVIXL* codegen) {
-  DCHECK(Primitive::IsIntOrLongType(type));
+  DCHECK(DataType::IsIntOrLongType(type));
 
   ArmVIXLAssembler* assembler = codegen->GetAssembler();
   UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
   const vixl32::Register temp = temps.Acquire();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     LocationSummary* locations = invoke->GetLocations();
     Location in = locations->InAt(0);
     Location out = locations->Out();
@@ -2959,7 +2965,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitIntegerHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke, Primitive::kPrimInt, codegen_);
+  GenHighestOneBit(invoke, DataType::Type::kInt32, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitLongHighestOneBit(HInvoke* invoke) {
@@ -2967,19 +2973,19 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitLongHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke, Primitive::kPrimLong, codegen_);
+  GenHighestOneBit(invoke, DataType::Type::kInt64, codegen_);
 }
 
 static void GenLowestOneBit(HInvoke* invoke,
-                            Primitive::Type type,
+                            DataType::Type type,
                             CodeGeneratorARMVIXL* codegen) {
-  DCHECK(Primitive::IsIntOrLongType(type));
+  DCHECK(DataType::IsIntOrLongType(type));
 
   ArmVIXLAssembler* assembler = codegen->GetAssembler();
   UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
   const vixl32::Register temp = temps.Acquire();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     LocationSummary* locations = invoke->GetLocations();
     Location in = locations->InAt(0);
     Location out = locations->Out();
@@ -3024,7 +3030,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitIntegerLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke, Primitive::kPrimInt, codegen_);
+  GenLowestOneBit(invoke, DataType::Type::kInt32, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitLongLowestOneBit(HInvoke* invoke) {
@@ -3032,7 +3038,7 @@
 }
 
 void IntrinsicCodeGeneratorARMVIXL::VisitLongLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke, Primitive::kPrimLong, codegen_);
+  GenLowestOneBit(invoke, DataType::Type::kInt64, codegen_);
 }
 
 void IntrinsicLocationsBuilderARMVIXL::VisitStringGetCharsNoCheck(HInvoke* invoke) {
@@ -3056,7 +3062,7 @@
   LocationSummary* locations = invoke->GetLocations();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   // Location of data in char array buffer.
@@ -3144,7 +3150,7 @@
   if (mirror::kUseStringCompression) {
     __ B(final_label);
 
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
     // Copy loop for compressed src, copying 1 character (8-bit) to (16-bit) at a time.
     __ Bind(&compressed_string_preloop);
@@ -3285,7 +3291,7 @@
     uint32_t data_offset = mirror::Array::DataOffset(kHeapReferenceSize).Uint32Value();
     uint32_t address = dchecked_integral_cast<uint32_t>(reinterpret_cast<uintptr_t>(info.cache));
     __ Ldr(temp, codegen_->DeduplicateBootImageAddressLiteral(data_offset + address));
-    codegen_->LoadFromShiftedRegOffset(Primitive::kPrimNot, locations->Out(), temp, out);
+    codegen_->LoadFromShiftedRegOffset(DataType::Type::kReference, locations->Out(), temp, out);
     assembler->MaybeUnpoisonHeapReference(out);
     __ B(&done);
     __ Bind(&allocate);
diff --git a/compiler/optimizing/intrinsics_mips.cc b/compiler/optimizing/intrinsics_mips.cc
index fe5579c..8847256 100644
--- a/compiler/optimizing/intrinsics_mips.cc
+++ b/compiler/optimizing/intrinsics_mips.cc
@@ -61,16 +61,16 @@
 #define __ codegen->GetAssembler()->
 
 static void MoveFromReturnRegister(Location trg,
-                                   Primitive::Type type,
+                                   DataType::Type type,
                                    CodeGeneratorMIPS* codegen) {
   if (!trg.IsValid()) {
-    DCHECK_EQ(type, Primitive::kPrimVoid);
+    DCHECK_EQ(type, DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
-  if (Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) {
+  if (DataType::IsIntegralType(type) || type == DataType::Type::kReference) {
     Register trg_reg = trg.AsRegister<Register>();
     if (trg_reg != V0) {
       __ Move(V0, trg_reg);
@@ -78,7 +78,7 @@
   } else {
     FRegister trg_reg = trg.AsFpuRegister<FRegister>();
     if (trg_reg != F0) {
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ MovS(F0, trg_reg);
       } else {
         __ MovD(F0, trg_reg);
@@ -247,17 +247,17 @@
 }
 
 static void GenReverse(LocationSummary* locations,
-                       Primitive::Type type,
+                       DataType::Type type,
                        bool isR2OrNewer,
                        bool isR6,
                        bool reverseBits,
                        MipsAssembler* assembler) {
-  DCHECK(type == Primitive::kPrimShort ||
-         type == Primitive::kPrimInt ||
-         type == Primitive::kPrimLong);
-  DCHECK(type != Primitive::kPrimShort || !reverseBits);
+  DCHECK(type == DataType::Type::kInt16 ||
+         type == DataType::Type::kInt32 ||
+         type == DataType::Type::kInt64);
+  DCHECK(type != DataType::Type::kInt16 || !reverseBits);
 
-  if (type == Primitive::kPrimShort) {
+  if (type == DataType::Type::kInt16) {
     Register in = locations->InAt(0).AsRegister<Register>();
     Register out = locations->Out().AsRegister<Register>();
 
@@ -271,7 +271,7 @@
       __ Srl(out, out, 24);
       __ Or(out, out, TMP);
     }
-  } else if (type == Primitive::kPrimInt) {
+  } else if (type == DataType::Type::kInt32) {
     Register in = locations->InAt(0).AsRegister<Register>();
     Register out = locations->Out().AsRegister<Register>();
 
@@ -316,7 +316,7 @@
         __ Or(out, TMP, out);
       }
     }
-  } else if (type == Primitive::kPrimLong) {
+  } else if (type == DataType::Type::kInt64) {
     Register in_lo = locations->InAt(0).AsRegisterPairLow<Register>();
     Register in_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
     Register out_lo = locations->Out().AsRegisterPairLow<Register>();
@@ -407,7 +407,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitIntegerReverseBytes(HInvoke* invoke) {
   GenReverse(invoke->GetLocations(),
-             Primitive::kPrimInt,
+             DataType::Type::kInt32,
              IsR2OrNewer(),
              IsR6(),
              /* reverseBits */ false,
@@ -421,7 +421,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitLongReverseBytes(HInvoke* invoke) {
   GenReverse(invoke->GetLocations(),
-             Primitive::kPrimLong,
+             DataType::Type::kInt64,
              IsR2OrNewer(),
              IsR6(),
              /* reverseBits */ false,
@@ -435,7 +435,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitShortReverseBytes(HInvoke* invoke) {
   GenReverse(invoke->GetLocations(),
-             Primitive::kPrimShort,
+             DataType::Type::kInt16,
              IsR2OrNewer(),
              IsR6(),
              /* reverseBits */ false,
@@ -584,7 +584,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitIntegerReverse(HInvoke* invoke) {
   GenReverse(invoke->GetLocations(),
-             Primitive::kPrimInt,
+             DataType::Type::kInt32,
              IsR2OrNewer(),
              IsR6(),
              /* reverseBits */ true,
@@ -598,7 +598,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitLongReverse(HInvoke* invoke) {
   GenReverse(invoke->GetLocations(),
-             Primitive::kPrimLong,
+             DataType::Type::kInt64,
              IsR2OrNewer(),
              IsR6(),
              /* reverseBits */ true,
@@ -614,7 +614,7 @@
 }
 
 static void GenBitCount(LocationSummary* locations,
-                        Primitive::Type type,
+                        DataType::Type type,
                         bool isR6,
                         MipsAssembler* assembler) {
   Register out = locations->Out().AsRegister<Register>();
@@ -641,7 +641,7 @@
   // instructions compared to a loop-based algorithm which required 47
   // instructions.
 
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     Register in = locations->InAt(0).AsRegister<Register>();
 
     __ Srl(TMP, in, 1);
@@ -665,7 +665,7 @@
     }
     __ Srl(out, out, 24);
   } else {
-    DCHECK_EQ(type, Primitive::kPrimLong);
+    DCHECK_EQ(type, DataType::Type::kInt64);
     Register in_lo = locations->InAt(0).AsRegisterPairLow<Register>();
     Register in_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
     Register tmp_hi = locations->GetTemp(0).AsRegister<Register>();
@@ -729,7 +729,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitIntegerBitCount(HInvoke* invoke) {
-  GenBitCount(invoke->GetLocations(), Primitive::kPrimInt, IsR6(), GetAssembler());
+  GenBitCount(invoke->GetLocations(), DataType::Type::kInt32, IsR6(), GetAssembler());
 }
 
 // int java.lang.Long.bitCount(int)
@@ -744,7 +744,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitLongBitCount(HInvoke* invoke) {
-  GenBitCount(invoke->GetLocations(), Primitive::kPrimLong, IsR6(), GetAssembler());
+  GenBitCount(invoke->GetLocations(), DataType::Type::kInt64, IsR6(), GetAssembler());
 }
 
 static void MathAbsFP(LocationSummary* locations,
@@ -865,7 +865,7 @@
 
 static void GenMinMaxFP(LocationSummary* locations,
                         bool is_min,
-                        Primitive::Type type,
+                        DataType::Type type,
                         bool is_R6,
                         MipsAssembler* assembler) {
   FRegister out = locations->Out().AsFpuRegister<FRegister>();
@@ -884,7 +884,7 @@
     // returned. This is why there is extra logic preceding the use of
     // the MIPS min.fmt/max.fmt instructions. If either a, or b holds a
     // NaN, return the NaN, otherwise return the min/max.
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ CmpUnD(FTMP, a, b);
       __ Bc1eqz(FTMP, &noNaNs);
 
@@ -907,7 +907,7 @@
         __ MaxD(out, a, b);
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimFloat);
+      DCHECK_EQ(type, DataType::Type::kFloat32);
       __ CmpUnS(FTMP, a, b);
       __ Bc1eqz(FTMP, &noNaNs);
 
@@ -938,16 +938,16 @@
     MipsLabel select;
     MipsLabel done;
 
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ CunD(a, b);
     } else {
-      DCHECK_EQ(type, Primitive::kPrimFloat);
+      DCHECK_EQ(type, DataType::Type::kFloat32);
       __ CunS(a, b);
     }
     __ Bc1f(&ordered);
 
     // a or b (or both) is a NaN. Return one, which is a NaN.
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ CeqD(b, b);
     } else {
       __ CeqS(b, b);
@@ -959,7 +959,7 @@
     // Neither is a NaN.
     // a == b? (-0.0 compares equal with +0.0)
     // If equal, handle zeroes, else compare further.
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ CeqD(a, b);
     } else {
       __ CeqS(a, b);
@@ -967,7 +967,7 @@
     __ Bc1f(&compare);
 
     // a == b either bit for bit or one is -0.0 and the other is +0.0.
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ MoveFromFpuHigh(TMP, a);
       __ MoveFromFpuHigh(AT, b);
     } else {
@@ -983,7 +983,7 @@
       __ And(TMP, TMP, AT);
     }
 
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ Mfc1(AT, a);
       __ Mtc1(AT, out);
       __ MoveToFpuHigh(TMP, out);
@@ -994,7 +994,7 @@
 
     __ Bind(&compare);
 
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       if (is_min) {
         // return (a <= b) ? a : b;
         __ ColeD(a, b);
@@ -1014,7 +1014,7 @@
 
     __ Bind(&select);
 
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ MovtD(out, a);
       __ MovfD(out, b);
     } else {
@@ -1043,7 +1043,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMinDoubleDouble(HInvoke* invoke) {
   GenMinMaxFP(invoke->GetLocations(),
               /* is_min */ true,
-              Primitive::kPrimDouble,
+              DataType::Type::kFloat64,
               IsR6(),
               GetAssembler());
 }
@@ -1056,7 +1056,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMinFloatFloat(HInvoke* invoke) {
   GenMinMaxFP(invoke->GetLocations(),
               /* is_min */ true,
-              Primitive::kPrimFloat,
+              DataType::Type::kFloat32,
               IsR6(),
               GetAssembler());
 }
@@ -1069,7 +1069,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMaxDoubleDouble(HInvoke* invoke) {
   GenMinMaxFP(invoke->GetLocations(),
               /* is_min */ false,
-              Primitive::kPrimDouble,
+              DataType::Type::kFloat64,
               IsR6(),
               GetAssembler());
 }
@@ -1082,7 +1082,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMaxFloatFloat(HInvoke* invoke) {
   GenMinMaxFP(invoke->GetLocations(),
               /* is_min */ false,
-              Primitive::kPrimFloat,
+              DataType::Type::kFloat32,
               IsR6(),
               GetAssembler());
 }
@@ -1098,7 +1098,7 @@
 
 static void GenMinMax(LocationSummary* locations,
                       bool is_min,
-                      Primitive::Type type,
+                      DataType::Type type,
                       bool is_R6,
                       MipsAssembler* assembler) {
   if (is_R6) {
@@ -1125,7 +1125,7 @@
     // as the output register; the else clause also handles the case
     // where the output register is distinct from both the first, and the
     // second input registers.
-    if (type == Primitive::kPrimLong) {
+    if (type == DataType::Type::kInt64) {
       Register a_lo = locations->InAt(0).AsRegisterPairLow<Register>();
       Register a_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
       Register b_lo = locations->InAt(1).AsRegisterPairLow<Register>();
@@ -1168,7 +1168,7 @@
         __ Or(out_hi, out_hi, AT);
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimInt);
+      DCHECK_EQ(type, DataType::Type::kInt32);
       Register a = locations->InAt(0).AsRegister<Register>();
       Register b = locations->InAt(1).AsRegister<Register>();
       Register out = locations->Out().AsRegister<Register>();
@@ -1190,7 +1190,7 @@
       }
     }
   } else {
-    if (type == Primitive::kPrimLong) {
+    if (type == DataType::Type::kInt64) {
       Register a_lo = locations->InAt(0).AsRegisterPairLow<Register>();
       Register a_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
       Register b_lo = locations->InAt(1).AsRegisterPairLow<Register>();
@@ -1234,7 +1234,7 @@
         }
       }
     } else {
-      DCHECK_EQ(type, Primitive::kPrimInt);
+      DCHECK_EQ(type, DataType::Type::kInt32);
       Register a = locations->InAt(0).AsRegister<Register>();
       Register b = locations->InAt(1).AsRegister<Register>();
       Register out = locations->Out().AsRegister<Register>();
@@ -1273,7 +1273,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMinIntInt(HInvoke* invoke) {
   GenMinMax(invoke->GetLocations(),
             /* is_min */ true,
-            Primitive::kPrimInt,
+            DataType::Type::kInt32,
             IsR6(),
             GetAssembler());
 }
@@ -1286,7 +1286,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMinLongLong(HInvoke* invoke) {
   GenMinMax(invoke->GetLocations(),
             /* is_min */ true,
-            Primitive::kPrimLong,
+            DataType::Type::kInt64,
             IsR6(),
             GetAssembler());
 }
@@ -1299,7 +1299,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMaxIntInt(HInvoke* invoke) {
   GenMinMax(invoke->GetLocations(),
             /* is_min */ false,
-            Primitive::kPrimInt,
+            DataType::Type::kInt32,
             IsR6(),
             GetAssembler());
 }
@@ -1312,7 +1312,7 @@
 void IntrinsicCodeGeneratorMIPS::VisitMathMaxLongLong(HInvoke* invoke) {
   GenMinMax(invoke->GetLocations(),
             /* is_min */ false,
-            Primitive::kPrimLong,
+            DataType::Type::kInt64,
             IsR6(),
             GetAssembler());
 }
@@ -1519,7 +1519,7 @@
 
 static void CreateIntIntIntToIntLocations(ArenaAllocator* arena,
                                           HInvoke* invoke,
-                                          Primitive::Type type) {
+                                          DataType::Type type) {
   bool can_call = kEmitCompilerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObject ||
        invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObjectVolatile);
@@ -1536,7 +1536,7 @@
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetOut(Location::RequiresRegister(),
                     (can_call ? Location::kOutputOverlap : Location::kNoOutputOverlap));
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // We need a temporary register for the read barrier marking slow
     // path in InstructionCodeGeneratorMIPS::GenerateReferenceLoadWithBakerReadBarrier.
     locations->AddTemp(Location::RequiresRegister());
@@ -1546,14 +1546,14 @@
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          bool is_R6,
                          CodeGeneratorMIPS* codegen) {
   LocationSummary* locations = invoke->GetLocations();
-  DCHECK((type == Primitive::kPrimInt) ||
-         (type == Primitive::kPrimLong) ||
-         (type == Primitive::kPrimNot)) << type;
+  DCHECK((type == DataType::Type::kInt32) ||
+         (type == DataType::Type::kInt64) ||
+         (type == DataType::Type::kReference)) << type;
   MipsAssembler* assembler = codegen->GetAssembler();
   // Target register.
   Location trg_loc = locations->Out();
@@ -1566,12 +1566,12 @@
   Location offset_loc = locations->InAt(2);
   Register offset_lo = offset_loc.AsRegisterPairLow<Register>();
 
-  if (!(kEmitCompilerReadBarrier && kUseBakerReadBarrier && (type == Primitive::kPrimNot))) {
+  if (!(kEmitCompilerReadBarrier && kUseBakerReadBarrier && (type == DataType::Type::kReference))) {
     __ Addu(TMP, base, offset_lo);
   }
 
   switch (type) {
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       Register trg_lo = trg_loc.AsRegisterPairLow<Register>();
       Register trg_hi = trg_loc.AsRegisterPairHigh<Register>();
       CHECK(!is_volatile);  // TODO: support atomic 8-byte volatile loads.
@@ -1587,7 +1587,7 @@
       break;
     }
 
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register trg = trg_loc.AsRegister<Register>();
       if (is_R6) {
         __ Lw(trg, TMP, 0);
@@ -1601,7 +1601,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       Register trg = trg_loc.AsRegister<Register>();
       if (kEmitCompilerReadBarrier) {
         if (kUseBakerReadBarrier) {
@@ -1657,47 +1657,47 @@
 
 // int sun.misc.Unsafe.getInt(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS::VisitUnsafeGet(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, IsR6(), codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, IsR6(), codegen_);
 }
 
 // int sun.misc.Unsafe.getIntVolatile(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, IsR6(), codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, IsR6(), codegen_);
 }
 
 // long sun.misc.Unsafe.getLong(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS::VisitUnsafeGetLong(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64);
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, IsR6(), codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, IsR6(), codegen_);
 }
 
 // Object sun.misc.Unsafe.getObject(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS::VisitUnsafeGetObject(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, IsR6(), codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, IsR6(), codegen_);
 }
 
 // Object sun.misc.Unsafe.getObjectVolatile(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, IsR6(), codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, IsR6(), codegen_);
 }
 
 static void CreateIntIntIntIntToVoidLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -1713,14 +1713,14 @@
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
 static void GenUnsafePut(LocationSummary* locations,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          bool is_ordered,
                          bool is_R6,
                          CodeGeneratorMIPS* codegen) {
-  DCHECK((type == Primitive::kPrimInt) ||
-         (type == Primitive::kPrimLong) ||
-         (type == Primitive::kPrimNot)) << type;
+  DCHECK((type == DataType::Type::kInt32) ||
+         (type == DataType::Type::kInt64) ||
+         (type == DataType::Type::kReference)) << type;
   MipsAssembler* assembler = codegen->GetAssembler();
   // Object pointer.
   Register base = locations->InAt(1).AsRegister<Register>();
@@ -1733,10 +1733,10 @@
   if (is_volatile || is_ordered) {
     __ Sync(0);
   }
-  if ((type == Primitive::kPrimInt) || (type == Primitive::kPrimNot)) {
+  if ((type == DataType::Type::kInt32) || (type == DataType::Type::kReference)) {
     Register value = locations->InAt(3).AsRegister<Register>();
 
-    if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+    if (kPoisonHeapReferences && type == DataType::Type::kReference) {
       __ PoisonHeapReference(AT, value);
       value = AT;
     }
@@ -1766,7 +1766,7 @@
     __ Sync(0);
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(base, locations->InAt(3).AsRegister<Register>(), value_can_be_null);
   }
@@ -1779,7 +1779,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePut(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ false,
                IsR6(),
@@ -1793,7 +1793,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ true,
                IsR6(),
@@ -1807,7 +1807,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ true,
                /* is_ordered */ false,
                IsR6(),
@@ -1821,7 +1821,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutObject(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ false,
                IsR6(),
@@ -1835,7 +1835,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ true,
                IsR6(),
@@ -1849,7 +1849,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ true,
                /* is_ordered */ false,
                IsR6(),
@@ -1863,7 +1863,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutLong(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ false,
                IsR6(),
@@ -1877,7 +1877,7 @@
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ true,
                IsR6(),
@@ -1908,7 +1908,7 @@
 
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
-static void GenCas(HInvoke* invoke, Primitive::Type type, CodeGeneratorMIPS* codegen) {
+static void GenCas(HInvoke* invoke, DataType::Type type, CodeGeneratorMIPS* codegen) {
   MipsAssembler* assembler = codegen->GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
   bool isR6 = codegen->GetInstructionSetFeatures().IsR6();
@@ -1924,7 +1924,7 @@
   DCHECK_NE(offset_lo, out);
   DCHECK_NE(expected, out);
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // The only read barrier implementation supporting the
     // UnsafeCASObject intrinsic is the Baker-style read barriers.
     DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
@@ -1954,7 +1954,7 @@
   MipsLabel loop_head, exit_loop;
   __ Addu(TMP, base, offset_lo);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     __ PoisonHeapReference(expected);
     // Do not poison `value`, if it is the same register as
     // `expected`, which has just been poisoned.
@@ -1970,7 +1970,7 @@
 
   __ Sync(0);
   __ Bind(&loop_head);
-  if ((type == Primitive::kPrimInt) || (type == Primitive::kPrimNot)) {
+  if ((type == DataType::Type::kInt32) || (type == DataType::Type::kReference)) {
     if (isR6) {
       __ LlR6(out, TMP);
     } else {
@@ -1988,11 +1988,11 @@
                         // in the case that the store fails.  Whether the
                         // store succeeds, or fails, it will load the
                         // correct Boolean value into the 'out' register.
-  // This test isn't really necessary. We only support Primitive::kPrimInt,
-  // Primitive::kPrimNot, and we already verified that we're working on one
+  // This test isn't really necessary. We only support DataType::Type::kInt,
+  // DataType::Type::kReference, and we already verified that we're working on one
   // of those two types. It's left here in case the code needs to support
   // other types in the future.
-  if ((type == Primitive::kPrimInt) || (type == Primitive::kPrimNot)) {
+  if ((type == DataType::Type::kInt32) || (type == DataType::Type::kReference)) {
     if (isR6) {
       __ ScR6(out, TMP);
     } else {
@@ -2004,7 +2004,7 @@
   __ Bind(&exit_loop);
   __ Sync(0);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     __ UnpoisonHeapReference(expected);
     // Do not unpoison `value`, if it is the same register as
     // `expected`, which has just been unpoisoned.
@@ -2020,7 +2020,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimInt, codegen_);
+  GenCas(invoke, DataType::Type::kInt32, codegen_);
 }
 
 // boolean sun.misc.Unsafe.compareAndSwapObject(Object o, long offset, Object expected, Object x)
@@ -2039,7 +2039,7 @@
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCas(invoke, Primitive::kPrimNot, codegen_);
+  GenCas(invoke, DataType::Type::kReference, codegen_);
 }
 
 // int java.lang.String.compareTo(String anotherString)
@@ -2050,7 +2050,7 @@
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 }
 
@@ -2218,7 +2218,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     Register char_reg = locations->InAt(1).AsRegister<Register>();
     // The "bltu" conditional branch tests to see if the character value
     // fits in a valid 16-bit (MIPS halfword) value. If it doesn't then
@@ -2256,7 +2256,7 @@
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 
   // Need a temp for slow-path codepoint compare, and need to send start-index=0.
@@ -2282,7 +2282,7 @@
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 
   // Need a temp for slow-path codepoint compare.
@@ -2307,7 +2307,7 @@
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
   locations->SetInAt(3, Location::RegisterLocation(calling_convention.GetRegisterAt(3)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 }
 
@@ -2332,7 +2332,7 @@
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 }
 
@@ -2353,7 +2353,7 @@
                                                             kIntrinsified);
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<Register>()));
 }
 
@@ -2370,16 +2370,16 @@
 }
 
 static void GenIsInfinite(LocationSummary* locations,
-                          const Primitive::Type type,
+                          const DataType::Type type,
                           const bool isR6,
                           MipsAssembler* assembler) {
   FRegister in = locations->InAt(0).AsFpuRegister<FRegister>();
   Register out = locations->Out().AsRegister<Register>();
 
-  DCHECK(type == Primitive::kPrimFloat || type == Primitive::kPrimDouble);
+  DCHECK(type == DataType::Type::kFloat32 || type == DataType::Type::kFloat64);
 
   if (isR6) {
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
         __ ClassD(FTMP, in);
     } else {
         __ ClassS(FTMP, in);
@@ -2389,7 +2389,7 @@
     __ Sltu(out, ZERO, out);
   } else {
     // If one, or more, of the exponent bits is zero, then the number can't be infinite.
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ MoveFromFpuHigh(TMP, in);
       __ LoadConst32(AT, High32Bits(kPositiveInfinityDouble));
     } else {
@@ -2400,7 +2400,7 @@
 
     __ Sll(TMP, TMP, 1);
 
-    if (type == Primitive::kPrimDouble) {
+    if (type == DataType::Type::kFloat64) {
       __ Mfc1(AT, in);
       __ Or(TMP, TMP, AT);
     }
@@ -2415,7 +2415,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitFloatIsInfinite(HInvoke* invoke) {
-  GenIsInfinite(invoke->GetLocations(), Primitive::kPrimFloat, IsR6(), GetAssembler());
+  GenIsInfinite(invoke->GetLocations(), DataType::Type::kFloat32, IsR6(), GetAssembler());
 }
 
 // boolean java.lang.Double.isInfinite(double)
@@ -2424,16 +2424,16 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitDoubleIsInfinite(HInvoke* invoke) {
-  GenIsInfinite(invoke->GetLocations(), Primitive::kPrimDouble, IsR6(), GetAssembler());
+  GenIsInfinite(invoke->GetLocations(), DataType::Type::kFloat64, IsR6(), GetAssembler());
 }
 
 static void GenHighestOneBit(LocationSummary* locations,
-                             const Primitive::Type type,
+                             const DataType::Type type,
                              bool isR6,
                              MipsAssembler* assembler) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     Register in_lo = locations->InAt(0).AsRegisterPairLow<Register>();
     Register in_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
     Register out_lo = locations->Out().AsRegisterPairLow<Register>();
@@ -2480,7 +2480,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitIntegerHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke->GetLocations(), Primitive::kPrimInt, IsR6(), GetAssembler());
+  GenHighestOneBit(invoke->GetLocations(), DataType::Type::kInt32, IsR6(), GetAssembler());
 }
 
 // long java.lang.Long.highestOneBit(long)
@@ -2489,16 +2489,16 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitLongHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke->GetLocations(), Primitive::kPrimLong, IsR6(), GetAssembler());
+  GenHighestOneBit(invoke->GetLocations(), DataType::Type::kInt64, IsR6(), GetAssembler());
 }
 
 static void GenLowestOneBit(LocationSummary* locations,
-                            const Primitive::Type type,
+                            const DataType::Type type,
                             bool isR6,
                             MipsAssembler* assembler) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     Register in_lo = locations->InAt(0).AsRegisterPairLow<Register>();
     Register in_hi = locations->InAt(0).AsRegisterPairHigh<Register>();
     Register out_lo = locations->Out().AsRegisterPairLow<Register>();
@@ -2528,7 +2528,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitIntegerLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke->GetLocations(), Primitive::kPrimInt, IsR6(), GetAssembler());
+  GenLowestOneBit(invoke->GetLocations(), DataType::Type::kInt32, IsR6(), GetAssembler());
 }
 
 // long java.lang.Long.lowestOneBit(long)
@@ -2537,7 +2537,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS::VisitLongLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke->GetLocations(), Primitive::kPrimLong, IsR6(), GetAssembler());
+  GenLowestOneBit(invoke->GetLocations(), DataType::Type::kInt64, IsR6(), GetAssembler());
 }
 
 // int java.lang.Math.round(float)
@@ -2686,9 +2686,9 @@
   LocationSummary* locations = invoke->GetLocations();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
-  const size_t char_shift = Primitive::ComponentSizeShift(Primitive::kPrimChar);
+  const size_t char_shift = DataType::SizeShift(DataType::Type::kUint16);
 
   Register srcObj = locations->InAt(0).AsRegister<Register>();
   Register srcBegin = locations->InAt(1).AsRegister<Register>();
@@ -2764,7 +2764,7 @@
   InvokeRuntimeCallingConvention calling_convention;
 
   locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimDouble));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kFloat64));
 }
 
 static void CreateFPFPToFPCallLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -2775,7 +2775,7 @@
 
   locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
   locations->SetInAt(1, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(1)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimDouble));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kFloat64));
 }
 
 static void GenFPToFPCall(HInvoke* invoke, CodeGeneratorMIPS* codegen, QuickEntrypointEnum entry) {
@@ -3112,10 +3112,10 @@
 
   // Okay, everything checks out.  Finally time to do the copy.
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
-  const size_t char_shift = Primitive::ComponentSizeShift(Primitive::kPrimChar);
+  const size_t char_shift = DataType::SizeShift(DataType::Type::kUint16);
 
   const uint32_t data_offset = mirror::Array::DataOffset(char_size).Uint32Value();
 
@@ -3154,7 +3154,7 @@
   IntrinsicVisitor::ComputeIntegerValueOfLocations(
       invoke,
       codegen_,
-      calling_convention.GetReturnLocation(Primitive::kPrimNot),
+      calling_convention.GetReturnLocation(DataType::Type::kReference),
       Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
 }
 
diff --git a/compiler/optimizing/intrinsics_mips64.cc b/compiler/optimizing/intrinsics_mips64.cc
index 80448f1..d0234d8 100644
--- a/compiler/optimizing/intrinsics_mips64.cc
+++ b/compiler/optimizing/intrinsics_mips64.cc
@@ -49,16 +49,16 @@
 #define __ codegen->GetAssembler()->
 
 static void MoveFromReturnRegister(Location trg,
-                                   Primitive::Type type,
+                                   DataType::Type type,
                                    CodeGeneratorMIPS64* codegen) {
   if (!trg.IsValid()) {
-    DCHECK_EQ(type, Primitive::kPrimVoid);
+    DCHECK_EQ(type, DataType::Type::kVoid);
     return;
   }
 
-  DCHECK_NE(type, Primitive::kPrimVoid);
+  DCHECK_NE(type, DataType::Type::kVoid);
 
-  if (Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) {
+  if (DataType::IsIntegralType(type) || type == DataType::Type::kReference) {
     GpuRegister trg_reg = trg.AsRegister<GpuRegister>();
     if (trg_reg != V0) {
       __ Move(V0, trg_reg);
@@ -66,7 +66,7 @@
   } else {
     FpuRegister trg_reg = trg.AsFpuRegister<FpuRegister>();
     if (trg_reg != F0) {
-      if (type == Primitive::kPrimFloat) {
+      if (type == DataType::Type::kFloat32) {
         __ MovS(F0, trg_reg);
       } else {
         __ MovD(F0, trg_reg);
@@ -224,21 +224,21 @@
 }
 
 static void GenReverseBytes(LocationSummary* locations,
-                            Primitive::Type type,
+                            DataType::Type type,
                             Mips64Assembler* assembler) {
   GpuRegister in  = locations->InAt(0).AsRegister<GpuRegister>();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
 
   switch (type) {
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ Dsbh(out, in);
       __ Seh(out, out);
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ Rotr(out, in, 16);
       __ Wsbh(out, out);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ Dsbh(out, in);
       __ Dshd(out, out);
       break;
@@ -254,7 +254,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitIntegerReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 // long java.lang.Long.reverseBytes(long)
@@ -263,7 +263,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitLongReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 // short java.lang.Short.reverseBytes(short)
@@ -272,7 +272,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitShortReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 static void GenNumberOfLeadingZeroes(LocationSummary* locations,
@@ -344,14 +344,14 @@
 }
 
 static void GenReverse(LocationSummary* locations,
-                       Primitive::Type type,
+                       DataType::Type type,
                        Mips64Assembler* assembler) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   GpuRegister in  = locations->InAt(0).AsRegister<GpuRegister>();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
 
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     __ Rotr(out, in, 16);
     __ Wsbh(out, out);
     __ Bitswap(out, out);
@@ -368,7 +368,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitIntegerReverse(HInvoke* invoke) {
-  GenReverse(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenReverse(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 // long java.lang.Long.reverse(long)
@@ -377,7 +377,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitLongReverse(HInvoke* invoke) {
-  GenReverse(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenReverse(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 static void CreateFPToFPLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -389,12 +389,12 @@
 }
 
 static void GenBitCount(LocationSummary* locations,
-                        const Primitive::Type type,
+                        const DataType::Type type,
                         Mips64Assembler* assembler) {
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
   GpuRegister in = locations->InAt(0).AsRegister<GpuRegister>();
 
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64);
 
   // https://graphics.stanford.edu/~seander/bithacks.html#CountBitsSetParallel
   //
@@ -419,7 +419,7 @@
   // number of instructions executed even when a large number of bits
   // are set.
 
-  if (type == Primitive::kPrimInt) {
+  if (type == DataType::Type::kInt32) {
     __ Srl(TMP, in, 1);
     __ LoadConst32(AT, 0x55555555);
     __ And(TMP, TMP, AT);
@@ -436,7 +436,7 @@
     __ LoadConst32(TMP, 0x01010101);
     __ MulR6(out, out, TMP);
     __ Srl(out, out, 24);
-  } else if (type == Primitive::kPrimLong) {
+  } else if (type == DataType::Type::kInt64) {
     __ Dsrl(TMP, in, 1);
     __ LoadConst64(AT, 0x5555555555555555L);
     __ And(TMP, TMP, AT);
@@ -462,7 +462,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitIntegerBitCount(HInvoke* invoke) {
-  GenBitCount(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenBitCount(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 // int java.lang.Long.bitCount(long)
@@ -471,7 +471,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitLongBitCount(HInvoke* invoke) {
-  GenBitCount(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenBitCount(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 static void MathAbsFP(LocationSummary* locations, bool is64bit, Mips64Assembler* assembler) {
@@ -546,7 +546,7 @@
 
 static void GenMinMaxFP(LocationSummary* locations,
                         bool is_min,
-                        Primitive::Type type,
+                        DataType::Type type,
                         Mips64Assembler* assembler) {
   FpuRegister a = locations->InAt(0).AsFpuRegister<FpuRegister>();
   FpuRegister b = locations->InAt(1).AsFpuRegister<FpuRegister>();
@@ -563,7 +563,7 @@
   // returned. This is why there is extra logic preceding the use of
   // the MIPS min.fmt/max.fmt instructions. If either a, or b holds a
   // NaN, return the NaN, otherwise return the min/max.
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     __ CmpUnD(FTMP, a, b);
     __ Bc1eqz(FTMP, &noNaNs);
 
@@ -586,7 +586,7 @@
       __ MaxD(out, a, b);
     }
   } else {
-    DCHECK_EQ(type, Primitive::kPrimFloat);
+    DCHECK_EQ(type, DataType::Type::kFloat32);
     __ CmpUnS(FTMP, a, b);
     __ Bc1eqz(FTMP, &noNaNs);
 
@@ -628,7 +628,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathMinDoubleDouble(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(), /* is_min */ true, Primitive::kPrimDouble, GetAssembler());
+  GenMinMaxFP(invoke->GetLocations(), /* is_min */ true, DataType::Type::kFloat64, GetAssembler());
 }
 
 // float java.lang.Math.min(float, float)
@@ -637,7 +637,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathMinFloatFloat(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(), /* is_min */ true, Primitive::kPrimFloat, GetAssembler());
+  GenMinMaxFP(invoke->GetLocations(), /* is_min */ true, DataType::Type::kFloat32, GetAssembler());
 }
 
 // double java.lang.Math.max(double, double)
@@ -646,7 +646,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathMaxDoubleDouble(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(), /* is_min */ false, Primitive::kPrimDouble, GetAssembler());
+  GenMinMaxFP(invoke->GetLocations(), /* is_min */ false, DataType::Type::kFloat64, GetAssembler());
 }
 
 // float java.lang.Math.max(float, float)
@@ -655,7 +655,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathMaxFloatFloat(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(), /* is_min */ false, Primitive::kPrimFloat, GetAssembler());
+  GenMinMaxFP(invoke->GetLocations(), /* is_min */ false, DataType::Type::kFloat32, GetAssembler());
 }
 
 static void GenMinMax(LocationSummary* locations,
@@ -885,12 +885,12 @@
   GenRoundingMode(invoke->GetLocations(), kCeil, GetAssembler());
 }
 
-static void GenRound(LocationSummary* locations, Mips64Assembler* assembler, Primitive::Type type) {
+static void GenRound(LocationSummary* locations, Mips64Assembler* assembler, DataType::Type type) {
   FpuRegister in = locations->InAt(0).AsFpuRegister<FpuRegister>();
   FpuRegister half = locations->GetTemp(0).AsFpuRegister<FpuRegister>();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
 
-  DCHECK(type == Primitive::kPrimFloat || type == Primitive::kPrimDouble);
+  DCHECK(type == DataType::Type::kFloat32 || type == DataType::Type::kFloat64);
 
   Mips64Label done;
 
@@ -903,7 +903,7 @@
   // return out;
 
   // out = floor(in);
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     __ FloorLD(FTMP, in);
     __ Dmfc1(out, FTMP);
   } else {
@@ -912,7 +912,7 @@
   }
 
   // if (out != MAX_VALUE && out != MIN_VALUE)
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     __ Daddiu(TMP, out, 1);
     __ Dati(TMP, 0x8000);  // TMP = out + 0x8000 0000 0000 0001
                            // or    out - 0x7FFF FFFF FFFF FFFF.
@@ -933,7 +933,7 @@
   }
 
   // TMP = (0.5 <= (in - out)) ? -1 : 0;
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     __ Cvtdl(FTMP, FTMP);  // Convert output of floor.l.d back to "double".
     __ LoadConst64(AT, bit_cast<int64_t, double>(0.5));
     __ SubD(FTMP, in, FTMP);
@@ -950,7 +950,7 @@
   }
 
   // Return out -= TMP.
-  if (type == Primitive::kPrimDouble) {
+  if (type == DataType::Type::kFloat64) {
     __ Dsubu(out, out, TMP);
   } else {
     __ Subu(out, out, TMP);
@@ -970,7 +970,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathRoundFloat(HInvoke* invoke) {
-  GenRound(invoke->GetLocations(), GetAssembler(), Primitive::kPrimFloat);
+  GenRound(invoke->GetLocations(), GetAssembler(), DataType::Type::kFloat32);
 }
 
 // long java.lang.Math.round(double)
@@ -984,7 +984,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitMathRoundDouble(HInvoke* invoke) {
-  GenRound(invoke->GetLocations(), GetAssembler(), Primitive::kPrimDouble);
+  GenRound(invoke->GetLocations(), GetAssembler(), DataType::Type::kFloat64);
 }
 
 // byte libcore.io.Memory.peekByte(long address)
@@ -1119,7 +1119,7 @@
 
 static void CreateIntIntIntToIntLocations(ArenaAllocator* arena,
                                           HInvoke* invoke,
-                                          Primitive::Type type) {
+                                          DataType::Type type) {
   bool can_call = kEmitCompilerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObject ||
        invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObjectVolatile);
@@ -1136,7 +1136,7 @@
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetOut(Location::RequiresRegister(),
                     (can_call ? Location::kOutputOverlap : Location::kNoOutputOverlap));
-  if (type == Primitive::kPrimNot && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
+  if (type == DataType::Type::kReference && kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
     // We need a temporary register for the read barrier marking slow
     // path in InstructionCodeGeneratorMIPS64::GenerateReferenceLoadWithBakerReadBarrier.
     locations->AddTemp(Location::RequiresRegister());
@@ -1146,13 +1146,13 @@
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          CodeGeneratorMIPS64* codegen) {
   LocationSummary* locations = invoke->GetLocations();
-  DCHECK((type == Primitive::kPrimInt) ||
-         (type == Primitive::kPrimLong) ||
-         (type == Primitive::kPrimNot)) << type;
+  DCHECK((type == DataType::Type::kInt32) ||
+         (type == DataType::Type::kInt64) ||
+         (type == DataType::Type::kReference)) << type;
   Mips64Assembler* assembler = codegen->GetAssembler();
   // Target register.
   Location trg_loc = locations->Out();
@@ -1164,26 +1164,26 @@
   Location offset_loc = locations->InAt(2);
   GpuRegister offset = offset_loc.AsRegister<GpuRegister>();
 
-  if (!(kEmitCompilerReadBarrier && kUseBakerReadBarrier && (type == Primitive::kPrimNot))) {
+  if (!(kEmitCompilerReadBarrier && kUseBakerReadBarrier && (type == DataType::Type::kReference))) {
     __ Daddu(TMP, base, offset);
   }
 
   switch (type) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ Ld(trg, TMP, 0);
       if (is_volatile) {
         __ Sync(0);
       }
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ Lw(trg, TMP, 0);
       if (is_volatile) {
         __ Sync(0);
       }
       break;
 
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       if (kEmitCompilerReadBarrier) {
         if (kUseBakerReadBarrier) {
           Location temp = locations->GetTemp(0);
@@ -1227,56 +1227,56 @@
 
 // int sun.misc.Unsafe.getInt(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGet(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 
 // int sun.misc.Unsafe.getIntVolatile(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 
 // long sun.misc.Unsafe.getLong(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGetLong(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 
 // long sun.misc.Unsafe.getLongVolatile(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 
 // Object sun.misc.Unsafe.getObject(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGetObject(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 
 // Object sun.misc.Unsafe.getObjectVolatile(Object o, long offset)
 void IntrinsicLocationsBuilderMIPS64::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference);
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 
 static void CreateIntIntIntIntToVoid(ArenaAllocator* arena, HInvoke* invoke) {
@@ -1292,13 +1292,13 @@
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
 static void GenUnsafePut(LocationSummary* locations,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          bool is_ordered,
                          CodeGeneratorMIPS64* codegen) {
-  DCHECK((type == Primitive::kPrimInt) ||
-         (type == Primitive::kPrimLong) ||
-         (type == Primitive::kPrimNot));
+  DCHECK((type == DataType::Type::kInt32) ||
+         (type == DataType::Type::kInt64) ||
+         (type == DataType::Type::kReference));
   Mips64Assembler* assembler = codegen->GetAssembler();
   // Object pointer.
   GpuRegister base = locations->InAt(1).AsRegister<GpuRegister>();
@@ -1311,9 +1311,9 @@
     __ Sync(0);
   }
   switch (type) {
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
-      if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
+      if (kPoisonHeapReferences && type == DataType::Type::kReference) {
         __ PoisonHeapReference(AT, value);
         __ Sw(AT, TMP, 0);
       } else {
@@ -1321,7 +1321,7 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ Sd(value, TMP, 0);
       break;
 
@@ -1333,7 +1333,7 @@
     __ Sync(0);
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(base, value, value_can_be_null);
   }
@@ -1346,7 +1346,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePut(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
@@ -1359,7 +1359,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
@@ -1372,7 +1372,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimInt,
+               DataType::Type::kInt32,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
@@ -1385,7 +1385,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutObject(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
@@ -1398,7 +1398,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
@@ -1411,7 +1411,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimNot,
+               DataType::Type::kReference,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
@@ -1424,7 +1424,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutLong(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ false,
                codegen_);
@@ -1437,7 +1437,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ false,
                /* is_ordered */ true,
                codegen_);
@@ -1450,7 +1450,7 @@
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafePutLongVolatile(HInvoke* invoke) {
   GenUnsafePut(invoke->GetLocations(),
-               Primitive::kPrimLong,
+               DataType::Type::kInt64,
                /* is_volatile */ true,
                /* is_ordered */ false,
                codegen_);
@@ -1480,7 +1480,7 @@
 
 // Note that the caller must supply a properly aligned memory address.
 // If they do not, the behavior is undefined (atomicity not guaranteed, exception may occur).
-static void GenCas(HInvoke* invoke, Primitive::Type type, CodeGeneratorMIPS64* codegen) {
+static void GenCas(HInvoke* invoke, DataType::Type type, CodeGeneratorMIPS64* codegen) {
   Mips64Assembler* assembler = codegen->GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
   GpuRegister base = locations->InAt(1).AsRegister<GpuRegister>();
@@ -1495,7 +1495,7 @@
   DCHECK_NE(offset, out);
   DCHECK_NE(expected, out);
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // The only read barrier implementation supporting the
     // UnsafeCASObject intrinsic is the Baker-style read barriers.
     DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
@@ -1525,7 +1525,7 @@
   Mips64Label loop_head, exit_loop;
   __ Daddu(TMP, base, offset);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     __ PoisonHeapReference(expected);
     // Do not poison `value`, if it is the same register as
     // `expected`, which has just been poisoned.
@@ -1541,13 +1541,13 @@
 
   __ Sync(0);
   __ Bind(&loop_head);
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ Lld(out, TMP);
   } else {
     // Note: We will need a read barrier here, when read barrier
     // support is added to the MIPS64 back end.
     __ Ll(out, TMP);
-    if (type == Primitive::kPrimNot) {
+    if (type == DataType::Type::kReference) {
       // The LL instruction sign-extends the 32-bit value, but
       // 32-bit references must be zero-extended. Zero-extend `out`.
       __ Dext(out, out, 0, 32);
@@ -1561,7 +1561,7 @@
                         // in the case that the store fails.  Whether the
                         // store succeeds, or fails, it will load the
                         // correct Boolean value into the 'out' register.
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ Scd(out, TMP);
   } else {
     __ Sc(out, TMP);
@@ -1571,7 +1571,7 @@
   __ Bind(&exit_loop);
   __ Sync(0);
 
-  if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     __ UnpoisonHeapReference(expected);
     // Do not unpoison `value`, if it is the same register as
     // `expected`, which has just been unpoisoned.
@@ -1587,7 +1587,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimInt, codegen_);
+  GenCas(invoke, DataType::Type::kInt32, codegen_);
 }
 
 // boolean sun.misc.Unsafe.compareAndSwapLong(Object o, long offset, long expected, long x)
@@ -1596,7 +1596,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitUnsafeCASLong(HInvoke* invoke) {
-  GenCas(invoke, Primitive::kPrimLong, codegen_);
+  GenCas(invoke, DataType::Type::kInt64, codegen_);
 }
 
 // boolean sun.misc.Unsafe.compareAndSwapObject(Object o, long offset, Object expected, Object x)
@@ -1615,7 +1615,7 @@
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCas(invoke, Primitive::kPrimNot, codegen_);
+  GenCas(invoke, DataType::Type::kReference, codegen_);
 }
 
 // int java.lang.String.compareTo(String anotherString)
@@ -1626,7 +1626,7 @@
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 }
 
@@ -1790,7 +1790,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     GpuRegister char_reg = locations->InAt(1).AsRegister<GpuRegister>();
     __ LoadConst32(tmp_reg, std::numeric_limits<uint16_t>::max());
     slow_path = new (allocator) IntrinsicSlowPathMIPS64(invoke);
@@ -1822,7 +1822,7 @@
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 
   // Need a temp for slow-path codepoint compare, and need to send start-index=0.
@@ -1844,7 +1844,7 @@
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 }
 
@@ -1863,7 +1863,7 @@
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
   locations->SetInAt(3, Location::RegisterLocation(calling_convention.GetRegisterAt(3)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 }
 
@@ -1890,7 +1890,7 @@
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(2, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 }
 
@@ -1912,7 +1912,7 @@
                                                             kIntrinsified);
   InvokeRuntimeCallingConvention calling_convention;
   locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-  Location outLocation = calling_convention.GetReturnLocation(Primitive::kPrimInt);
+  Location outLocation = calling_convention.GetReturnLocation(DataType::Type::kInt32);
   locations->SetOut(Location::RegisterLocation(outLocation.AsRegister<GpuRegister>()));
 }
 
@@ -1985,9 +1985,9 @@
   LocationSummary* locations = invoke->GetLocations();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
-  const size_t char_shift = Primitive::ComponentSizeShift(Primitive::kPrimChar);
+  const size_t char_shift = DataType::SizeShift(DataType::Type::kUint16);
 
   GpuRegister srcObj = locations->InAt(0).AsRegister<GpuRegister>();
   GpuRegister srcBegin = locations->InAt(1).AsRegister<GpuRegister>();
@@ -2213,10 +2213,10 @@
 
   // Okay, everything checks out.  Finally time to do the copy.
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
-  const size_t char_shift = Primitive::ComponentSizeShift(Primitive::kPrimChar);
+  const size_t char_shift = DataType::SizeShift(DataType::Type::kUint16);
 
   const uint32_t data_offset = mirror::Array::DataOffset(char_size).Uint32Value();
 
@@ -2250,14 +2250,14 @@
 }
 
 static void GenHighestOneBit(LocationSummary* locations,
-                             Primitive::Type type,
+                             DataType::Type type,
                              Mips64Assembler* assembler) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong) << PrettyDescriptor(type);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64) << type;
 
   GpuRegister in = locations->InAt(0).AsRegister<GpuRegister>();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ Dclz(TMP, in);
     __ LoadConst64(AT, INT64_C(0x8000000000000000));
     __ Dsrlv(AT, AT, TMP);
@@ -2281,7 +2281,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitIntegerHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenHighestOneBit(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 // long java.lang.Long.highestOneBit(long)
@@ -2290,18 +2290,18 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitLongHighestOneBit(HInvoke* invoke) {
-  GenHighestOneBit(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenHighestOneBit(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 static void GenLowestOneBit(LocationSummary* locations,
-                            Primitive::Type type,
+                            DataType::Type type,
                             Mips64Assembler* assembler) {
-  DCHECK(type == Primitive::kPrimInt || type == Primitive::kPrimLong) << PrettyDescriptor(type);
+  DCHECK(type == DataType::Type::kInt32 || type == DataType::Type::kInt64) << type;
 
   GpuRegister in = locations->InAt(0).AsRegister<GpuRegister>();
   GpuRegister out = locations->Out().AsRegister<GpuRegister>();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ Dsubu(TMP, ZERO, in);
   } else {
     __ Subu(TMP, ZERO, in);
@@ -2315,7 +2315,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitIntegerLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenLowestOneBit(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 // long java.lang.Long.lowestOneBit(long)
@@ -2324,7 +2324,7 @@
 }
 
 void IntrinsicCodeGeneratorMIPS64::VisitLongLowestOneBit(HInvoke* invoke) {
-  GenLowestOneBit(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenLowestOneBit(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 static void CreateFPToFPCallLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -2334,7 +2334,7 @@
   InvokeRuntimeCallingConvention calling_convention;
 
   locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimDouble));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kFloat64));
 }
 
 static void CreateFPFPToFPCallLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -2345,7 +2345,7 @@
 
   locations->SetInAt(0, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(0)));
   locations->SetInAt(1, Location::FpuRegisterLocation(calling_convention.GetFpuRegisterAt(1)));
-  locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimDouble));
+  locations->SetOut(calling_convention.GetReturnLocation(DataType::Type::kFloat64));
 }
 
 static void GenFPToFPCall(HInvoke* invoke,
@@ -2533,7 +2533,7 @@
   IntrinsicVisitor::ComputeIntegerValueOfLocations(
       invoke,
       codegen_,
-      calling_convention.GetReturnLocation(Primitive::kPrimNot),
+      calling_convention.GetReturnLocation(DataType::Type::kReference),
       Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
 }
 
diff --git a/compiler/optimizing/intrinsics_x86.cc b/compiler/optimizing/intrinsics_x86.cc
index abd9014..a591622 100644
--- a/compiler/optimizing/intrinsics_x86.cc
+++ b/compiler/optimizing/intrinsics_x86.cc
@@ -97,7 +97,7 @@
     DCHECK(instruction_->GetLocations()->Intrinsified());
     DCHECK_EQ(instruction_->AsInvoke()->GetIntrinsic(), Intrinsics::kSystemArrayCopy);
 
-    int32_t element_size = Primitive::ComponentSize(Primitive::kPrimNot);
+    int32_t element_size = DataType::Size(DataType::Type::kReference);
     uint32_t offset = mirror::Array::DataOffset(element_size).Uint32Value();
 
     Register src = locations->InAt(0).AsRegister<Register>();
@@ -282,17 +282,17 @@
 }
 
 static void GenReverseBytes(LocationSummary* locations,
-                            Primitive::Type size,
+                            DataType::Type size,
                             X86Assembler* assembler) {
   Register out = locations->Out().AsRegister<Register>();
 
   switch (size) {
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       // TODO: Can be done with an xchg of 8b registers. This is straight from Quick.
       __ bswapl(out);
       __ sarl(out, Immediate(16));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ bswapl(out);
       break;
     default:
@@ -306,7 +306,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitIntegerReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitLongReverseBytes(HInvoke* invoke) {
@@ -335,7 +335,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitShortReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 
@@ -1307,7 +1307,7 @@
 
   // Okay, everything checks out.  Finally time to do the copy.
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   const uint32_t data_offset = mirror::Array::DataOffset(char_size).Uint32Value();
@@ -1540,7 +1540,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     __ cmpl(search_value, Immediate(std::numeric_limits<uint16_t>::max()));
     slow_path = new (allocator) IntrinsicSlowPathX86(invoke);
     codegen->AddSlowPath(slow_path);
@@ -1766,7 +1766,7 @@
   X86Assembler* assembler = GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
 
-  size_t char_component_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  size_t char_component_size = DataType::Size(DataType::Type::kUint16);
   // Location of data in char array buffer.
   const uint32_t data_offset = mirror::Array::DataOffset(char_component_size).Uint32Value();
   // Location of char array data in string.
@@ -1782,7 +1782,7 @@
   Register dstBegin = locations->InAt(4).AsRegister<Register>();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   // Compute the number of chars (words) to move.
@@ -1802,7 +1802,7 @@
   if (mirror::kUseStringCompression) {
     // Location of count in string
     const uint32_t count_offset = mirror::String::CountOffset().Uint32Value();
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
     __ pushl(EAX);
     __ cfi().AdjustCFAOffset(stack_adjust);
@@ -1849,22 +1849,22 @@
   __ cfi().AdjustCFAOffset(-stack_adjust);
 }
 
-static void GenPeek(LocationSummary* locations, Primitive::Type size, X86Assembler* assembler) {
+static void GenPeek(LocationSummary* locations, DataType::Type size, X86Assembler* assembler) {
   Register address = locations->InAt(0).AsRegisterPairLow<Register>();
   Location out_loc = locations->Out();
   // x86 allows unaligned access. We do not have to check the input or use specific instructions
   // to avoid a SIGBUS.
   switch (size) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       __ movsxb(out_loc.AsRegister<Register>(), Address(address, 0));
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ movsxw(out_loc.AsRegister<Register>(), Address(address, 0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ movl(out_loc.AsRegister<Register>(), Address(address, 0));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ movl(out_loc.AsRegisterPairLow<Register>(), Address(address, 0));
       __ movl(out_loc.AsRegisterPairHigh<Register>(), Address(address, 4));
       break;
@@ -1879,7 +1879,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPeekByte(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimByte, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt8, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPeekIntNative(HInvoke* invoke) {
@@ -1887,7 +1887,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPeekIntNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPeekLongNative(HInvoke* invoke) {
@@ -1895,7 +1895,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPeekLongNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPeekShortNative(HInvoke* invoke) {
@@ -1903,30 +1903,30 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPeekShortNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
-static void CreateLongIntToVoidLocations(ArenaAllocator* arena, Primitive::Type size,
+static void CreateLongIntToVoidLocations(ArenaAllocator* arena, DataType::Type size,
                                          HInvoke* invoke) {
   LocationSummary* locations = new (arena) LocationSummary(invoke,
                                                            LocationSummary::kNoCall,
                                                            kIntrinsified);
   locations->SetInAt(0, Location::RequiresRegister());
   HInstruction* value = invoke->InputAt(1);
-  if (size == Primitive::kPrimByte) {
+  if (size == DataType::Type::kInt8) {
     locations->SetInAt(1, Location::ByteRegisterOrConstant(EDX, value));
   } else {
     locations->SetInAt(1, Location::RegisterOrConstant(value));
   }
 }
 
-static void GenPoke(LocationSummary* locations, Primitive::Type size, X86Assembler* assembler) {
+static void GenPoke(LocationSummary* locations, DataType::Type size, X86Assembler* assembler) {
   Register address = locations->InAt(0).AsRegisterPairLow<Register>();
   Location value_loc = locations->InAt(1);
   // x86 allows unaligned access. We do not have to check the input or use specific instructions
   // to avoid a SIGBUS.
   switch (size) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       if (value_loc.IsConstant()) {
         __ movb(Address(address, 0),
                 Immediate(value_loc.GetConstant()->AsIntConstant()->GetValue()));
@@ -1934,7 +1934,7 @@
         __ movb(Address(address, 0), value_loc.AsRegister<ByteRegister>());
       }
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       if (value_loc.IsConstant()) {
         __ movw(Address(address, 0),
                 Immediate(value_loc.GetConstant()->AsIntConstant()->GetValue()));
@@ -1942,7 +1942,7 @@
         __ movw(Address(address, 0), value_loc.AsRegister<Register>());
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       if (value_loc.IsConstant()) {
         __ movl(Address(address, 0),
                 Immediate(value_loc.GetConstant()->AsIntConstant()->GetValue()));
@@ -1950,7 +1950,7 @@
         __ movl(Address(address, 0), value_loc.AsRegister<Register>());
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (value_loc.IsConstant()) {
         int64_t value = value_loc.GetConstant()->AsLongConstant()->GetValue();
         __ movl(Address(address, 0), Immediate(Low32Bits(value)));
@@ -1967,35 +1967,35 @@
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPokeByte(HInvoke* invoke) {
-  CreateLongIntToVoidLocations(arena_, Primitive::kPrimByte, invoke);
+  CreateLongIntToVoidLocations(arena_, DataType::Type::kInt8, invoke);
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPokeByte(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimByte, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt8, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPokeIntNative(HInvoke* invoke) {
-  CreateLongIntToVoidLocations(arena_, Primitive::kPrimInt, invoke);
+  CreateLongIntToVoidLocations(arena_, DataType::Type::kInt32, invoke);
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPokeIntNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPokeLongNative(HInvoke* invoke) {
-  CreateLongIntToVoidLocations(arena_, Primitive::kPrimLong, invoke);
+  CreateLongIntToVoidLocations(arena_, DataType::Type::kInt64, invoke);
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPokeLongNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitMemoryPokeShortNative(HInvoke* invoke) {
-  CreateLongIntToVoidLocations(arena_, Primitive::kPrimShort, invoke);
+  CreateLongIntToVoidLocations(arena_, DataType::Type::kInt16, invoke);
 }
 
 void IntrinsicCodeGeneratorX86::VisitMemoryPokeShortNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86::VisitThreadCurrentThread(HInvoke* invoke) {
@@ -2011,7 +2011,7 @@
 }
 
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          CodeGeneratorX86* codegen) {
   X86Assembler* assembler = down_cast<X86Assembler*>(codegen->GetAssembler());
@@ -2023,13 +2023,13 @@
   Location output_loc = locations->Out();
 
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       Register output = output_loc.AsRegister<Register>();
       __ movl(output, Address(base, offset, ScaleFactor::TIMES_1, 0));
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       Register output = output_loc.AsRegister<Register>();
       if (kEmitCompilerReadBarrier) {
         if (kUseBakerReadBarrier) {
@@ -2048,7 +2048,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
         Register output_lo = output_loc.AsRegisterPairLow<Register>();
         Register output_hi = output_loc.AsRegisterPairHigh<Register>();
         if (is_volatile) {
@@ -2073,7 +2073,7 @@
 
 static void CreateIntIntIntToIntLocations(ArenaAllocator* arena,
                                           HInvoke* invoke,
-                                          Primitive::Type type,
+                                          DataType::Type type,
                                           bool is_volatile) {
   bool can_call = kEmitCompilerReadBarrier &&
       (invoke->GetIntrinsic() == Intrinsics::kUnsafeGetObject ||
@@ -2089,7 +2089,7 @@
   locations->SetInAt(0, Location::NoLocation());        // Unused receiver.
   locations->SetInAt(1, Location::RequiresRegister());
   locations->SetInAt(2, Location::RequiresRegister());
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     if (is_volatile) {
       // Need to use XMM to read volatile.
       locations->AddTemp(Location::RequiresFpuRegister());
@@ -2104,47 +2104,48 @@
 }
 
 void IntrinsicLocationsBuilderX86::VisitUnsafeGet(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt, /* is_volatile */ false);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimInt, /* is_volatile */ true);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt32, /* is_volatile */ true);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafeGetLong(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong, /* is_volatile */ false);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimLong, /* is_volatile */ true);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kInt64, /* is_volatile */ true);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafeGetObject(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot, /* is_volatile */ false);
+  CreateIntIntIntToIntLocations(
+      arena_, invoke, DataType::Type::kReference, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntToIntLocations(arena_, invoke, Primitive::kPrimNot, /* is_volatile */ true);
+  CreateIntIntIntToIntLocations(arena_, invoke, DataType::Type::kReference, /* is_volatile */ true);
 }
 
 
 void IntrinsicCodeGeneratorX86::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 
 
 static void CreateIntIntIntIntToVoidPlusTempsLocations(ArenaAllocator* arena,
-                                                       Primitive::Type type,
+                                                       DataType::Type type,
                                                        HInvoke* invoke,
                                                        bool is_volatile) {
   LocationSummary* locations = new (arena) LocationSummary(invoke,
@@ -2154,12 +2155,12 @@
   locations->SetInAt(1, Location::RequiresRegister());
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetInAt(3, Location::RequiresRegister());
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Need temp registers for card-marking.
     locations->AddTemp(Location::RequiresRegister());  // Possibly used for reference poisoning too.
     // Ensure the value is in a byte register.
     locations->AddTemp(Location::RegisterLocation(ECX));
-  } else if (type == Primitive::kPrimLong && is_volatile) {
+  } else if (type == DataType::Type::kInt64 && is_volatile) {
     locations->AddTemp(Location::RequiresFpuRegister());
     locations->AddTemp(Location::RequiresFpuRegister());
   }
@@ -2167,45 +2168,45 @@
 
 void IntrinsicLocationsBuilderX86::VisitUnsafePut(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimInt, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kInt32, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutOrdered(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimInt, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kInt32, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutVolatile(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimInt, invoke, /* is_volatile */ true);
+      arena_, DataType::Type::kInt32, invoke, /* is_volatile */ true);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutObject(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimNot, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kReference, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimNot, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kReference, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimNot, invoke, /* is_volatile */ true);
+      arena_, DataType::Type::kReference, invoke, /* is_volatile */ true);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutLong(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimLong, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kInt64, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutLongOrdered(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimLong, invoke, /* is_volatile */ false);
+      arena_, DataType::Type::kInt64, invoke, /* is_volatile */ false);
 }
 void IntrinsicLocationsBuilderX86::VisitUnsafePutLongVolatile(HInvoke* invoke) {
   CreateIntIntIntIntToVoidPlusTempsLocations(
-      arena_, Primitive::kPrimLong, invoke, /* is_volatile */ true);
+      arena_, DataType::Type::kInt64, invoke, /* is_volatile */ true);
 }
 
 // We don't care for ordered: it requires an AnyStore barrier, which is already given by the x86
 // memory model.
 static void GenUnsafePut(LocationSummary* locations,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile,
                          CodeGeneratorX86* codegen) {
   X86Assembler* assembler = down_cast<X86Assembler*>(codegen->GetAssembler());
@@ -2213,7 +2214,7 @@
   Register offset = locations->InAt(2).AsRegisterPairLow<Register>();
   Location value_loc = locations->InAt(3);
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     Register value_lo = value_loc.AsRegisterPairLow<Register>();
     Register value_hi = value_loc.AsRegisterPairHigh<Register>();
     if (is_volatile) {
@@ -2227,7 +2228,7 @@
       __ movl(Address(base, offset, ScaleFactor::TIMES_1, 0), value_lo);
       __ movl(Address(base, offset, ScaleFactor::TIMES_1, 4), value_hi);
     }
-  } else if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  } else if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     Register temp = locations->GetTemp(0).AsRegister<Register>();
     __ movl(temp, value_loc.AsRegister<Register>());
     __ PoisonHeapReference(temp);
@@ -2240,7 +2241,7 @@
     codegen->MemoryFence();
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(locations->GetTemp(0).AsRegister<Register>(),
                         locations->GetTemp(1).AsRegister<Register>(),
@@ -2251,35 +2252,38 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitUnsafePut(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutObject(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutLong(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutLongOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86::VisitUnsafePutLongVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 
 static void CreateIntIntIntIntIntToInt(ArenaAllocator* arena,
-                                       Primitive::Type type,
+                                       DataType::Type type,
                                        HInvoke* invoke) {
   bool can_call = kEmitCompilerReadBarrier &&
       kUseBakerReadBarrier &&
@@ -2296,7 +2300,7 @@
   locations->SetInAt(2, Location::RequiresRegister());
   // Expected value must be in EAX or EDX:EAX.
   // For long, new value must be in ECX:EBX.
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     locations->SetInAt(3, Location::RegisterPairLocation(EAX, EDX));
     locations->SetInAt(4, Location::RegisterPairLocation(EBX, ECX));
   } else {
@@ -2306,7 +2310,7 @@
 
   // Force a byte register for the output.
   locations->SetOut(Location::RegisterLocation(EAX));
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Need temporary registers for card-marking, and possibly for
     // (Baker) read barrier.
     locations->AddTemp(Location::RequiresRegister());  // Possibly used for reference poisoning too.
@@ -2316,11 +2320,11 @@
 }
 
 void IntrinsicLocationsBuilderX86::VisitUnsafeCASInt(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimInt, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kInt32, invoke);
 }
 
 void IntrinsicLocationsBuilderX86::VisitUnsafeCASLong(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimLong, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kInt64, invoke);
 }
 
 void IntrinsicLocationsBuilderX86::VisitUnsafeCASObject(HInvoke* invoke) {
@@ -2330,10 +2334,10 @@
     return;
   }
 
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimNot, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kReference, invoke);
 }
 
-static void GenCAS(Primitive::Type type, HInvoke* invoke, CodeGeneratorX86* codegen) {
+static void GenCAS(DataType::Type type, HInvoke* invoke, CodeGeneratorX86* codegen) {
   X86Assembler* assembler = down_cast<X86Assembler*>(codegen->GetAssembler());
   LocationSummary* locations = invoke->GetLocations();
 
@@ -2345,7 +2349,7 @@
   // The address of the field within the holding object.
   Address field_addr(base, offset, ScaleFactor::TIMES_1, 0);
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // The only read barrier implementation supporting the
     // UnsafeCASObject intrinsic is the Baker-style read barriers.
     DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
@@ -2426,12 +2430,12 @@
       // `expected`, as it is the same as register `out` (EAX).
     }
   } else {
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       // Ensure the expected value is in EAX (required by the CMPXCHG
       // instruction).
       DCHECK_EQ(locations->InAt(3).AsRegister<Register>(), EAX);
       __ LockCmpxchgl(field_addr, locations->InAt(4).AsRegister<Register>());
-    } else if (type == Primitive::kPrimLong) {
+    } else if (type == DataType::Type::kInt64) {
       // Ensure the expected value is in EAX:EDX and that the new
       // value is in EBX:ECX (required by the CMPXCHG8B instruction).
       DCHECK_EQ(locations->InAt(3).AsRegisterPairLow<Register>(), EAX);
@@ -2453,11 +2457,11 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCAS(Primitive::kPrimInt, invoke, codegen_);
+  GenCAS(DataType::Type::kInt32, invoke, codegen_);
 }
 
 void IntrinsicCodeGeneratorX86::VisitUnsafeCASLong(HInvoke* invoke) {
-  GenCAS(Primitive::kPrimLong, invoke, codegen_);
+  GenCAS(DataType::Type::kInt64, invoke, codegen_);
 }
 
 void IntrinsicCodeGeneratorX86::VisitUnsafeCASObject(HInvoke* invoke) {
@@ -2465,7 +2469,7 @@
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCAS(Primitive::kPrimNot, invoke, codegen_);
+  GenCAS(DataType::Type::kReference, invoke, codegen_);
 }
 
 void IntrinsicLocationsBuilderX86::VisitIntegerReverse(HInvoke* invoke) {
@@ -2824,16 +2828,16 @@
 
 // Compute base address for the System.arraycopy intrinsic in `base`.
 static void GenSystemArrayCopyBaseAddress(X86Assembler* assembler,
-                                          Primitive::Type type,
+                                          DataType::Type type,
                                           const Register& array,
                                           const Location& pos,
                                           const Register& base) {
   // This routine is only used by the SystemArrayCopy intrinsic at the
-  // moment. We can allow Primitive::kPrimNot as `type` to implement
+  // moment. We can allow DataType::Type::kReference as `type` to implement
   // the SystemArrayCopyChar intrinsic.
-  DCHECK_EQ(type, Primitive::kPrimNot);
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const ScaleFactor scale_factor = static_cast<ScaleFactor>(Primitive::ComponentSizeShift(type));
+  DCHECK_EQ(type, DataType::Type::kReference);
+  const int32_t element_size = DataType::Size(type);
+  const ScaleFactor scale_factor = static_cast<ScaleFactor>(DataType::SizeShift(type));
   const uint32_t data_offset = mirror::Array::DataOffset(element_size).Uint32Value();
 
   if (pos.IsConstant()) {
@@ -2846,16 +2850,16 @@
 
 // Compute end source address for the System.arraycopy intrinsic in `end`.
 static void GenSystemArrayCopyEndAddress(X86Assembler* assembler,
-                                         Primitive::Type type,
+                                         DataType::Type type,
                                          const Location& copy_length,
                                          const Register& base,
                                          const Register& end) {
   // This routine is only used by the SystemArrayCopy intrinsic at the
-  // moment. We can allow Primitive::kPrimNot as `type` to implement
+  // moment. We can allow DataType::Type::kReference as `type` to implement
   // the SystemArrayCopyChar intrinsic.
-  DCHECK_EQ(type, Primitive::kPrimNot);
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const ScaleFactor scale_factor = static_cast<ScaleFactor>(Primitive::ComponentSizeShift(type));
+  DCHECK_EQ(type, DataType::Type::kReference);
+  const int32_t element_size = DataType::Size(type);
+  const ScaleFactor scale_factor = static_cast<ScaleFactor>(DataType::SizeShift(type));
 
   if (copy_length.IsConstant()) {
     int32_t constant = copy_length.GetConstant()->AsIntConstant()->GetValue();
@@ -3169,8 +3173,8 @@
     __ j(kNotEqual, intrinsic_slow_path->GetEntryLabel());
   }
 
-  const Primitive::Type type = Primitive::kPrimNot;
-  const int32_t element_size = Primitive::ComponentSize(type);
+  const DataType::Type type = DataType::Type::kReference;
+  const int32_t element_size = DataType::Size(type);
 
   // Compute the base source address in `temp1`.
   GenSystemArrayCopyBaseAddress(GetAssembler(), type, src, src_pos, temp1);
diff --git a/compiler/optimizing/intrinsics_x86_64.cc b/compiler/optimizing/intrinsics_x86_64.cc
index 7798c0d..a2545ee 100644
--- a/compiler/optimizing/intrinsics_x86_64.cc
+++ b/compiler/optimizing/intrinsics_x86_64.cc
@@ -90,7 +90,7 @@
     DCHECK(instruction_->GetLocations()->Intrinsified());
     DCHECK_EQ(instruction_->AsInvoke()->GetIntrinsic(), Intrinsics::kSystemArrayCopy);
 
-    int32_t element_size = Primitive::ComponentSize(Primitive::kPrimNot);
+    int32_t element_size = DataType::Size(DataType::Type::kReference);
 
     CpuRegister src_curr_addr = locations->GetTemp(0).AsRegister<CpuRegister>();
     CpuRegister dst_curr_addr = locations->GetTemp(1).AsRegister<CpuRegister>();
@@ -193,20 +193,20 @@
 }
 
 static void GenReverseBytes(LocationSummary* locations,
-                            Primitive::Type size,
+                            DataType::Type size,
                             X86_64Assembler* assembler) {
   CpuRegister out = locations->Out().AsRegister<CpuRegister>();
 
   switch (size) {
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       // TODO: Can be done with an xchg of 8b registers. This is straight from Quick.
       __ bswapl(out);
       __ sarl(out, Immediate(16));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ bswapl(out);
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ bswapq(out);
       break;
     default:
@@ -220,7 +220,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitIntegerReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitLongReverseBytes(HInvoke* invoke) {
@@ -228,7 +228,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitLongReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitShortReverseBytes(HInvoke* invoke) {
@@ -236,7 +236,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitShortReverseBytes(HInvoke* invoke) {
-  GenReverseBytes(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenReverseBytes(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 
@@ -1084,7 +1084,7 @@
 
   // Okay, everything checks out.  Finally time to do the copy.
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   const uint32_t data_offset = mirror::Array::DataOffset(char_size).Uint32Value();
@@ -1125,7 +1125,7 @@
 // source address for the System.arraycopy intrinsic in `src_base`,
 // `dst_base` and `src_end` respectively.
 static void GenSystemArrayCopyAddresses(X86_64Assembler* assembler,
-                                        Primitive::Type type,
+                                        DataType::Type type,
                                         const CpuRegister& src,
                                         const Location& src_pos,
                                         const CpuRegister& dst,
@@ -1135,9 +1135,9 @@
                                         const CpuRegister& dst_base,
                                         const CpuRegister& src_end) {
   // This routine is only used by the SystemArrayCopy intrinsic.
-  DCHECK_EQ(type, Primitive::kPrimNot);
-  const int32_t element_size = Primitive::ComponentSize(type);
-  const ScaleFactor scale_factor = static_cast<ScaleFactor>(Primitive::ComponentSizeShift(type));
+  DCHECK_EQ(type, DataType::Type::kReference);
+  const int32_t element_size = DataType::Size(type);
+  const ScaleFactor scale_factor = static_cast<ScaleFactor>(DataType::SizeShift(type));
   const uint32_t data_offset = mirror::Array::DataOffset(element_size).Uint32Value();
 
   if (src_pos.IsConstant()) {
@@ -1410,8 +1410,8 @@
     __ j(kNotEqual, intrinsic_slow_path->GetEntryLabel());
   }
 
-  const Primitive::Type type = Primitive::kPrimNot;
-  const int32_t element_size = Primitive::ComponentSize(type);
+  const DataType::Type type = DataType::Type::kReference;
+  const int32_t element_size = DataType::Size(type);
 
   // Compute base source address, base destination address, and end
   // source address in `temp1`, `temp2` and `temp3` respectively.
@@ -1705,7 +1705,7 @@
       __ Bind(slow_path->GetExitLabel());
       return;
     }
-  } else if (code_point->GetType() != Primitive::kPrimChar) {
+  } else if (code_point->GetType() != DataType::Type::kUint16) {
     __ cmpl(search_value, Immediate(std::numeric_limits<uint16_t>::max()));
     slow_path = new (allocator) IntrinsicSlowPathX86_64(invoke);
     codegen->AddSlowPath(slow_path);
@@ -1922,7 +1922,7 @@
   X86_64Assembler* assembler = GetAssembler();
   LocationSummary* locations = invoke->GetLocations();
 
-  size_t char_component_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  size_t char_component_size = DataType::Size(DataType::Type::kUint16);
   // Location of data in char array buffer.
   const uint32_t data_offset = mirror::Array::DataOffset(char_component_size).Uint32Value();
   // Location of char array data in string.
@@ -1938,7 +1938,7 @@
   CpuRegister dstBegin = locations->InAt(4).AsRegister<CpuRegister>();
 
   // Check assumption that sizeof(Char) is 2 (used in scaling below).
-  const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+  const size_t char_size = DataType::Size(DataType::Type::kUint16);
   DCHECK_EQ(char_size, 2u);
 
   NearLabel done;
@@ -1952,7 +1952,7 @@
   }
   if (mirror::kUseStringCompression) {
     NearLabel copy_uncompressed, copy_loop;
-    const size_t c_char_size = Primitive::ComponentSize(Primitive::kPrimByte);
+    const size_t c_char_size = DataType::Size(DataType::Type::kInt8);
     DCHECK_EQ(c_char_size, 1u);
     // Location of count in string.
     const uint32_t count_offset = mirror::String::CountOffset().Uint32Value();
@@ -1993,22 +1993,22 @@
   __ Bind(&done);
 }
 
-static void GenPeek(LocationSummary* locations, Primitive::Type size, X86_64Assembler* assembler) {
+static void GenPeek(LocationSummary* locations, DataType::Type size, X86_64Assembler* assembler) {
   CpuRegister address = locations->InAt(0).AsRegister<CpuRegister>();
   CpuRegister out = locations->Out().AsRegister<CpuRegister>();  // == address, here for clarity.
   // x86 allows unaligned access. We do not have to check the input or use specific instructions
   // to avoid a SIGBUS.
   switch (size) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       __ movsxb(out, Address(address, 0));
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       __ movsxw(out, Address(address, 0));
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ movl(out, Address(address, 0));
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ movq(out, Address(address, 0));
       break;
     default:
@@ -2022,7 +2022,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPeekByte(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimByte, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt8, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPeekIntNative(HInvoke* invoke) {
@@ -2030,7 +2030,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPeekIntNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPeekLongNative(HInvoke* invoke) {
@@ -2038,7 +2038,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPeekLongNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPeekShortNative(HInvoke* invoke) {
@@ -2046,7 +2046,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPeekShortNative(HInvoke* invoke) {
-  GenPeek(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenPeek(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 static void CreateIntIntToVoidLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -2057,13 +2057,13 @@
   locations->SetInAt(1, Location::RegisterOrInt32Constant(invoke->InputAt(1)));
 }
 
-static void GenPoke(LocationSummary* locations, Primitive::Type size, X86_64Assembler* assembler) {
+static void GenPoke(LocationSummary* locations, DataType::Type size, X86_64Assembler* assembler) {
   CpuRegister address = locations->InAt(0).AsRegister<CpuRegister>();
   Location value = locations->InAt(1);
   // x86 allows unaligned access. We do not have to check the input or use specific instructions
   // to avoid a SIGBUS.
   switch (size) {
-    case Primitive::kPrimByte:
+    case DataType::Type::kInt8:
       if (value.IsConstant()) {
         __ movb(Address(address, 0),
                 Immediate(CodeGenerator::GetInt32ValueOf(value.GetConstant())));
@@ -2071,7 +2071,7 @@
         __ movb(Address(address, 0), value.AsRegister<CpuRegister>());
       }
       break;
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt16:
       if (value.IsConstant()) {
         __ movw(Address(address, 0),
                 Immediate(CodeGenerator::GetInt32ValueOf(value.GetConstant())));
@@ -2079,7 +2079,7 @@
         __ movw(Address(address, 0), value.AsRegister<CpuRegister>());
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       if (value.IsConstant()) {
         __ movl(Address(address, 0),
                 Immediate(CodeGenerator::GetInt32ValueOf(value.GetConstant())));
@@ -2087,7 +2087,7 @@
         __ movl(Address(address, 0), value.AsRegister<CpuRegister>());
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (value.IsConstant()) {
         int64_t v = value.GetConstant()->AsLongConstant()->GetValue();
         DCHECK(IsInt<32>(v));
@@ -2108,7 +2108,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPokeByte(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimByte, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt8, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPokeIntNative(HInvoke* invoke) {
@@ -2116,7 +2116,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPokeIntNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimInt, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt32, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPokeLongNative(HInvoke* invoke) {
@@ -2124,7 +2124,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPokeLongNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimLong, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt64, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitMemoryPokeShortNative(HInvoke* invoke) {
@@ -2132,7 +2132,7 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitMemoryPokeShortNative(HInvoke* invoke) {
-  GenPoke(invoke->GetLocations(), Primitive::kPrimShort, GetAssembler());
+  GenPoke(invoke->GetLocations(), DataType::Type::kInt16, GetAssembler());
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitThreadCurrentThread(HInvoke* invoke) {
@@ -2149,7 +2149,7 @@
 }
 
 static void GenUnsafeGet(HInvoke* invoke,
-                         Primitive::Type type,
+                         DataType::Type type,
                          bool is_volatile ATTRIBUTE_UNUSED,
                          CodeGeneratorX86_64* codegen) {
   X86_64Assembler* assembler = down_cast<X86_64Assembler*>(codegen->GetAssembler());
@@ -2162,11 +2162,11 @@
   CpuRegister output = output_loc.AsRegister<CpuRegister>();
 
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       __ movl(output, Address(base, offset, ScaleFactor::TIMES_1, 0));
       break;
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       if (kEmitCompilerReadBarrier) {
         if (kUseBakerReadBarrier) {
           Address src(base, offset, ScaleFactor::TIMES_1, 0);
@@ -2184,7 +2184,7 @@
       break;
     }
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       __ movq(output, Address(base, offset, ScaleFactor::TIMES_1, 0));
       break;
 
@@ -2234,27 +2234,27 @@
 
 
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGet(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGetVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGetLong(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGetLongVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGetObject(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeGetObjectVolatile(HInvoke* invoke) {
-  GenUnsafeGet(invoke, Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafeGet(invoke, DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 
 
 static void CreateIntIntIntIntToVoidPlusTempsLocations(ArenaAllocator* arena,
-                                                       Primitive::Type type,
+                                                       DataType::Type type,
                                                        HInvoke* invoke) {
   LocationSummary* locations = new (arena) LocationSummary(invoke,
                                                            LocationSummary::kNoCall,
@@ -2263,7 +2263,7 @@
   locations->SetInAt(1, Location::RequiresRegister());
   locations->SetInAt(2, Location::RequiresRegister());
   locations->SetInAt(3, Location::RequiresRegister());
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Need temp registers for card-marking.
     locations->AddTemp(Location::RequiresRegister());  // Possibly used for reference poisoning too.
     locations->AddTemp(Location::RequiresRegister());
@@ -2271,45 +2271,45 @@
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePut(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimInt, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt32, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutOrdered(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimInt, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt32, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutVolatile(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimInt, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt32, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutObject(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimNot, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kReference, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimNot, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kReference, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimNot, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kReference, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutLong(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimLong, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt64, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutLongOrdered(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimLong, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt64, invoke);
 }
 void IntrinsicLocationsBuilderX86_64::VisitUnsafePutLongVolatile(HInvoke* invoke) {
-  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, Primitive::kPrimLong, invoke);
+  CreateIntIntIntIntToVoidPlusTempsLocations(arena_, DataType::Type::kInt64, invoke);
 }
 
 // We don't care for ordered: it requires an AnyStore barrier, which is already given by the x86
 // memory model.
-static void GenUnsafePut(LocationSummary* locations, Primitive::Type type, bool is_volatile,
+static void GenUnsafePut(LocationSummary* locations, DataType::Type type, bool is_volatile,
                          CodeGeneratorX86_64* codegen) {
   X86_64Assembler* assembler = down_cast<X86_64Assembler*>(codegen->GetAssembler());
   CpuRegister base = locations->InAt(1).AsRegister<CpuRegister>();
   CpuRegister offset = locations->InAt(2).AsRegister<CpuRegister>();
   CpuRegister value = locations->InAt(3).AsRegister<CpuRegister>();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     __ movq(Address(base, offset, ScaleFactor::TIMES_1, 0), value);
-  } else if (kPoisonHeapReferences && type == Primitive::kPrimNot) {
+  } else if (kPoisonHeapReferences && type == DataType::Type::kReference) {
     CpuRegister temp = locations->GetTemp(0).AsRegister<CpuRegister>();
     __ movl(temp, value);
     __ PoisonHeapReference(temp);
@@ -2322,7 +2322,7 @@
     codegen->MemoryFence();
   }
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     bool value_can_be_null = true;  // TODO: Worth finding out this information?
     codegen->MarkGCCard(locations->GetTemp(0).AsRegister<CpuRegister>(),
                         locations->GetTemp(1).AsRegister<CpuRegister>(),
@@ -2333,35 +2333,38 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePut(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimInt, /* is_volatile */ true, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt32, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutObject(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutObjectOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ false, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutObjectVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimNot, /* is_volatile */ true, codegen_);
+  GenUnsafePut(
+      invoke->GetLocations(), DataType::Type::kReference, /* is_volatile */ true, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutLong(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutLongOrdered(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ false, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ false, codegen_);
 }
 void IntrinsicCodeGeneratorX86_64::VisitUnsafePutLongVolatile(HInvoke* invoke) {
-  GenUnsafePut(invoke->GetLocations(), Primitive::kPrimLong, /* is_volatile */ true, codegen_);
+  GenUnsafePut(invoke->GetLocations(), DataType::Type::kInt64, /* is_volatile */ true, codegen_);
 }
 
 static void CreateIntIntIntIntIntToInt(ArenaAllocator* arena,
-                                       Primitive::Type type,
+                                       DataType::Type type,
                                        HInvoke* invoke) {
   bool can_call = kEmitCompilerReadBarrier &&
       kUseBakerReadBarrier &&
@@ -2379,7 +2382,7 @@
   locations->SetInAt(4, Location::RequiresRegister());
 
   locations->SetOut(Location::RequiresRegister());
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // Need temporary registers for card-marking, and possibly for
     // (Baker) read barrier.
     locations->AddTemp(Location::RequiresRegister());  // Possibly used for reference poisoning too.
@@ -2388,11 +2391,11 @@
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitUnsafeCASInt(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimInt, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kInt32, invoke);
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitUnsafeCASLong(HInvoke* invoke) {
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimLong, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kInt64, invoke);
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitUnsafeCASObject(HInvoke* invoke) {
@@ -2402,10 +2405,10 @@
     return;
   }
 
-  CreateIntIntIntIntIntToInt(arena_, Primitive::kPrimNot, invoke);
+  CreateIntIntIntIntIntToInt(arena_, DataType::Type::kReference, invoke);
 }
 
-static void GenCAS(Primitive::Type type, HInvoke* invoke, CodeGeneratorX86_64* codegen) {
+static void GenCAS(DataType::Type type, HInvoke* invoke, CodeGeneratorX86_64* codegen) {
   X86_64Assembler* assembler = down_cast<X86_64Assembler*>(codegen->GetAssembler());
   LocationSummary* locations = invoke->GetLocations();
 
@@ -2418,7 +2421,7 @@
   Location out_loc = locations->Out();
   CpuRegister out = out_loc.AsRegister<CpuRegister>();
 
-  if (type == Primitive::kPrimNot) {
+  if (type == DataType::Type::kReference) {
     // The only read barrier implementation supporting the
     // UnsafeCASObject intrinsic is the Baker-style read barriers.
     DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
@@ -2500,9 +2503,9 @@
       __ UnpoisonHeapReference(expected);
     }
   } else {
-    if (type == Primitive::kPrimInt) {
+    if (type == DataType::Type::kInt32) {
       __ LockCmpxchgl(Address(base, offset, TIMES_1, 0), value);
-    } else if (type == Primitive::kPrimLong) {
+    } else if (type == DataType::Type::kInt64) {
       __ LockCmpxchgq(Address(base, offset, TIMES_1, 0), value);
     } else {
       LOG(FATAL) << "Unexpected CAS type " << type;
@@ -2518,11 +2521,11 @@
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeCASInt(HInvoke* invoke) {
-  GenCAS(Primitive::kPrimInt, invoke, codegen_);
+  GenCAS(DataType::Type::kInt32, invoke, codegen_);
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeCASLong(HInvoke* invoke) {
-  GenCAS(Primitive::kPrimLong, invoke, codegen_);
+  GenCAS(DataType::Type::kInt64, invoke, codegen_);
 }
 
 void IntrinsicCodeGeneratorX86_64::VisitUnsafeCASObject(HInvoke* invoke) {
@@ -2530,7 +2533,7 @@
   // UnsafeCASObject intrinsic is the Baker-style read barriers.
   DCHECK(!kEmitCompilerReadBarrier || kUseBakerReadBarrier);
 
-  GenCAS(Primitive::kPrimNot, invoke, codegen_);
+  GenCAS(DataType::Type::kReference, invoke, codegen_);
 }
 
 void IntrinsicLocationsBuilderX86_64::VisitIntegerReverse(HInvoke* invoke) {
diff --git a/compiler/optimizing/licm_test.cc b/compiler/optimizing/licm_test.cc
index 8967d7c..0617e60 100644
--- a/compiler/optimizing/licm_test.cc
+++ b/compiler/optimizing/licm_test.cc
@@ -78,7 +78,7 @@
     parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                    dex::TypeIndex(0),
                                                    0,
-                                                   Primitive::kPrimNot);
+                                                   DataType::Type::kReference);
     entry_->AddInstruction(parameter_);
     int_constant_ = graph_->GetIntConstant(42);
     float_constant_ = graph_->GetFloatConstant(42.0f);
@@ -125,7 +125,7 @@
   // Populate the loop with instructions: set/get field with different types.
   HInstruction* get_field = new (&allocator_) HInstanceFieldGet(parameter_,
                                                                 nullptr,
-                                                                Primitive::kPrimLong,
+                                                                DataType::Type::kInt64,
                                                                 MemberOffset(10),
                                                                 false,
                                                                 kUnknownFieldIndex,
@@ -134,7 +134,7 @@
                                                                 0);
   loop_body_->InsertInstructionBefore(get_field, loop_body_->GetLastInstruction());
   HInstruction* set_field = new (&allocator_) HInstanceFieldSet(
-      parameter_, int_constant_, nullptr, Primitive::kPrimInt, MemberOffset(20),
+      parameter_, int_constant_, nullptr, DataType::Type::kInt32, MemberOffset(20),
       false, kUnknownFieldIndex, kUnknownClassDefIndex, graph_->GetDexFile(), 0);
   loop_body_->InsertInstructionBefore(set_field, loop_body_->GetLastInstruction());
 
@@ -152,7 +152,7 @@
   ScopedNullHandle<mirror::DexCache> dex_cache;
   HInstruction* get_field = new (&allocator_) HInstanceFieldGet(parameter_,
                                                                 nullptr,
-                                                                Primitive::kPrimLong,
+                                                                DataType::Type::kInt64,
                                                                 MemberOffset(10),
                                                                 false,
                                                                 kUnknownFieldIndex,
@@ -163,7 +163,7 @@
   HInstruction* set_field = new (&allocator_) HInstanceFieldSet(parameter_,
                                                                 get_field,
                                                                 nullptr,
-                                                                Primitive::kPrimLong,
+                                                                DataType::Type::kInt64,
                                                                 MemberOffset(10),
                                                                 false,
                                                                 kUnknownFieldIndex,
@@ -184,10 +184,10 @@
 
   // Populate the loop with instructions: set/get array with different types.
   HInstruction* get_array = new (&allocator_) HArrayGet(
-      parameter_, int_constant_, Primitive::kPrimInt, 0);
+      parameter_, int_constant_, DataType::Type::kInt32, 0);
   loop_body_->InsertInstructionBefore(get_array, loop_body_->GetLastInstruction());
   HInstruction* set_array = new (&allocator_) HArraySet(
-      parameter_, int_constant_, float_constant_, Primitive::kPrimFloat, 0);
+      parameter_, int_constant_, float_constant_, DataType::Type::kFloat32, 0);
   loop_body_->InsertInstructionBefore(set_array, loop_body_->GetLastInstruction());
 
   EXPECT_EQ(get_array->GetBlock(), loop_body_);
@@ -202,10 +202,10 @@
 
   // Populate the loop with instructions: set/get array with same types.
   HInstruction* get_array = new (&allocator_) HArrayGet(
-      parameter_, int_constant_, Primitive::kPrimFloat, 0);
+      parameter_, int_constant_, DataType::Type::kFloat32, 0);
   loop_body_->InsertInstructionBefore(get_array, loop_body_->GetLastInstruction());
   HInstruction* set_array = new (&allocator_) HArraySet(
-      parameter_, get_array, float_constant_, Primitive::kPrimFloat, 0);
+      parameter_, get_array, float_constant_, DataType::Type::kFloat32, 0);
   loop_body_->InsertInstructionBefore(set_array, loop_body_->GetLastInstruction());
 
   EXPECT_EQ(get_array->GetBlock(), loop_body_);
diff --git a/compiler/optimizing/load_store_analysis.h b/compiler/optimizing/load_store_analysis.h
index 02bc254..d46b904 100644
--- a/compiler/optimizing/load_store_analysis.h
+++ b/compiler/optimizing/load_store_analysis.h
@@ -369,7 +369,7 @@
   }
 
   void CreateReferenceInfoForReferenceType(HInstruction* instruction) {
-    if (instruction->GetType() != Primitive::kPrimNot) {
+    if (instruction->GetType() != DataType::Type::kReference) {
       return;
     }
     DCHECK(FindReferenceInfoOf(instruction) == nullptr);
diff --git a/compiler/optimizing/load_store_analysis_test.cc b/compiler/optimizing/load_store_analysis_test.cc
index 81344b5..0df2f27 100644
--- a/compiler/optimizing/load_store_analysis_test.cc
+++ b/compiler/optimizing/load_store_analysis_test.cc
@@ -49,16 +49,17 @@
   // array_set1    ArraySet [array, c1, c3]
   // array_set2    ArraySet [array, index, c3]
   HInstruction* array = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* index = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(1), 1, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(1), 1, DataType::Type::kInt32);
   HInstruction* c1 = graph_->GetIntConstant(1);
   HInstruction* c2 = graph_->GetIntConstant(2);
   HInstruction* c3 = graph_->GetIntConstant(3);
-  HInstruction* array_get1 = new (&allocator_) HArrayGet(array, c1, Primitive::kPrimInt, 0);
-  HInstruction* array_get2 = new (&allocator_) HArrayGet(array, c2, Primitive::kPrimInt, 0);
-  HInstruction* array_set1 = new (&allocator_) HArraySet(array, c1, c3, Primitive::kPrimInt, 0);
-  HInstruction* array_set2 = new (&allocator_) HArraySet(array, index, c3, Primitive::kPrimInt, 0);
+  HInstruction* array_get1 = new (&allocator_) HArrayGet(array, c1, DataType::Type::kInt32, 0);
+  HInstruction* array_get2 = new (&allocator_) HArrayGet(array, c2, DataType::Type::kInt32, 0);
+  HInstruction* array_set1 = new (&allocator_) HArraySet(array, c1, c3, DataType::Type::kInt32, 0);
+  HInstruction* array_set2 =
+      new (&allocator_) HArraySet(array, index, c3, DataType::Type::kInt32, 0);
   entry->AddInstruction(array);
   entry->AddInstruction(index);
   entry->AddInstruction(array_get1);
@@ -121,11 +122,11 @@
   HInstruction* object = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                            dex::TypeIndex(0),
                                                            0,
-                                                           Primitive::kPrimNot);
+                                                           DataType::Type::kReference);
   HInstanceFieldSet* set_field10 = new (&allocator_) HInstanceFieldSet(object,
                                                                        c1,
                                                                        nullptr,
-                                                                       Primitive::kPrimInt,
+                                                                       DataType::Type::kInt32,
                                                                        MemberOffset(10),
                                                                        false,
                                                                        kUnknownFieldIndex,
@@ -134,7 +135,7 @@
                                                                        0);
   HInstanceFieldGet* get_field10 = new (&allocator_) HInstanceFieldGet(object,
                                                                        nullptr,
-                                                                       Primitive::kPrimInt,
+                                                                       DataType::Type::kInt32,
                                                                        MemberOffset(10),
                                                                        false,
                                                                        kUnknownFieldIndex,
@@ -143,7 +144,7 @@
                                                                        0);
   HInstanceFieldGet* get_field20 = new (&allocator_) HInstanceFieldGet(object,
                                                                        nullptr,
-                                                                       Primitive::kPrimInt,
+                                                                       DataType::Type::kInt32,
                                                                        MemberOffset(20),
                                                                        false,
                                                                        kUnknownFieldIndex,
@@ -191,26 +192,28 @@
   graph_->BuildDominatorTree();
 
   HInstruction* array = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* index = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(1), 1, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(1), 1, DataType::Type::kInt32);
   HInstruction* c0 = graph_->GetIntConstant(0);
   HInstruction* c1 = graph_->GetIntConstant(1);
   HInstruction* c_neg1 = graph_->GetIntConstant(-1);
-  HInstruction* add0 = new (&allocator_) HAdd(Primitive::kPrimInt, index, c0);
-  HInstruction* add1 = new (&allocator_) HAdd(Primitive::kPrimInt, index, c1);
-  HInstruction* sub0 = new (&allocator_) HSub(Primitive::kPrimInt, index, c0);
-  HInstruction* sub1 = new (&allocator_) HSub(Primitive::kPrimInt, index, c1);
-  HInstruction* sub_neg1 = new (&allocator_) HSub(Primitive::kPrimInt, index, c_neg1);
-  HInstruction* rev_sub1 = new (&allocator_) HSub(Primitive::kPrimInt, c1, index);
-  HInstruction* arr_set1 = new (&allocator_) HArraySet(array, c0, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set2 = new (&allocator_) HArraySet(array, c1, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set3 = new (&allocator_) HArraySet(array, add0, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set4 = new (&allocator_) HArraySet(array, add1, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set5 = new (&allocator_) HArraySet(array, sub0, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set6 = new (&allocator_) HArraySet(array, sub1, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set7 = new (&allocator_) HArraySet(array, rev_sub1, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set8 = new (&allocator_) HArraySet(array, sub_neg1, c0, Primitive::kPrimInt, 0);
+  HInstruction* add0 = new (&allocator_) HAdd(DataType::Type::kInt32, index, c0);
+  HInstruction* add1 = new (&allocator_) HAdd(DataType::Type::kInt32, index, c1);
+  HInstruction* sub0 = new (&allocator_) HSub(DataType::Type::kInt32, index, c0);
+  HInstruction* sub1 = new (&allocator_) HSub(DataType::Type::kInt32, index, c1);
+  HInstruction* sub_neg1 = new (&allocator_) HSub(DataType::Type::kInt32, index, c_neg1);
+  HInstruction* rev_sub1 = new (&allocator_) HSub(DataType::Type::kInt32, c1, index);
+  HInstruction* arr_set1 = new (&allocator_) HArraySet(array, c0, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set2 = new (&allocator_) HArraySet(array, c1, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set3 = new (&allocator_) HArraySet(array, add0, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set4 = new (&allocator_) HArraySet(array, add1, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set5 = new (&allocator_) HArraySet(array, sub0, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set6 = new (&allocator_) HArraySet(array, sub1, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set7 =
+      new (&allocator_) HArraySet(array, rev_sub1, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set8 =
+      new (&allocator_) HArraySet(array, sub_neg1, c0, DataType::Type::kInt32, 0);
 
   entry->AddInstruction(array);
   entry->AddInstruction(index);
@@ -275,9 +278,9 @@
   graph_->BuildDominatorTree();
 
   HInstruction* array = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* index = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(1), 1, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(1), 1, DataType::Type::kInt32);
 
   HInstruction* c0 = graph_->GetIntConstant(0);
   HInstruction* c_0x80000000 = graph_->GetIntConstant(0x80000000);
@@ -287,34 +290,41 @@
   HInstruction* c_0x80000001 = graph_->GetIntConstant(0x80000001);
 
   // `index+0x80000000` and `index-0x80000000` array indices MAY alias.
-  HInstruction* add_0x80000000 = new (&allocator_) HAdd(Primitive::kPrimInt, index, c_0x80000000);
-  HInstruction* sub_0x80000000 = new (&allocator_) HSub(Primitive::kPrimInt, index, c_0x80000000);
+  HInstruction* add_0x80000000 = new (&allocator_) HAdd(
+      DataType::Type::kInt32, index, c_0x80000000);
+  HInstruction* sub_0x80000000 = new (&allocator_) HSub(
+      DataType::Type::kInt32, index, c_0x80000000);
   HInstruction* arr_set_1 = new (&allocator_) HArraySet(
-      array, add_0x80000000, c0, Primitive::kPrimInt, 0);
+      array, add_0x80000000, c0, DataType::Type::kInt32, 0);
   HInstruction* arr_set_2 = new (&allocator_) HArraySet(
-      array, sub_0x80000000, c0, Primitive::kPrimInt, 0);
+      array, sub_0x80000000, c0, DataType::Type::kInt32, 0);
 
   // `index+0x10` and `index-0xFFFFFFF0` array indices MAY alias.
-  HInstruction* add_0x10 = new (&allocator_) HAdd(Primitive::kPrimInt, index, c_0x10);
-  HInstruction* sub_0xFFFFFFF0 = new (&allocator_) HSub(Primitive::kPrimInt, index, c_0xFFFFFFF0);
+  HInstruction* add_0x10 = new (&allocator_) HAdd(DataType::Type::kInt32, index, c_0x10);
+  HInstruction* sub_0xFFFFFFF0 = new (&allocator_) HSub(
+      DataType::Type::kInt32, index, c_0xFFFFFFF0);
   HInstruction* arr_set_3 = new (&allocator_) HArraySet(
-      array, add_0x10, c0, Primitive::kPrimInt, 0);
+      array, add_0x10, c0, DataType::Type::kInt32, 0);
   HInstruction* arr_set_4 = new (&allocator_) HArraySet(
-      array, sub_0xFFFFFFF0, c0, Primitive::kPrimInt, 0);
+      array, sub_0xFFFFFFF0, c0, DataType::Type::kInt32, 0);
 
   // `index+0x7FFFFFFF` and `index-0x80000001` array indices MAY alias.
-  HInstruction* add_0x7FFFFFFF = new (&allocator_) HAdd(Primitive::kPrimInt, index, c_0x7FFFFFFF);
-  HInstruction* sub_0x80000001 = new (&allocator_) HSub(Primitive::kPrimInt, index, c_0x80000001);
+  HInstruction* add_0x7FFFFFFF = new (&allocator_) HAdd(
+      DataType::Type::kInt32, index, c_0x7FFFFFFF);
+  HInstruction* sub_0x80000001 = new (&allocator_) HSub(
+      DataType::Type::kInt32, index, c_0x80000001);
   HInstruction* arr_set_5 = new (&allocator_) HArraySet(
-      array, add_0x7FFFFFFF, c0, Primitive::kPrimInt, 0);
+      array, add_0x7FFFFFFF, c0, DataType::Type::kInt32, 0);
   HInstruction* arr_set_6 = new (&allocator_) HArraySet(
-      array, sub_0x80000001, c0, Primitive::kPrimInt, 0);
+      array, sub_0x80000001, c0, DataType::Type::kInt32, 0);
 
   // `index+0` and `index-0` array indices MAY alias.
-  HInstruction* add_0 = new (&allocator_) HAdd(Primitive::kPrimInt, index, c0);
-  HInstruction* sub_0 = new (&allocator_) HSub(Primitive::kPrimInt, index, c0);
-  HInstruction* arr_set_7 = new (&allocator_) HArraySet(array, add_0, c0, Primitive::kPrimInt, 0);
-  HInstruction* arr_set_8 = new (&allocator_) HArraySet(array, sub_0, c0, Primitive::kPrimInt, 0);
+  HInstruction* add_0 = new (&allocator_) HAdd(DataType::Type::kInt32, index, c0);
+  HInstruction* sub_0 = new (&allocator_) HSub(DataType::Type::kInt32, index, c0);
+  HInstruction* arr_set_7 = new (&allocator_) HArraySet(
+      array, add_0, c0, DataType::Type::kInt32, 0);
+  HInstruction* arr_set_8 = new (&allocator_) HArraySet(
+      array, sub_0, c0, DataType::Type::kInt32, 0);
 
   entry->AddInstruction(array);
   entry->AddInstruction(index);
diff --git a/compiler/optimizing/load_store_elimination.cc b/compiler/optimizing/load_store_elimination.cc
index 8a9acf1..bd14f2b 100644
--- a/compiler/optimizing/load_store_elimination.cc
+++ b/compiler/optimizing/load_store_elimination.cc
@@ -271,21 +271,21 @@
     }
   }
 
-  HInstruction* GetDefaultValue(Primitive::Type type) {
+  HInstruction* GetDefaultValue(DataType::Type type) {
     switch (type) {
-      case Primitive::kPrimNot:
+      case DataType::Type::kReference:
         return GetGraph()->GetNullConstant();
-      case Primitive::kPrimBoolean:
-      case Primitive::kPrimByte:
-      case Primitive::kPrimChar:
-      case Primitive::kPrimShort:
-      case Primitive::kPrimInt:
+      case DataType::Type::kBool:
+      case DataType::Type::kInt8:
+      case DataType::Type::kUint16:
+      case DataType::Type::kInt16:
+      case DataType::Type::kInt32:
         return GetGraph()->GetIntConstant(0);
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         return GetGraph()->GetLongConstant(0);
-      case Primitive::kPrimFloat:
+      case DataType::Type::kFloat32:
         return GetGraph()->GetFloatConstant(0);
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat64:
         return GetGraph()->GetDoubleConstant(0);
       default:
         UNREACHABLE();
@@ -328,8 +328,7 @@
       // This acts like GVN but with better aliasing analysis.
       heap_values[idx] = instruction;
     } else {
-      if (Primitive::PrimitiveKind(heap_value->GetType())
-              != Primitive::PrimitiveKind(instruction->GetType())) {
+      if (DataType::Kind(heap_value->GetType()) != DataType::Kind(instruction->GetType())) {
         // The only situation where the same heap location has different type is when
         // we do an array get on an instruction that originates from the null constant
         // (the null could be behind a field access, an array access, a null check or
diff --git a/compiler/optimizing/loop_optimization.cc b/compiler/optimizing/loop_optimization.cc
index 6f8743b..7e37018 100644
--- a/compiler/optimizing/loop_optimization.cc
+++ b/compiler/optimizing/loop_optimization.cc
@@ -71,11 +71,17 @@
   return false;
 }
 
+// Forward declaration.
+static bool IsZeroExtensionAndGet(HInstruction* instruction,
+                                  DataType::Type type,
+                                  /*out*/ HInstruction** operand,
+                                  bool to64 = false);
+
 // Detect a sign extension in instruction from the given type. The to64 parameter
 // denotes if result is long, and thus sign extension from int can be included.
 // Returns the promoted operand on success.
 static bool IsSignExtensionAndGet(HInstruction* instruction,
-                                  Primitive::Type type,
+                                  DataType::Type type,
                                   /*out*/ HInstruction** operand,
                                   bool to64 = false) {
   // Accept any already wider constant that would be handled properly by sign
@@ -84,20 +90,20 @@
   int64_t value = 0;
   if (IsInt64AndGet(instruction, /*out*/ &value)) {
     switch (type) {
-      case Primitive::kPrimByte:
+      case DataType::Type::kInt8:
         if (IsInt<8>(value)) {
           *operand = instruction;
           return true;
         }
         return false;
-      case Primitive::kPrimChar:
-      case Primitive::kPrimShort:
+      case DataType::Type::kUint16:
+      case DataType::Type::kInt16:
         if (IsInt<16>(value)) {
           *operand = instruction;
           return true;
         }
         return false;
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         if (IsInt<32>(value)) {
           *operand = instruction;
           return to64;
@@ -113,20 +119,30 @@
                                          instruction->IsStaticFieldGet() ||
                                          instruction->IsInstanceFieldGet())) {
     switch (type) {
-      case Primitive::kPrimByte:
-      case Primitive::kPrimShort:
+      case DataType::Type::kInt8:
+      case DataType::Type::kInt16:
         *operand = instruction;
         return true;
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         *operand = instruction;
         return to64;
       default:
         return false;
     }
   }
-  // Explicit type conversion to long.
-  if (instruction->IsTypeConversion() && instruction->GetType() == Primitive::kPrimLong) {
-    return IsSignExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, /*to64*/ true);
+  // Explicit type conversions.
+  if (instruction->IsTypeConversion()) {
+    DataType::Type from = instruction->InputAt(0)->GetType();
+    switch (instruction->GetType()) {
+      case DataType::Type::kInt64:
+        return IsSignExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, /*to64*/ true);
+      case DataType::Type::kInt16:
+        return type == DataType::Type::kUint16 &&
+               from == DataType::Type::kUint16 &&
+               IsZeroExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, to64);
+      default:
+        return false;
+    }
   }
   return false;
 }
@@ -135,29 +151,29 @@
 // denotes if result is long, and thus zero extension from int can be included.
 // Returns the promoted operand on success.
 static bool IsZeroExtensionAndGet(HInstruction* instruction,
-                                  Primitive::Type type,
+                                  DataType::Type type,
                                   /*out*/ HInstruction** operand,
-                                  bool to64 = false) {
+                                  bool to64) {
   // Accept any already wider constant that would be handled properly by zero
   // extension when represented in the *width* of the given narrower data type
   // (the fact that byte/short/int normally sign extend does not matter here).
   int64_t value = 0;
   if (IsInt64AndGet(instruction, /*out*/ &value)) {
     switch (type) {
-      case Primitive::kPrimByte:
+      case DataType::Type::kInt8:
         if (IsUint<8>(value)) {
           *operand = instruction;
           return true;
         }
         return false;
-      case Primitive::kPrimChar:
-      case Primitive::kPrimShort:
+      case DataType::Type::kUint16:
+      case DataType::Type::kInt16:
         if (IsUint<16>(value)) {
           *operand = instruction;
           return true;
         }
         return false;
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         if (IsUint<32>(value)) {
           *operand = instruction;
           return to64;
@@ -172,7 +188,7 @@
   if (instruction->GetType() == type && (instruction->IsArrayGet() ||
                                          instruction->IsStaticFieldGet() ||
                                          instruction->IsInstanceFieldGet())) {
-    if (type == Primitive::kPrimChar) {
+    if (type == DataType::Type::kUint16) {
       *operand = instruction;
       return true;
     }
@@ -189,20 +205,30 @@
         (IsInt64AndGet(b, /*out*/ &mask) && (IsSignExtensionAndGet(a, type, /*out*/ operand) ||
                                              IsZeroExtensionAndGet(a, type, /*out*/ operand)))) {
       switch ((*operand)->GetType()) {
-        case Primitive::kPrimByte:
+        case DataType::Type::kInt8:
           return mask == std::numeric_limits<uint8_t>::max();
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
           return mask == std::numeric_limits<uint16_t>::max();
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           return mask == std::numeric_limits<uint32_t>::max() && to64;
         default: return false;
       }
     }
   }
-  // Explicit type conversion to long.
-  if (instruction->IsTypeConversion() && instruction->GetType() == Primitive::kPrimLong) {
-    return IsZeroExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, /*to64*/ true);
+  // Explicit type conversions.
+  if (instruction->IsTypeConversion()) {
+    DataType::Type from = instruction->InputAt(0)->GetType();
+    switch (instruction->GetType()) {
+      case DataType::Type::kInt64:
+        return IsZeroExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, /*to64*/ true);
+      case DataType::Type::kUint16:
+        return type == DataType::Type::kInt16 &&
+               from == DataType::Type::kInt16 &&
+               IsSignExtensionAndGet(instruction->InputAt(0), type, /*out*/ operand, to64);
+      default:
+        return false;
+    }
   }
   return false;
 }
@@ -211,7 +237,7 @@
 // Returns true on success and sets is_unsigned accordingly.
 static bool IsNarrowerOperands(HInstruction* a,
                                HInstruction* b,
-                               Primitive::Type type,
+                               DataType::Type type,
                                /*out*/ HInstruction** r,
                                /*out*/ HInstruction** s,
                                /*out*/ bool* is_unsigned) {
@@ -227,7 +253,7 @@
 
 // As above, single operand.
 static bool IsNarrowerOperand(HInstruction* a,
-                              Primitive::Type type,
+                              DataType::Type type,
                               /*out*/ HInstruction** r,
                               /*out*/ bool* is_unsigned) {
   if (IsSignExtensionAndGet(a, type, r)) {
@@ -241,44 +267,44 @@
 }
 
 // Compute relative vector length based on type difference.
-static size_t GetOtherVL(Primitive::Type other_type, Primitive::Type vector_type, size_t vl) {
+static size_t GetOtherVL(DataType::Type other_type, DataType::Type vector_type, size_t vl) {
   switch (other_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
       switch (vector_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte: return vl;
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8: return vl;
         default: break;
       }
       return vl;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       switch (vector_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte: return vl >> 1;
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort: return vl;
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8: return vl >> 1;
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16: return vl;
         default: break;
       }
       break;
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (vector_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte: return vl >> 2;
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort: return vl >> 1;
-        case Primitive::kPrimInt: return vl;
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8: return vl >> 2;
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16: return vl >> 1;
+        case DataType::Type::kInt32: return vl;
         default: break;
       }
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (vector_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte: return vl >> 3;
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort: return vl >> 2;
-        case Primitive::kPrimInt: return vl >> 1;
-        case Primitive::kPrimLong: return vl;
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8: return vl >> 3;
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16: return vl >> 2;
+        case DataType::Type::kInt32: return vl >> 1;
+        case DataType::Type::kInt64: return vl;
         default: break;
       }
       break;
@@ -815,8 +841,9 @@
   vector_body_ = block;
 
   // Loop induction type.
-  Primitive::Type induc_type = main_phi->GetType();
-  DCHECK(induc_type == Primitive::kPrimInt || induc_type == Primitive::kPrimLong) << induc_type;
+  DataType::Type induc_type = main_phi->GetType();
+  DCHECK(induc_type == DataType::Type::kInt32 || induc_type == DataType::Type::kInt64)
+      << induc_type;
 
   // Generate dynamic loop peeling trip count, if needed, under the assumption
   // that the Android runtime guarantees at least "component size" alignment:
@@ -939,7 +966,7 @@
                                         HInstruction* step,
                                         uint32_t unroll) {
   DCHECK(unroll == 1 || vector_mode_ == kVector);
-  Primitive::Type induc_type = lo->GetType();
+  DataType::Type induc_type = lo->GetType();
   // Prepare new loop.
   vector_preheader_ = new_preheader,
   vector_header_ = vector_preheader_->GetSingleSuccessor();
@@ -1003,7 +1030,7 @@
   // (4) vectorizable right-hand-side value.
   uint64_t restrictions = kNone;
   if (instruction->IsArraySet()) {
-    Primitive::Type type = instruction->AsArraySet()->GetComponentType();
+    DataType::Type type = instruction->AsArraySet()->GetComponentType();
     HInstruction* base = instruction->InputAt(0);
     HInstruction* index = instruction->InputAt(1);
     HInstruction* value = instruction->InputAt(2);
@@ -1027,7 +1054,7 @@
   // (2) vectorizable right-hand-side value.
   auto redit = reductions_->find(instruction);
   if (redit != reductions_->end()) {
-    Primitive::Type type = instruction->GetType();
+    DataType::Type type = instruction->GetType();
     // Recognize SAD idiom or direct reduction.
     if (VectorizeSADIdiom(node, instruction, generate_code, type, restrictions) ||
         (TrySetVectorType(type, &restrictions) &&
@@ -1054,7 +1081,7 @@
 bool HLoopOptimization::VectorizeUse(LoopNode* node,
                                      HInstruction* instruction,
                                      bool generate_code,
-                                     Primitive::Type type,
+                                     DataType::Type type,
                                      uint64_t restrictions) {
   // Accept anything for which code has already been generated.
   if (generate_code) {
@@ -1115,12 +1142,12 @@
     // Accept particular type conversions.
     HTypeConversion* conversion = instruction->AsTypeConversion();
     HInstruction* opa = conversion->InputAt(0);
-    Primitive::Type from = conversion->GetInputType();
-    Primitive::Type to = conversion->GetResultType();
-    if (Primitive::IsIntegralType(from) && Primitive::IsIntegralType(to)) {
-      size_t size_vec = Primitive::ComponentSize(type);
-      size_t size_from = Primitive::ComponentSize(from);
-      size_t size_to = Primitive::ComponentSize(to);
+    DataType::Type from = conversion->GetInputType();
+    DataType::Type to = conversion->GetResultType();
+    if (DataType::IsIntegralType(from) && DataType::IsIntegralType(to)) {
+      size_t size_vec = DataType::Size(type);
+      size_t size_from = DataType::Size(from);
+      size_t size_to = DataType::Size(to);
       // Accept an integral conversion
       // (1a) narrowing into vector type, "wider" operations cannot bring in higher order bits, or
       // (1b) widening from at least vector type, and
@@ -1140,7 +1167,7 @@
         }
         return true;
       }
-    } else if (to == Primitive::kPrimFloat && from == Primitive::kPrimInt) {
+    } else if (to == DataType::Type::kFloat32 && from == DataType::Type::kInt32) {
       DCHECK_EQ(to, type);
       // Accept int to float conversion for
       // (1) supported int,
@@ -1215,7 +1242,7 @@
     if (VectorizeUse(node, r, generate_code, type, restrictions) &&
         IsInt64AndGet(opb, /*out*/ &distance)) {
       // Restrict shift distance to packed data type width.
-      int64_t max_distance = Primitive::ComponentSize(type) * 8;
+      int64_t max_distance = DataType::Size(type) * 8;
       if (0 <= distance && distance < max_distance) {
         if (generate_code) {
           GenerateVecOp(instruction, vector_map_->Get(r), opb, type);
@@ -1298,7 +1325,7 @@
   return false;
 }
 
-bool HLoopOptimization::TrySetVectorType(Primitive::Type type, uint64_t* restrictions) {
+bool HLoopOptimization::TrySetVectorType(DataType::Type type, uint64_t* restrictions) {
   const InstructionSetFeatures* features = compiler_driver_->GetInstructionSetFeatures();
   switch (compiler_driver_->GetInstructionSet()) {
     case kArm:
@@ -1306,15 +1333,15 @@
       // Allow vectorization for all ARM devices, because Android assumes that
       // ARM 32-bit always supports advanced SIMD (64-bit SIMD).
       switch (type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8:
           *restrictions |= kNoDiv | kNoReduction;
           return TrySetVectorLength(8);
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
           *restrictions |= kNoDiv | kNoStringCharAt | kNoReduction;
           return TrySetVectorLength(4);
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           *restrictions |= kNoDiv | kNoReduction;
           return TrySetVectorLength(2);
         default:
@@ -1325,24 +1352,24 @@
       // Allow vectorization for all ARM devices, because Android assumes that
       // ARMv8 AArch64 always supports advanced SIMD (128-bit SIMD).
       switch (type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8:
           *restrictions |= kNoDiv;
           return TrySetVectorLength(16);
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
           *restrictions |= kNoDiv;
           return TrySetVectorLength(8);
-        case Primitive::kPrimInt:
+        case DataType::Type::kInt32:
           *restrictions |= kNoDiv;
           return TrySetVectorLength(4);
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           *restrictions |= kNoDiv | kNoMul | kNoMinMax;
           return TrySetVectorLength(2);
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           *restrictions |= kNoReduction;
           return TrySetVectorLength(4);
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           *restrictions |= kNoReduction;
           return TrySetVectorLength(2);
         default:
@@ -1353,25 +1380,25 @@
       // Allow vectorization for SSE4.1-enabled X86 devices only (128-bit SIMD).
       if (features->AsX86InstructionSetFeatures()->HasSSE4_1()) {
         switch (type) {
-          case Primitive::kPrimBoolean:
-          case Primitive::kPrimByte:
+          case DataType::Type::kBool:
+          case DataType::Type::kInt8:
             *restrictions |=
                 kNoMul | kNoDiv | kNoShift | kNoAbs | kNoSignedHAdd | kNoUnroundedHAdd | kNoSAD;
             return TrySetVectorLength(16);
-          case Primitive::kPrimChar:
-          case Primitive::kPrimShort:
+          case DataType::Type::kUint16:
+          case DataType::Type::kInt16:
             *restrictions |= kNoDiv | kNoAbs | kNoSignedHAdd | kNoUnroundedHAdd | kNoSAD;
             return TrySetVectorLength(8);
-          case Primitive::kPrimInt:
+          case DataType::Type::kInt32:
             *restrictions |= kNoDiv | kNoSAD;
             return TrySetVectorLength(4);
-          case Primitive::kPrimLong:
+          case DataType::Type::kInt64:
             *restrictions |= kNoMul | kNoDiv | kNoShr | kNoAbs | kNoMinMax | kNoSAD;
             return TrySetVectorLength(2);
-          case Primitive::kPrimFloat:
+          case DataType::Type::kFloat32:
             *restrictions |= kNoMinMax | kNoReduction;  // minmax: -0.0 vs +0.0
             return TrySetVectorLength(4);
-          case Primitive::kPrimDouble:
+          case DataType::Type::kFloat64:
             *restrictions |= kNoMinMax | kNoReduction;  // minmax: -0.0 vs +0.0
             return TrySetVectorLength(2);
           default:
@@ -1382,24 +1409,24 @@
     case kMips:
       if (features->AsMipsInstructionSetFeatures()->HasMsa()) {
         switch (type) {
-          case Primitive::kPrimBoolean:
-          case Primitive::kPrimByte:
+          case DataType::Type::kBool:
+          case DataType::Type::kInt8:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(16);
-          case Primitive::kPrimChar:
-          case Primitive::kPrimShort:
+          case DataType::Type::kUint16:
+          case DataType::Type::kInt16:
             *restrictions |= kNoDiv | kNoStringCharAt | kNoReduction | kNoSAD;
             return TrySetVectorLength(8);
-          case Primitive::kPrimInt:
+          case DataType::Type::kInt32:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(4);
-          case Primitive::kPrimLong:
+          case DataType::Type::kInt64:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(2);
-          case Primitive::kPrimFloat:
+          case DataType::Type::kFloat32:
             *restrictions |= kNoMinMax | kNoReduction;  // min/max(x, NaN)
             return TrySetVectorLength(4);
-          case Primitive::kPrimDouble:
+          case DataType::Type::kFloat64:
             *restrictions |= kNoMinMax | kNoReduction;  // min/max(x, NaN)
             return TrySetVectorLength(2);
           default:
@@ -1410,24 +1437,24 @@
     case kMips64:
       if (features->AsMips64InstructionSetFeatures()->HasMsa()) {
         switch (type) {
-          case Primitive::kPrimBoolean:
-          case Primitive::kPrimByte:
+          case DataType::Type::kBool:
+          case DataType::Type::kInt8:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(16);
-          case Primitive::kPrimChar:
-          case Primitive::kPrimShort:
+          case DataType::Type::kUint16:
+          case DataType::Type::kInt16:
             *restrictions |= kNoDiv | kNoStringCharAt | kNoReduction | kNoSAD;
             return TrySetVectorLength(8);
-          case Primitive::kPrimInt:
+          case DataType::Type::kInt32:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(4);
-          case Primitive::kPrimLong:
+          case DataType::Type::kInt64:
             *restrictions |= kNoDiv | kNoReduction | kNoSAD;
             return TrySetVectorLength(2);
-          case Primitive::kPrimFloat:
+          case DataType::Type::kFloat32:
             *restrictions |= kNoMinMax | kNoReduction;  // min/max(x, NaN)
             return TrySetVectorLength(4);
-          case Primitive::kPrimDouble:
+          case DataType::Type::kFloat64:
             *restrictions |= kNoMinMax | kNoReduction;  // min/max(x, NaN)
             return TrySetVectorLength(2);
           default:
@@ -1452,7 +1479,7 @@
   return vector_length_ == length;
 }
 
-void HLoopOptimization::GenerateVecInv(HInstruction* org, Primitive::Type type) {
+void HLoopOptimization::GenerateVecInv(HInstruction* org, DataType::Type type) {
   if (vector_map_->find(org) == vector_map_->end()) {
     // In scalar code, just use a self pass-through for scalar invariants
     // (viz. expression remains itself).
@@ -1468,9 +1495,9 @@
     } else {
       // Generates ReplicateScalar( (optional_type_conv) org ).
       HInstruction* input = org;
-      Primitive::Type input_type = input->GetType();
-      if (type != input_type && (type == Primitive::kPrimLong ||
-                                 input_type == Primitive::kPrimLong)) {
+      DataType::Type input_type = input->GetType();
+      if (type != input_type && (type == DataType::Type::kInt64 ||
+                                 input_type == DataType::Type::kInt64)) {
         input = Insert(vector_preheader_,
                        new (global_allocator_) HTypeConversion(type, input, kNoDexPc));
       }
@@ -1487,7 +1514,7 @@
     HInstruction* subscript = vector_index_;
     int64_t value = 0;
     if (!IsInt64AndGet(offset, &value) || value != 0) {
-      subscript = new (global_allocator_) HAdd(Primitive::kPrimInt, subscript, offset);
+      subscript = new (global_allocator_) HAdd(DataType::Type::kInt32, subscript, offset);
       if (org->IsPhi()) {
         Insert(vector_body_, subscript);  // lacks layout placeholder
       }
@@ -1500,7 +1527,7 @@
                                        HInstruction* opa,
                                        HInstruction* opb,
                                        HInstruction* offset,
-                                       Primitive::Type type) {
+                                       DataType::Type type) {
   HInstruction* vector = nullptr;
   if (vector_mode_ == kVector) {
     // Vector store or load.
@@ -1570,7 +1597,7 @@
     // Generate a [initial, 0, .., 0] vector.
     HVecOperation* red_vector = new_red->AsVecOperation();
     size_t vector_length = red_vector->GetVectorLength();
-    Primitive::Type type = red_vector->GetPackedType();
+    DataType::Type type = red_vector->GetPackedType();
     new_init = Insert(vector_preheader_,
                       new (global_allocator_) HVecSetScalars(global_allocator_,
                                                              &new_init,
@@ -1594,7 +1621,7 @@
     if (input->IsVecOperation()) {
       HVecOperation* input_vector = input->AsVecOperation();
       size_t vector_length = input_vector->GetVectorLength();
-      Primitive::Type type = input_vector->GetPackedType();
+      DataType::Type type = input_vector->GetPackedType();
       HVecReduce::ReductionKind kind = GetReductionKind(input_vector);
       HBasicBlock* exit = instruction->GetBlock()->GetSuccessors()[0];
       // Generate a vector reduction and scalar extract
@@ -1624,10 +1651,10 @@
 void HLoopOptimization::GenerateVecOp(HInstruction* org,
                                       HInstruction* opa,
                                       HInstruction* opb,
-                                      Primitive::Type type,
+                                      DataType::Type type,
                                       bool is_unsigned) {
   HInstruction* vector = nullptr;
-  Primitive::Type org_type = org->GetType();
+  DataType::Type org_type = org->GetType();
   switch (org->GetKind()) {
     case HInstruction::kNeg:
       DCHECK(opb == nullptr);
@@ -1779,7 +1806,7 @@
 bool HLoopOptimization::VectorizeHalvingAddIdiom(LoopNode* node,
                                                  HInstruction* instruction,
                                                  bool generate_code,
-                                                 Primitive::Type type,
+                                                 DataType::Type type,
                                                  uint64_t restrictions) {
   // Test for top level arithmetic shift right x >> 1 or logical shift right x >>> 1
   // (note whether the sign bit in wider precision is shifted in has no effect
@@ -1853,12 +1880,12 @@
 bool HLoopOptimization::VectorizeSADIdiom(LoopNode* node,
                                           HInstruction* instruction,
                                           bool generate_code,
-                                          Primitive::Type reduction_type,
+                                          DataType::Type reduction_type,
                                           uint64_t restrictions) {
   // Filter integral "q += ABS(a - b);" reduction, where ABS and SUB
   // are done in the same precision (either int or long).
   if (!instruction->IsAdd() ||
-      (reduction_type != Primitive::kPrimInt && reduction_type != Primitive::kPrimLong)) {
+      (reduction_type != DataType::Type::kInt32 && reduction_type != DataType::Type::kInt64)) {
     return false;
   }
   HInstruction* q = instruction->InputAt(0);
@@ -1882,11 +1909,19 @@
   HInstruction* r = a;
   HInstruction* s = b;
   bool is_unsigned = false;
-  Primitive::Type sub_type = a->GetType();
+  DataType::Type sub_type = a->GetType();
   if (a->IsTypeConversion()) {
-    sub_type = a->InputAt(0)->GetType();
+    HInstruction* hunt = a;
+    while (hunt->IsTypeConversion()) {
+      hunt = hunt->InputAt(0);
+    }
+    sub_type = hunt->GetType();
   } else if (b->IsTypeConversion()) {
-    sub_type = b->InputAt(0)->GetType();
+    HInstruction* hunt = a;
+    while (hunt->IsTypeConversion()) {
+      hunt = hunt->InputAt(0);
+    }
+    sub_type = hunt->GetType();
   }
   if (reduction_type != sub_type &&
       (!IsNarrowerOperands(a, b, sub_type, &r, &s, &is_unsigned) || is_unsigned)) {
diff --git a/compiler/optimizing/loop_optimization.h b/compiler/optimizing/loop_optimization.h
index ae2ea76..6e6e387 100644
--- a/compiler/optimizing/loop_optimization.h
+++ b/compiler/optimizing/loop_optimization.h
@@ -91,7 +91,7 @@
    * Representation of a unit-stride array reference.
    */
   struct ArrayReference {
-    ArrayReference(HInstruction* b, HInstruction* o, Primitive::Type t, bool l)
+    ArrayReference(HInstruction* b, HInstruction* o, DataType::Type t, bool l)
         : base(b), offset(o), type(t), lhs(l) { }
     bool operator<(const ArrayReference& other) const {
       return
@@ -103,7 +103,7 @@
     }
     HInstruction* base;    // base address
     HInstruction* offset;  // offset + i
-    Primitive::Type type;  // component type
+    DataType::Type type;   // component type
     bool lhs;              // def/use
   };
 
@@ -147,36 +147,36 @@
   bool VectorizeUse(LoopNode* node,
                     HInstruction* instruction,
                     bool generate_code,
-                    Primitive::Type type,
+                    DataType::Type type,
                     uint64_t restrictions);
-  bool TrySetVectorType(Primitive::Type type, /*out*/ uint64_t* restrictions);
+  bool TrySetVectorType(DataType::Type type, /*out*/ uint64_t* restrictions);
   bool TrySetVectorLength(uint32_t length);
-  void GenerateVecInv(HInstruction* org, Primitive::Type type);
+  void GenerateVecInv(HInstruction* org, DataType::Type type);
   void GenerateVecSub(HInstruction* org, HInstruction* offset);
   void GenerateVecMem(HInstruction* org,
                       HInstruction* opa,
                       HInstruction* opb,
                       HInstruction* offset,
-                      Primitive::Type type);
+                      DataType::Type type);
   void GenerateVecReductionPhi(HPhi* phi);
   void GenerateVecReductionPhiInputs(HPhi* phi, HInstruction* reduction);
   HInstruction* ReduceAndExtractIfNeeded(HInstruction* instruction);
   void GenerateVecOp(HInstruction* org,
                      HInstruction* opa,
                      HInstruction* opb,
-                     Primitive::Type type,
+                     DataType::Type type,
                      bool is_unsigned = false);
 
   // Vectorization idioms.
   bool VectorizeHalvingAddIdiom(LoopNode* node,
                                 HInstruction* instruction,
                                 bool generate_code,
-                                Primitive::Type type,
+                                DataType::Type type,
                                 uint64_t restrictions);
   bool VectorizeSADIdiom(LoopNode* node,
                          HInstruction* instruction,
                          bool generate_code,
-                         Primitive::Type type,
+                         DataType::Type type,
                          uint64_t restrictions);
 
   // Vectorization heuristics.
diff --git a/compiler/optimizing/loop_optimization_test.cc b/compiler/optimizing/loop_optimization_test.cc
index 1c5603d..95718ae 100644
--- a/compiler/optimizing/loop_optimization_test.cc
+++ b/compiler/optimizing/loop_optimization_test.cc
@@ -51,7 +51,7 @@
     parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                    dex::TypeIndex(0),
                                                    0,
-                                                   Primitive::kPrimInt);
+                                                   DataType::Type::kInt32);
     entry_block_->AddInstruction(parameter_);
     return_block_->AddInstruction(new (&allocator_) HReturnVoid());
     exit_block_->AddInstruction(new (&allocator_) HExit());
@@ -216,8 +216,8 @@
   header->AddInstruction(new (&allocator_) HIf(parameter_));
   body->AddInstruction(new (&allocator_) HGoto());
 
-  HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, Primitive::kPrimInt);
-  HInstruction* add = new (&allocator_) HAdd(Primitive::kPrimInt, phi, parameter_);
+  HPhi* phi = new (&allocator_) HPhi(&allocator_, 0, 0, DataType::Type::kInt32);
+  HInstruction* add = new (&allocator_) HAdd(DataType::Type::kInt32, phi, parameter_);
   header->AddPhi(phi);
   body->AddInstruction(add);
 
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index 9cff6b0..41ea998 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -564,7 +564,7 @@
   // id and/or any invariants the graph is assuming when adding new instructions.
   if ((cached_current_method_ == nullptr) || (cached_current_method_->GetBlock() == nullptr)) {
     cached_current_method_ = new (arena_) HCurrentMethod(
-        Is64BitInstructionSet(instruction_set_) ? Primitive::kPrimLong : Primitive::kPrimInt,
+        Is64BitInstructionSet(instruction_set_) ? DataType::Type::kInt64 : DataType::Type::kInt32,
         entry_block_->GetDexPc());
     if (entry_block_->GetFirstInstruction() == nullptr) {
       entry_block_->AddInstruction(cached_current_method_);
@@ -585,19 +585,19 @@
   return dex_file_.PrettyMethod(method_idx_, with_signature);
 }
 
-HConstant* HGraph::GetConstant(Primitive::Type type, int64_t value, uint32_t dex_pc) {
+HConstant* HGraph::GetConstant(DataType::Type type, int64_t value, uint32_t dex_pc) {
   switch (type) {
-    case Primitive::Type::kPrimBoolean:
+    case DataType::Type::kBool:
       DCHECK(IsUint<1>(value));
       FALLTHROUGH_INTENDED;
-    case Primitive::Type::kPrimByte:
-    case Primitive::Type::kPrimChar:
-    case Primitive::Type::kPrimShort:
-    case Primitive::Type::kPrimInt:
-      DCHECK(IsInt(Primitive::ComponentSize(type) * kBitsPerByte, value));
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+    case DataType::Type::kInt32:
+      DCHECK(IsInt(DataType::Size(type) * kBitsPerByte, value));
       return GetIntConstant(static_cast<int32_t>(value), dex_pc);
 
-    case Primitive::Type::kPrimLong:
+    case DataType::Type::kInt64:
       return GetLongConstant(value, dex_pc);
 
     default:
@@ -838,9 +838,9 @@
     // We can only replace a control flow instruction with another control flow instruction.
     DCHECK(replacement->IsControlFlow());
     DCHECK_EQ(replacement->GetId(), -1);
-    DCHECK_EQ(replacement->GetType(), Primitive::kPrimVoid);
+    DCHECK_EQ(replacement->GetType(), DataType::Type::kVoid);
     DCHECK_EQ(initial->GetBlock(), this);
-    DCHECK_EQ(initial->GetType(), Primitive::kPrimVoid);
+    DCHECK_EQ(initial->GetType(), DataType::Type::kVoid);
     DCHECK(initial->GetUses().empty());
     DCHECK(initial->GetEnvUses().empty());
     replacement->SetBlock(this);
@@ -1219,7 +1219,7 @@
 size_t HConstructorFence::RemoveConstructorFences(HInstruction* instruction) {
   DCHECK(instruction->GetBlock() != nullptr);
   // Removing constructor fences only makes sense for instructions with an object return type.
-  DCHECK_EQ(Primitive::kPrimNot, instruction->GetType());
+  DCHECK_EQ(DataType::Type::kReference, instruction->GetType());
 
   // Return how many instructions were removed for statistic purposes.
   size_t remove_count = 0;
@@ -1382,11 +1382,11 @@
   if (GetInput()->IsIntConstant()) {
     int32_t value = GetInput()->AsIntConstant()->GetValue();
     switch (GetResultType()) {
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         return graph->GetLongConstant(static_cast<int64_t>(value), GetDexPc());
-      case Primitive::kPrimFloat:
+      case DataType::Type::kFloat32:
         return graph->GetFloatConstant(static_cast<float>(value), GetDexPc());
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat64:
         return graph->GetDoubleConstant(static_cast<double>(value), GetDexPc());
       default:
         return nullptr;
@@ -1394,11 +1394,11 @@
   } else if (GetInput()->IsLongConstant()) {
     int64_t value = GetInput()->AsLongConstant()->GetValue();
     switch (GetResultType()) {
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         return graph->GetIntConstant(static_cast<int32_t>(value), GetDexPc());
-      case Primitive::kPrimFloat:
+      case DataType::Type::kFloat32:
         return graph->GetFloatConstant(static_cast<float>(value), GetDexPc());
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat64:
         return graph->GetDoubleConstant(static_cast<double>(value), GetDexPc());
       default:
         return nullptr;
@@ -1406,7 +1406,7 @@
   } else if (GetInput()->IsFloatConstant()) {
     float value = GetInput()->AsFloatConstant()->GetValue();
     switch (GetResultType()) {
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         if (std::isnan(value))
           return graph->GetIntConstant(0, GetDexPc());
         if (value >= kPrimIntMax)
@@ -1414,7 +1414,7 @@
         if (value <= kPrimIntMin)
           return graph->GetIntConstant(kPrimIntMin, GetDexPc());
         return graph->GetIntConstant(static_cast<int32_t>(value), GetDexPc());
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         if (std::isnan(value))
           return graph->GetLongConstant(0, GetDexPc());
         if (value >= kPrimLongMax)
@@ -1422,7 +1422,7 @@
         if (value <= kPrimLongMin)
           return graph->GetLongConstant(kPrimLongMin, GetDexPc());
         return graph->GetLongConstant(static_cast<int64_t>(value), GetDexPc());
-      case Primitive::kPrimDouble:
+      case DataType::Type::kFloat64:
         return graph->GetDoubleConstant(static_cast<double>(value), GetDexPc());
       default:
         return nullptr;
@@ -1430,7 +1430,7 @@
   } else if (GetInput()->IsDoubleConstant()) {
     double value = GetInput()->AsDoubleConstant()->GetValue();
     switch (GetResultType()) {
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         if (std::isnan(value))
           return graph->GetIntConstant(0, GetDexPc());
         if (value >= kPrimIntMax)
@@ -1438,7 +1438,7 @@
         if (value <= kPrimLongMin)
           return graph->GetIntConstant(kPrimIntMin, GetDexPc());
         return graph->GetIntConstant(static_cast<int32_t>(value), GetDexPc());
-      case Primitive::kPrimLong:
+      case DataType::Type::kInt64:
         if (std::isnan(value))
           return graph->GetLongConstant(0, GetDexPc());
         if (value >= kPrimLongMax)
@@ -1446,7 +1446,7 @@
         if (value <= kPrimLongMin)
           return graph->GetLongConstant(kPrimLongMin, GetDexPc());
         return graph->GetLongConstant(static_cast<int64_t>(value), GetDexPc());
-      case Primitive::kPrimFloat:
+      case DataType::Type::kFloat32:
         return graph->GetFloatConstant(static_cast<float>(value), GetDexPc());
       default:
         return nullptr;
@@ -2604,7 +2604,7 @@
 
 void HInstruction::SetReferenceTypeInfo(ReferenceTypeInfo rti) {
   if (kIsDebugBuild) {
-    DCHECK_EQ(GetType(), Primitive::kPrimNot);
+    DCHECK_EQ(GetType(), DataType::Type::kReference);
     ScopedObjectAccess soa(Thread::Current());
     DCHECK(rti.IsValid()) << "Invalid RTI for " << DebugName();
     if (IsBoundType()) {
@@ -2893,7 +2893,7 @@
   ArenaAllocator* allocator = GetArena();
 
   if (cond->IsCondition() &&
-      !Primitive::IsFloatingPointType(cond->InputAt(0)->GetType())) {
+      !DataType::IsFloatingPointType(cond->InputAt(0)->GetType())) {
     // Can't reverse floating point conditions.  We have to use HBooleanNot in that case.
     HInstruction* lhs = cond->InputAt(0);
     HInstruction* rhs = cond->InputAt(1);
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index 6bc5111..c49cee3 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -28,6 +28,7 @@
 #include "base/iteration_range.h"
 #include "base/stl_util.h"
 #include "base/transform_array_ref.h"
+#include "data_type.h"
 #include "deoptimization_kind.h"
 #include "dex_file.h"
 #include "dex_file_types.h"
@@ -40,7 +41,6 @@
 #include "method_reference.h"
 #include "mirror/class.h"
 #include "offsets.h"
-#include "primitive.h"
 #include "utils/intrusive_forward_list.h"
 
 namespace art {
@@ -511,7 +511,7 @@
   // Returns a constant of the given type and value. If it does not exist
   // already, it is created and inserted into the graph. This method is only for
   // integral types.
-  HConstant* GetConstant(Primitive::Type type, int64_t value, uint32_t dex_pc = kNoDexPc);
+  HConstant* GetConstant(DataType::Type type, int64_t value, uint32_t dex_pc = kNoDexPc);
 
   // TODO: This is problematic for the consistency of reference type propagation
   // because it can be created anytime after the pass and thus it will be left
@@ -1567,7 +1567,7 @@
  * The internal representation uses 38-bit and is described in the table below.
  * The first line indicates the side effect, and for field/array accesses the
  * second line indicates the type of the access (in the order of the
- * Primitive::Type enum).
+ * DataType::Type enum).
  * The two numbered lines below indicate the bit position in the bitfield (read
  * vertically).
  *
@@ -1616,23 +1616,23 @@
     return SideEffects(kAllReads);
   }
 
-  static SideEffects FieldWriteOfType(Primitive::Type type, bool is_volatile) {
+  static SideEffects FieldWriteOfType(DataType::Type type, bool is_volatile) {
     return is_volatile
         ? AllWritesAndReads()
         : SideEffects(TypeFlag(type, kFieldWriteOffset));
   }
 
-  static SideEffects ArrayWriteOfType(Primitive::Type type) {
+  static SideEffects ArrayWriteOfType(DataType::Type type) {
     return SideEffects(TypeFlag(type, kArrayWriteOffset));
   }
 
-  static SideEffects FieldReadOfType(Primitive::Type type, bool is_volatile) {
+  static SideEffects FieldReadOfType(DataType::Type type, bool is_volatile) {
     return is_volatile
         ? AllWritesAndReads()
         : SideEffects(TypeFlag(type, kFieldReadOffset));
   }
 
-  static SideEffects ArrayReadOfType(Primitive::Type type) {
+  static SideEffects ArrayReadOfType(DataType::Type type) {
     return SideEffects(TypeFlag(type, kArrayReadOffset));
   }
 
@@ -1761,13 +1761,13 @@
       ((1ULL << (kLastBitForReads + 1 - kFieldReadOffset)) - 1) << kFieldReadOffset;
 
   // Translates type to bit flag.
-  static uint64_t TypeFlag(Primitive::Type type, int offset) {
-    CHECK_NE(type, Primitive::kPrimVoid);
+  static uint64_t TypeFlag(DataType::Type type, int offset) {
+    CHECK_NE(type, DataType::Type::kVoid);
     const uint64_t one = 1;
-    const int shift = type;  // 0-based consecutive enum
+    const int shift = static_cast<int>(type);  // 0-based consecutive enum
     DCHECK_LE(kFieldWriteOffset, shift);
     DCHECK_LT(shift, kArrayWriteOffset);
-    return one << (type + offset);
+    return one << (shift + offset);
   }
 
   // Private constructor on direct flags value.
@@ -1956,7 +1956,7 @@
   virtual void Accept(HGraphVisitor* visitor) = 0;
   virtual const char* DebugName() const = 0;
 
-  virtual Primitive::Type GetType() const { return Primitive::kPrimVoid; }
+  virtual DataType::Type GetType() const { return DataType::Type::kVoid; }
 
   virtual bool NeedsEnvironment() const { return false; }
 
@@ -1977,7 +1977,7 @@
   // simplifies the null check elimination.
   // TODO: Consider merging can_be_null into ReferenceTypeInfo.
   virtual bool CanBeNull() const {
-    DCHECK_EQ(GetType(), Primitive::kPrimNot) << "CanBeNull only applies to reference types";
+    DCHECK_EQ(GetType(), DataType::Type::kReference) << "CanBeNull only applies to reference types";
     return true;
   }
 
@@ -1986,13 +1986,13 @@
   }
 
   virtual bool IsActualObject() const {
-    return GetType() == Primitive::kPrimNot;
+    return GetType() == DataType::Type::kReference;
   }
 
   void SetReferenceTypeInfo(ReferenceTypeInfo rti);
 
   ReferenceTypeInfo GetReferenceTypeInfo() const {
-    DCHECK_EQ(GetType(), Primitive::kPrimNot);
+    DCHECK_EQ(GetType(), DataType::Type::kReference);
     return ReferenceTypeInfo::CreateUnchecked(reference_type_handle_,
                                               GetPackedFlag<kFlagReferenceTypeIsExact>());
   }
@@ -2505,24 +2505,24 @@
 template<intptr_t N>
 class HExpression : public HTemplateInstruction<N> {
  public:
-  HExpression<N>(Primitive::Type type, SideEffects side_effects, uint32_t dex_pc)
+  HExpression<N>(DataType::Type type, SideEffects side_effects, uint32_t dex_pc)
       : HTemplateInstruction<N>(side_effects, dex_pc) {
     this->template SetPackedField<TypeField>(type);
   }
   virtual ~HExpression() {}
 
-  Primitive::Type GetType() const OVERRIDE {
+  DataType::Type GetType() const OVERRIDE {
     return TypeField::Decode(this->GetPackedFields());
   }
 
  protected:
   static constexpr size_t kFieldType = HInstruction::kNumberOfGenericPackedBits;
   static constexpr size_t kFieldTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kNumberOfExpressionPackedBits = kFieldType + kFieldTypeSize;
   static_assert(kNumberOfExpressionPackedBits <= HInstruction::kMaxNumberOfPackedBits,
                 "Too many packed fields.");
-  using TypeField = BitField<Primitive::Type, kFieldType, kFieldTypeSize>;
+  using TypeField = BitField<DataType::Type, kFieldType, kFieldTypeSize>;
 };
 
 // Represents dex's RETURN_VOID opcode. A HReturnVoid is a control flow
@@ -2562,7 +2562,7 @@
   HPhi(ArenaAllocator* arena,
        uint32_t reg_number,
        size_t number_of_inputs,
-       Primitive::Type type,
+       DataType::Type type,
        uint32_t dex_pc = kNoDexPc)
       : HVariableInputSizeInstruction(
             SideEffects::None(),
@@ -2572,7 +2572,7 @@
             kArenaAllocPhiInputs),
         reg_number_(reg_number) {
     SetPackedField<TypeField>(ToPhiType(type));
-    DCHECK_NE(GetType(), Primitive::kPrimVoid);
+    DCHECK_NE(GetType(), DataType::Type::kVoid);
     // Phis are constructed live and marked dead if conflicting or unused.
     // Individual steps of SsaBuilder should assume that if a phi has been
     // marked dead, it can be ignored and will be removed by SsaPhiElimination.
@@ -2581,21 +2581,21 @@
   }
 
   // Returns a type equivalent to the given `type`, but that a `HPhi` can hold.
-  static Primitive::Type ToPhiType(Primitive::Type type) {
-    return Primitive::PrimitiveKind(type);
+  static DataType::Type ToPhiType(DataType::Type type) {
+    return DataType::Kind(type);
   }
 
   bool IsCatchPhi() const { return GetBlock()->IsCatchBlock(); }
 
-  Primitive::Type GetType() const OVERRIDE { return GetPackedField<TypeField>(); }
-  void SetType(Primitive::Type new_type) {
+  DataType::Type GetType() const OVERRIDE { return GetPackedField<TypeField>(); }
+  void SetType(DataType::Type new_type) {
     // Make sure that only valid type changes occur. The following are allowed:
     //  (1) int  -> float/ref (primitive type propagation),
     //  (2) long -> double (primitive type propagation).
     DCHECK(GetType() == new_type ||
-           (GetType() == Primitive::kPrimInt && new_type == Primitive::kPrimFloat) ||
-           (GetType() == Primitive::kPrimInt && new_type == Primitive::kPrimNot) ||
-           (GetType() == Primitive::kPrimLong && new_type == Primitive::kPrimDouble));
+           (GetType() == DataType::Type::kInt32 && new_type == DataType::Type::kFloat32) ||
+           (GetType() == DataType::Type::kInt32 && new_type == DataType::Type::kReference) ||
+           (GetType() == DataType::Type::kInt64 && new_type == DataType::Type::kFloat64));
     SetPackedField<TypeField>(new_type);
   }
 
@@ -2645,12 +2645,12 @@
  private:
   static constexpr size_t kFieldType = HInstruction::kNumberOfGenericPackedBits;
   static constexpr size_t kFieldTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kFlagIsLive = kFieldType + kFieldTypeSize;
   static constexpr size_t kFlagCanBeNull = kFlagIsLive + 1;
   static constexpr size_t kNumberOfPhiPackedBits = kFlagCanBeNull + 1;
   static_assert(kNumberOfPhiPackedBits <= kMaxNumberOfPackedBits, "Too many packed fields.");
-  using TypeField = BitField<Primitive::Type, kFieldType, kFieldTypeSize>;
+  using TypeField = BitField<DataType::Type, kFieldType, kFieldTypeSize>;
 
   const uint32_t reg_number_;
 
@@ -2691,7 +2691,7 @@
 
 class HConstant : public HExpression<0> {
  public:
-  explicit HConstant(Primitive::Type type, uint32_t dex_pc = kNoDexPc)
+  explicit HConstant(DataType::Type type, uint32_t dex_pc = kNoDexPc)
       : HExpression(type, SideEffects::None(), dex_pc) {}
 
   bool CanBeMoved() const OVERRIDE { return true; }
@@ -2729,7 +2729,8 @@
   DECLARE_INSTRUCTION(NullConstant);
 
  private:
-  explicit HNullConstant(uint32_t dex_pc = kNoDexPc) : HConstant(Primitive::kPrimNot, dex_pc) {}
+  explicit HNullConstant(uint32_t dex_pc = kNoDexPc)
+      : HConstant(DataType::Type::kReference, dex_pc) {}
 
   friend class HGraph;
   DISALLOW_COPY_AND_ASSIGN(HNullConstant);
@@ -2766,9 +2767,9 @@
 
  private:
   explicit HIntConstant(int32_t value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimInt, dex_pc), value_(value) {}
+      : HConstant(DataType::Type::kInt32, dex_pc), value_(value) {}
   explicit HIntConstant(bool value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimInt, dex_pc), value_(value ? 1 : 0) {}
+      : HConstant(DataType::Type::kInt32, dex_pc), value_(value ? 1 : 0) {}
 
   const int32_t value_;
 
@@ -2800,7 +2801,7 @@
 
  private:
   explicit HLongConstant(int64_t value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimLong, dex_pc), value_(value) {}
+      : HConstant(DataType::Type::kInt64, dex_pc), value_(value) {}
 
   const int64_t value_;
 
@@ -2849,9 +2850,9 @@
 
  private:
   explicit HFloatConstant(float value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimFloat, dex_pc), value_(value) {}
+      : HConstant(DataType::Type::kFloat32, dex_pc), value_(value) {}
   explicit HFloatConstant(int32_t value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimFloat, dex_pc), value_(bit_cast<float, int32_t>(value)) {}
+      : HConstant(DataType::Type::kFloat32, dex_pc), value_(bit_cast<float, int32_t>(value)) {}
 
   const float value_;
 
@@ -2900,9 +2901,9 @@
 
  private:
   explicit HDoubleConstant(double value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimDouble, dex_pc), value_(value) {}
+      : HConstant(DataType::Type::kFloat64, dex_pc), value_(value) {}
   explicit HDoubleConstant(int64_t value, uint32_t dex_pc = kNoDexPc)
-      : HConstant(Primitive::kPrimDouble, dex_pc), value_(bit_cast<double, int64_t>(value)) {}
+      : HConstant(DataType::Type::kFloat64, dex_pc), value_(bit_cast<double, int64_t>(value)) {}
 
   const double value_;
 
@@ -3051,8 +3052,8 @@
 
   DeoptimizationKind GetDeoptimizationKind() const { return GetPackedField<DeoptimizeKindField>(); }
 
-  Primitive::Type GetType() const OVERRIDE {
-    return GuardsAnInput() ? GuardedInput()->GetType() : Primitive::kPrimVoid;
+  DataType::Type GetType() const OVERRIDE {
+    return GuardsAnInput() ? GuardedInput()->GetType() : DataType::Type::kVoid;
   }
 
   bool GuardsAnInput() const {
@@ -3098,7 +3099,7 @@
       : HVariableInputSizeInstruction(SideEffects::None(), dex_pc, arena, 0, kArenaAllocCHA) {
   }
 
-  Primitive::Type GetType() const OVERRIDE { return Primitive::kPrimInt; }
+  DataType::Type GetType() const OVERRIDE { return DataType::Type::kInt32; }
 
   // We do all CHA guard elimination/motion in a single pass, after which there is no
   // further guard elimination/motion since a guard might have been used for justification
@@ -3117,7 +3118,7 @@
 // instructions that work with the dex cache.
 class HCurrentMethod FINAL : public HExpression<0> {
  public:
-  explicit HCurrentMethod(Primitive::Type type, uint32_t dex_pc = kNoDexPc)
+  explicit HCurrentMethod(DataType::Type type, uint32_t dex_pc = kNoDexPc)
       : HExpression(type, SideEffects::None(), dex_pc) {}
 
   DECLARE_INSTRUCTION(CurrentMethod);
@@ -3136,7 +3137,7 @@
     kLast = kIMTable
   };
   HClassTableGet(HInstruction* cls,
-                 Primitive::Type type,
+                 DataType::Type type,
                  TableKind kind,
                  size_t index,
                  uint32_t dex_pc)
@@ -3208,13 +3209,13 @@
 
 class HUnaryOperation : public HExpression<1> {
  public:
-  HUnaryOperation(Primitive::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
+  HUnaryOperation(DataType::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
       : HExpression(result_type, SideEffects::None(), dex_pc) {
     SetRawInputAt(0, input);
   }
 
   HInstruction* GetInput() const { return InputAt(0); }
-  Primitive::Type GetResultType() const { return GetType(); }
+  DataType::Type GetResultType() const { return GetType(); }
 
   bool CanBeMoved() const OVERRIDE { return true; }
   bool InstructionDataEquals(const HInstruction* other ATTRIBUTE_UNUSED) const OVERRIDE {
@@ -3240,7 +3241,7 @@
 
 class HBinaryOperation : public HExpression<2> {
  public:
-  HBinaryOperation(Primitive::Type result_type,
+  HBinaryOperation(DataType::Type result_type,
                    HInstruction* left,
                    HInstruction* right,
                    SideEffects side_effects = SideEffects::None(),
@@ -3252,7 +3253,7 @@
 
   HInstruction* GetLeft() const { return InputAt(0); }
   HInstruction* GetRight() const { return InputAt(1); }
-  Primitive::Type GetResultType() const { return GetType(); }
+  DataType::Type GetResultType() const { return GetType(); }
 
   virtual bool IsCommutative() const { return false; }
 
@@ -3342,7 +3343,7 @@
 class HCondition : public HBinaryOperation {
  public:
   HCondition(HInstruction* first, HInstruction* second, uint32_t dex_pc = kNoDexPc)
-      : HBinaryOperation(Primitive::kPrimBoolean, first, second, SideEffects::None(), dex_pc) {
+      : HBinaryOperation(DataType::Type::kBool, first, second, SideEffects::None(), dex_pc) {
     SetPackedField<ComparisonBiasField>(ComparisonBias::kNoBias);
   }
 
@@ -3367,7 +3368,7 @@
   }
 
   bool IsFPConditionTrueIfNaN() const {
-    DCHECK(Primitive::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
+    DCHECK(DataType::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
     IfCondition if_cond = GetCondition();
     if (if_cond == kCondNE) {
       return true;
@@ -3378,7 +3379,7 @@
   }
 
   bool IsFPConditionFalseIfNaN() const {
-    DCHECK(Primitive::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
+    DCHECK(DataType::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
     IfCondition if_cond = GetCondition();
     if (if_cond == kCondEQ) {
       return true;
@@ -3404,7 +3405,7 @@
 
   template <typename T>
   int32_t CompareFP(T x, T y) const {
-    DCHECK(Primitive::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
+    DCHECK(DataType::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
     DCHECK_NE(GetBias(), ComparisonBias::kNoBias);
     // Handle the bias.
     return std::isunordered(x, y) ? (IsGtBias() ? 1 : -1) : Compare(x, y);
@@ -3821,20 +3822,20 @@
  public:
   // Note that `comparison_type` is the type of comparison performed
   // between the comparison's inputs, not the type of the instantiated
-  // HCompare instruction (which is always Primitive::kPrimInt).
-  HCompare(Primitive::Type comparison_type,
+  // HCompare instruction (which is always DataType::Type::kInt).
+  HCompare(DataType::Type comparison_type,
            HInstruction* first,
            HInstruction* second,
            ComparisonBias bias,
            uint32_t dex_pc)
-      : HBinaryOperation(Primitive::kPrimInt,
+      : HBinaryOperation(DataType::Type::kInt32,
                          first,
                          second,
                          SideEffectsForArchRuntimeCalls(comparison_type),
                          dex_pc) {
     SetPackedField<ComparisonBiasField>(bias);
-    DCHECK_EQ(comparison_type, Primitive::PrimitiveKind(first->GetType()));
-    DCHECK_EQ(comparison_type, Primitive::PrimitiveKind(second->GetType()));
+    DCHECK_EQ(comparison_type, DataType::Kind(first->GetType()));
+    DCHECK_EQ(comparison_type, DataType::Kind(second->GetType()));
   }
 
   template <typename T>
@@ -3842,7 +3843,7 @@
 
   template <typename T>
   int32_t ComputeFP(T x, T y) const {
-    DCHECK(Primitive::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
+    DCHECK(DataType::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
     DCHECK_NE(GetBias(), ComparisonBias::kNoBias);
     // Handle the bias.
     return std::isunordered(x, y) ? (IsGtBias() ? 1 : -1) : Compute(x, y);
@@ -3875,11 +3876,11 @@
   // Does this compare instruction have a "gt bias" (vs an "lt bias")?
   // Only meaningful for floating-point comparisons.
   bool IsGtBias() const {
-    DCHECK(Primitive::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
+    DCHECK(DataType::IsFloatingPointType(InputAt(0)->GetType())) << InputAt(0)->GetType();
     return GetBias() == ComparisonBias::kGtBias;
   }
 
-  static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type type ATTRIBUTE_UNUSED) {
+  static SideEffects SideEffectsForArchRuntimeCalls(DataType::Type type ATTRIBUTE_UNUSED) {
     // Comparisons do not require a runtime call in any back end.
     return SideEffects::None();
   }
@@ -3914,7 +3915,7 @@
                const DexFile& dex_file,
                bool finalizable,
                QuickEntrypointEnum entrypoint)
-      : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
+      : HExpression(DataType::Type::kReference, SideEffects::CanTriggerGC(), dex_pc),
         type_index_(type_index),
         dex_file_(dex_file),
         entrypoint_(entrypoint) {
@@ -4002,7 +4003,7 @@
   // inputs at the end of their list of inputs.
   uint32_t GetNumberOfArguments() const { return number_of_arguments_; }
 
-  Primitive::Type GetType() const OVERRIDE { return GetPackedField<ReturnTypeField>(); }
+  DataType::Type GetType() const OVERRIDE { return GetPackedField<ReturnTypeField>(); }
 
   uint32_t GetDexMethodIndex() const { return dex_method_index_; }
 
@@ -4055,17 +4056,17 @@
   static constexpr size_t kFieldReturnType =
       kFieldInvokeType + kFieldInvokeTypeSize;
   static constexpr size_t kFieldReturnTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kFlagCanThrow = kFieldReturnType + kFieldReturnTypeSize;
   static constexpr size_t kNumberOfInvokePackedBits = kFlagCanThrow + 1;
   static_assert(kNumberOfInvokePackedBits <= kMaxNumberOfPackedBits, "Too many packed fields.");
   using InvokeTypeField = BitField<InvokeType, kFieldInvokeType, kFieldInvokeTypeSize>;
-  using ReturnTypeField = BitField<Primitive::Type, kFieldReturnType, kFieldReturnTypeSize>;
+  using ReturnTypeField = BitField<DataType::Type, kFieldReturnType, kFieldReturnTypeSize>;
 
   HInvoke(ArenaAllocator* arena,
           uint32_t number_of_arguments,
           uint32_t number_of_other_inputs,
-          Primitive::Type return_type,
+          DataType::Type return_type,
           uint32_t dex_pc,
           uint32_t dex_method_index,
           ArtMethod* resolved_method,
@@ -4102,7 +4103,7 @@
  public:
   HInvokeUnresolved(ArenaAllocator* arena,
                     uint32_t number_of_arguments,
-                    Primitive::Type return_type,
+                    DataType::Type return_type,
                     uint32_t dex_pc,
                     uint32_t dex_method_index,
                     InvokeType invoke_type)
@@ -4126,7 +4127,7 @@
  public:
   HInvokePolymorphic(ArenaAllocator* arena,
                      uint32_t number_of_arguments,
-                     Primitive::Type return_type,
+                     DataType::Type return_type,
                      uint32_t dex_pc,
                      uint32_t dex_method_index)
       : HInvoke(arena,
@@ -4203,7 +4204,7 @@
 
   HInvokeStaticOrDirect(ArenaAllocator* arena,
                         uint32_t number_of_arguments,
-                        Primitive::Type return_type,
+                        DataType::Type return_type,
                         uint32_t dex_pc,
                         uint32_t method_index,
                         ArtMethod* resolved_method,
@@ -4281,7 +4282,7 @@
   }
 
   bool CanBeNull() const OVERRIDE {
-    return GetPackedField<ReturnTypeField>() == Primitive::kPrimNot && !IsStringInit();
+    return GetPackedField<ReturnTypeField>() == DataType::Type::kReference && !IsStringInit();
   }
 
   // Get the index of the special input, if any.
@@ -4398,7 +4399,7 @@
  public:
   HInvokeVirtual(ArenaAllocator* arena,
                  uint32_t number_of_arguments,
-                 Primitive::Type return_type,
+                 DataType::Type return_type,
                  uint32_t dex_pc,
                  uint32_t dex_method_index,
                  ArtMethod* resolved_method,
@@ -4446,7 +4447,7 @@
  public:
   HInvokeInterface(ArenaAllocator* arena,
                    uint32_t number_of_arguments,
-                   Primitive::Type return_type,
+                   DataType::Type return_type,
                    uint32_t dex_pc,
                    uint32_t dex_method_index,
                    ArtMethod* resolved_method,
@@ -4485,9 +4486,9 @@
 
 class HNeg FINAL : public HUnaryOperation {
  public:
-  HNeg(Primitive::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
+  HNeg(DataType::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
       : HUnaryOperation(result_type, input, dex_pc) {
-    DCHECK_EQ(result_type, Primitive::PrimitiveKind(input->GetType()));
+    DCHECK_EQ(result_type, DataType::Kind(input->GetType()));
   }
 
   template <typename T> static T Compute(T x) { return -x; }
@@ -4514,7 +4515,7 @@
 class HNewArray FINAL : public HExpression<2> {
  public:
   HNewArray(HInstruction* cls, HInstruction* length, uint32_t dex_pc)
-      : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc) {
+      : HExpression(DataType::Type::kReference, SideEffects::CanTriggerGC(), dex_pc) {
     SetRawInputAt(0, cls);
     SetRawInputAt(1, length);
   }
@@ -4544,7 +4545,7 @@
 
 class HAdd FINAL : public HBinaryOperation {
  public:
-  HAdd(Primitive::Type result_type,
+  HAdd(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc = kNoDexPc)
@@ -4579,7 +4580,7 @@
 
 class HSub FINAL : public HBinaryOperation {
  public:
-  HSub(Primitive::Type result_type,
+  HSub(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc = kNoDexPc)
@@ -4612,7 +4613,7 @@
 
 class HMul FINAL : public HBinaryOperation {
  public:
-  HMul(Primitive::Type result_type,
+  HMul(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc = kNoDexPc)
@@ -4647,7 +4648,7 @@
 
 class HDiv FINAL : public HBinaryOperation {
  public:
-  HDiv(Primitive::Type result_type,
+  HDiv(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc)
@@ -4655,7 +4656,7 @@
 
   template <typename T>
   T ComputeIntegral(T x, T y) const {
-    DCHECK(!Primitive::IsFloatingPointType(GetType())) << GetType();
+    DCHECK(!DataType::IsFloatingPointType(GetType())) << GetType();
     // Our graph structure ensures we never have 0 for `y` during
     // constant folding.
     DCHECK_NE(y, 0);
@@ -4665,7 +4666,7 @@
 
   template <typename T>
   T ComputeFP(T x, T y) const {
-    DCHECK(Primitive::IsFloatingPointType(GetType())) << GetType();
+    DCHECK(DataType::IsFloatingPointType(GetType())) << GetType();
     return x / y;
   }
 
@@ -4694,7 +4695,7 @@
 
 class HRem FINAL : public HBinaryOperation {
  public:
-  HRem(Primitive::Type result_type,
+  HRem(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc)
@@ -4702,7 +4703,7 @@
 
   template <typename T>
   T ComputeIntegral(T x, T y) const {
-    DCHECK(!Primitive::IsFloatingPointType(GetType())) << GetType();
+    DCHECK(!DataType::IsFloatingPointType(GetType())) << GetType();
     // Our graph structure ensures we never have 0 for `y` during
     // constant folding.
     DCHECK_NE(y, 0);
@@ -4712,7 +4713,7 @@
 
   template <typename T>
   T ComputeFP(T x, T y) const {
-    DCHECK(Primitive::IsFloatingPointType(GetType())) << GetType();
+    DCHECK(DataType::IsFloatingPointType(GetType())) << GetType();
     return std::fmod(x, y);
   }
 
@@ -4748,7 +4749,7 @@
     SetRawInputAt(0, value);
   }
 
-  Primitive::Type GetType() const OVERRIDE { return InputAt(0)->GetType(); }
+  DataType::Type GetType() const OVERRIDE { return InputAt(0)->GetType(); }
 
   bool CanBeMoved() const OVERRIDE { return true; }
 
@@ -4767,13 +4768,13 @@
 
 class HShl FINAL : public HBinaryOperation {
  public:
-  HShl(Primitive::Type result_type,
+  HShl(DataType::Type result_type,
        HInstruction* value,
        HInstruction* distance,
        uint32_t dex_pc = kNoDexPc)
       : HBinaryOperation(result_type, value, distance, SideEffects::None(), dex_pc) {
-    DCHECK_EQ(result_type, Primitive::PrimitiveKind(value->GetType()));
-    DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(distance->GetType()));
+    DCHECK_EQ(result_type, DataType::Kind(value->GetType()));
+    DCHECK_EQ(DataType::Type::kInt32, DataType::Kind(distance->GetType()));
   }
 
   template <typename T>
@@ -4813,13 +4814,13 @@
 
 class HShr FINAL : public HBinaryOperation {
  public:
-  HShr(Primitive::Type result_type,
+  HShr(DataType::Type result_type,
        HInstruction* value,
        HInstruction* distance,
        uint32_t dex_pc = kNoDexPc)
       : HBinaryOperation(result_type, value, distance, SideEffects::None(), dex_pc) {
-    DCHECK_EQ(result_type, Primitive::PrimitiveKind(value->GetType()));
-    DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(distance->GetType()));
+    DCHECK_EQ(result_type, DataType::Kind(value->GetType()));
+    DCHECK_EQ(DataType::Type::kInt32, DataType::Kind(distance->GetType()));
   }
 
   template <typename T>
@@ -4859,13 +4860,13 @@
 
 class HUShr FINAL : public HBinaryOperation {
  public:
-  HUShr(Primitive::Type result_type,
+  HUShr(DataType::Type result_type,
         HInstruction* value,
         HInstruction* distance,
         uint32_t dex_pc = kNoDexPc)
       : HBinaryOperation(result_type, value, distance, SideEffects::None(), dex_pc) {
-    DCHECK_EQ(result_type, Primitive::PrimitiveKind(value->GetType()));
-    DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(distance->GetType()));
+    DCHECK_EQ(result_type, DataType::Kind(value->GetType()));
+    DCHECK_EQ(DataType::Type::kInt32, DataType::Kind(distance->GetType()));
   }
 
   template <typename T>
@@ -4907,7 +4908,7 @@
 
 class HAnd FINAL : public HBinaryOperation {
  public:
-  HAnd(Primitive::Type result_type,
+  HAnd(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc = kNoDexPc)
@@ -4944,7 +4945,7 @@
 
 class HOr FINAL : public HBinaryOperation {
  public:
-  HOr(Primitive::Type result_type,
+  HOr(DataType::Type result_type,
       HInstruction* left,
       HInstruction* right,
       uint32_t dex_pc = kNoDexPc)
@@ -4981,7 +4982,7 @@
 
 class HXor FINAL : public HBinaryOperation {
  public:
-  HXor(Primitive::Type result_type,
+  HXor(DataType::Type result_type,
        HInstruction* left,
        HInstruction* right,
        uint32_t dex_pc = kNoDexPc)
@@ -5018,10 +5019,10 @@
 
 class HRor FINAL : public HBinaryOperation {
  public:
-  HRor(Primitive::Type result_type, HInstruction* value, HInstruction* distance)
+  HRor(DataType::Type result_type, HInstruction* value, HInstruction* distance)
     : HBinaryOperation(result_type, value, distance) {
-    DCHECK_EQ(result_type, Primitive::PrimitiveKind(value->GetType()));
-    DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(distance->GetType()));
+    DCHECK_EQ(result_type, DataType::Kind(value->GetType()));
+    DCHECK_EQ(DataType::Type::kInt32, DataType::Kind(distance->GetType()));
   }
 
   template <typename T>
@@ -5074,7 +5075,7 @@
   HParameterValue(const DexFile& dex_file,
                   dex::TypeIndex type_index,
                   uint8_t index,
-                  Primitive::Type parameter_type,
+                  DataType::Type parameter_type,
                   bool is_this = false)
       : HExpression(parameter_type, SideEffects::None(), kNoDexPc),
         dex_file_(dex_file),
@@ -5113,7 +5114,7 @@
 
 class HNot FINAL : public HUnaryOperation {
  public:
-  HNot(Primitive::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
+  HNot(DataType::Type result_type, HInstruction* input, uint32_t dex_pc = kNoDexPc)
       : HUnaryOperation(result_type, input, dex_pc) {}
 
   bool CanBeMoved() const OVERRIDE { return true; }
@@ -5147,7 +5148,7 @@
 class HBooleanNot FINAL : public HUnaryOperation {
  public:
   explicit HBooleanNot(HInstruction* input, uint32_t dex_pc = kNoDexPc)
-      : HUnaryOperation(Primitive::Type::kPrimBoolean, input, dex_pc) {}
+      : HUnaryOperation(DataType::Type::kBool, input, dex_pc) {}
 
   bool CanBeMoved() const OVERRIDE { return true; }
   bool InstructionDataEquals(const HInstruction* other ATTRIBUTE_UNUSED) const OVERRIDE {
@@ -5184,16 +5185,16 @@
 class HTypeConversion FINAL : public HExpression<1> {
  public:
   // Instantiate a type conversion of `input` to `result_type`.
-  HTypeConversion(Primitive::Type result_type, HInstruction* input, uint32_t dex_pc)
+  HTypeConversion(DataType::Type result_type, HInstruction* input, uint32_t dex_pc)
       : HExpression(result_type, SideEffects::None(), dex_pc) {
     SetRawInputAt(0, input);
     // Invariant: We should never generate a conversion to a Boolean value.
-    DCHECK_NE(Primitive::kPrimBoolean, result_type);
+    DCHECK_NE(DataType::Type::kBool, result_type);
   }
 
   HInstruction* GetInput() const { return InputAt(0); }
-  Primitive::Type GetInputType() const { return GetInput()->GetType(); }
-  Primitive::Type GetResultType() const { return GetType(); }
+  DataType::Type GetInputType() const { return GetInput()->GetType(); }
+  DataType::Type GetResultType() const { return GetType(); }
 
   bool CanBeMoved() const OVERRIDE { return true; }
   bool InstructionDataEquals(const HInstruction* other ATTRIBUTE_UNUSED) const OVERRIDE {
@@ -5245,7 +5246,7 @@
  public:
   FieldInfo(ArtField* field,
             MemberOffset field_offset,
-            Primitive::Type field_type,
+            DataType::Type field_type,
             bool is_volatile,
             uint32_t index,
             uint16_t declaring_class_def_index,
@@ -5260,7 +5261,7 @@
 
   ArtField* GetField() const { return field_; }
   MemberOffset GetFieldOffset() const { return field_offset_; }
-  Primitive::Type GetFieldType() const { return field_type_; }
+  DataType::Type GetFieldType() const { return field_type_; }
   uint32_t GetFieldIndex() const { return index_; }
   uint16_t GetDeclaringClassDefIndex() const { return declaring_class_def_index_;}
   const DexFile& GetDexFile() const { return dex_file_; }
@@ -5269,7 +5270,7 @@
  private:
   ArtField* const field_;
   const MemberOffset field_offset_;
-  const Primitive::Type field_type_;
+  const DataType::Type field_type_;
   const bool is_volatile_;
   const uint32_t index_;
   const uint16_t declaring_class_def_index_;
@@ -5280,7 +5281,7 @@
  public:
   HInstanceFieldGet(HInstruction* value,
                     ArtField* field,
-                    Primitive::Type field_type,
+                    DataType::Type field_type,
                     MemberOffset field_offset,
                     bool is_volatile,
                     uint32_t field_idx,
@@ -5315,7 +5316,7 @@
 
   const FieldInfo& GetFieldInfo() const { return field_info_; }
   MemberOffset GetFieldOffset() const { return field_info_.GetFieldOffset(); }
-  Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
+  DataType::Type GetFieldType() const { return field_info_.GetFieldType(); }
   bool IsVolatile() const { return field_info_.IsVolatile(); }
 
   DECLARE_INSTRUCTION(InstanceFieldGet);
@@ -5331,7 +5332,7 @@
   HInstanceFieldSet(HInstruction* object,
                     HInstruction* value,
                     ArtField* field,
-                    Primitive::Type field_type,
+                    DataType::Type field_type,
                     MemberOffset field_offset,
                     bool is_volatile,
                     uint32_t field_idx,
@@ -5357,7 +5358,7 @@
 
   const FieldInfo& GetFieldInfo() const { return field_info_; }
   MemberOffset GetFieldOffset() const { return field_info_.GetFieldOffset(); }
-  Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
+  DataType::Type GetFieldType() const { return field_info_.GetFieldType(); }
   bool IsVolatile() const { return field_info_.IsVolatile(); }
   HInstruction* GetValue() const { return InputAt(1); }
   bool GetValueCanBeNull() const { return GetPackedFlag<kFlagValueCanBeNull>(); }
@@ -5380,7 +5381,7 @@
  public:
   HArrayGet(HInstruction* array,
             HInstruction* index,
-            Primitive::Type type,
+            DataType::Type type,
             uint32_t dex_pc,
             bool is_string_char_at = false)
       : HExpression(type, SideEffects::ArrayReadOfType(type), dex_pc) {
@@ -5414,11 +5415,11 @@
       DCHECK_EQ(GetBlock(), other->GetBlock());
       DCHECK_EQ(GetArray(), other->GetArray());
       DCHECK_EQ(GetIndex(), other->GetIndex());
-      if (Primitive::IsIntOrLongType(GetType())) {
-        DCHECK(Primitive::IsFloatingPointType(other->GetType())) << other->GetType();
+      if (DataType::IsIntOrLongType(GetType())) {
+        DCHECK(DataType::IsFloatingPointType(other->GetType())) << other->GetType();
       } else {
-        DCHECK(Primitive::IsFloatingPointType(GetType())) << GetType();
-        DCHECK(Primitive::IsIntOrLongType(other->GetType())) << other->GetType();
+        DCHECK(DataType::IsFloatingPointType(GetType())) << GetType();
+        DCHECK(DataType::IsIntOrLongType(other->GetType())) << other->GetType();
       }
     }
     return result;
@@ -5450,11 +5451,11 @@
   HArraySet(HInstruction* array,
             HInstruction* index,
             HInstruction* value,
-            Primitive::Type expected_component_type,
+            DataType::Type expected_component_type,
             uint32_t dex_pc)
       : HTemplateInstruction(SideEffects::None(), dex_pc) {
     SetPackedField<ExpectedComponentTypeField>(expected_component_type);
-    SetPackedFlag<kFlagNeedsTypeCheck>(value->GetType() == Primitive::kPrimNot);
+    SetPackedFlag<kFlagNeedsTypeCheck>(value->GetType() == DataType::Type::kReference);
     SetPackedFlag<kFlagValueCanBeNull>(true);
     SetPackedFlag<kFlagStaticTypeOfArrayIsObjectArray>(false);
     SetRawInputAt(0, array);
@@ -5499,29 +5500,30 @@
   HInstruction* GetIndex() const { return InputAt(1); }
   HInstruction* GetValue() const { return InputAt(2); }
 
-  Primitive::Type GetComponentType() const {
+  DataType::Type GetComponentType() const {
     // The Dex format does not type floating point index operations. Since the
     // `expected_component_type_` is set during building and can therefore not
     // be correct, we also check what is the value type. If it is a floating
     // point type, we must use that type.
-    Primitive::Type value_type = GetValue()->GetType();
-    return ((value_type == Primitive::kPrimFloat) || (value_type == Primitive::kPrimDouble))
+    DataType::Type value_type = GetValue()->GetType();
+    return ((value_type == DataType::Type::kFloat32) || (value_type == DataType::Type::kFloat64))
         ? value_type
         : GetRawExpectedComponentType();
   }
 
-  Primitive::Type GetRawExpectedComponentType() const {
+  DataType::Type GetRawExpectedComponentType() const {
     return GetPackedField<ExpectedComponentTypeField>();
   }
 
   void ComputeSideEffects() {
-    Primitive::Type type = GetComponentType();
+    DataType::Type type = GetComponentType();
     SetSideEffects(SideEffects::ArrayWriteOfType(type).Union(
         SideEffectsForArchRuntimeCalls(type)));
   }
 
-  static SideEffects SideEffectsForArchRuntimeCalls(Primitive::Type value_type) {
-    return (value_type == Primitive::kPrimNot) ? SideEffects::CanTriggerGC() : SideEffects::None();
+  static SideEffects SideEffectsForArchRuntimeCalls(DataType::Type value_type) {
+    return (value_type == DataType::Type::kReference) ? SideEffects::CanTriggerGC()
+                                                      : SideEffects::None();
   }
 
   DECLARE_INSTRUCTION(ArraySet);
@@ -5529,7 +5531,7 @@
  private:
   static constexpr size_t kFieldExpectedComponentType = kNumberOfGenericPackedBits;
   static constexpr size_t kFieldExpectedComponentTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kFlagNeedsTypeCheck =
       kFieldExpectedComponentType + kFieldExpectedComponentTypeSize;
   static constexpr size_t kFlagValueCanBeNull = kFlagNeedsTypeCheck + 1;
@@ -5540,7 +5542,7 @@
       kFlagStaticTypeOfArrayIsObjectArray + 1;
   static_assert(kNumberOfArraySetPackedBits <= kMaxNumberOfPackedBits, "Too many packed fields.");
   using ExpectedComponentTypeField =
-      BitField<Primitive::Type, kFieldExpectedComponentType, kFieldExpectedComponentTypeSize>;
+      BitField<DataType::Type, kFieldExpectedComponentType, kFieldExpectedComponentTypeSize>;
 
   DISALLOW_COPY_AND_ASSIGN(HArraySet);
 };
@@ -5548,7 +5550,7 @@
 class HArrayLength FINAL : public HExpression<1> {
  public:
   HArrayLength(HInstruction* array, uint32_t dex_pc, bool is_string_length = false)
-      : HExpression(Primitive::kPrimInt, SideEffects::None(), dex_pc) {
+      : HExpression(DataType::Type::kInt32, SideEffects::None(), dex_pc) {
     SetPackedFlag<kFlagIsStringLength>(is_string_length);
     // Note that arrays do not change length, so the instruction does not
     // depend on any write.
@@ -5590,7 +5592,7 @@
                uint32_t dex_pc,
                bool string_char_at = false)
       : HExpression(index->GetType(), SideEffects::CanTriggerGC(), dex_pc) {
-    DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(index->GetType()));
+    DCHECK_EQ(DataType::Type::kInt32, DataType::Kind(index->GetType()));
     SetPackedFlag<kFlagIsStringCharAt>(string_char_at);
     SetRawInputAt(0, index);
     SetRawInputAt(1, length);
@@ -5800,8 +5802,8 @@
         &special_input_, (special_input_.GetInstruction() != nullptr) ? 1u : 0u);
   }
 
-  Primitive::Type GetType() const OVERRIDE {
-    return Primitive::kPrimNot;
+  DataType::Type GetType() const OVERRIDE {
+    return DataType::Type::kReference;
   }
 
   Handle<mirror::Class> GetClass() const {
@@ -5968,8 +5970,8 @@
         &special_input_, (special_input_.GetInstruction() != nullptr) ? 1u : 0u);
   }
 
-  Primitive::Type GetType() const OVERRIDE {
-    return Primitive::kPrimNot;
+  DataType::Type GetType() const OVERRIDE {
+    return DataType::Type::kReference;
   }
 
   DECLARE_INSTRUCTION(LoadString);
@@ -6020,7 +6022,7 @@
  public:
   HClinitCheck(HLoadClass* constant, uint32_t dex_pc)
       : HExpression(
-            Primitive::kPrimNot,
+            DataType::Type::kReference,
             SideEffects::AllChanges(),  // Assume write/read on all fields/arrays.
             dex_pc) {
     SetRawInputAt(0, constant);
@@ -6053,7 +6055,7 @@
  public:
   HStaticFieldGet(HInstruction* cls,
                   ArtField* field,
-                  Primitive::Type field_type,
+                  DataType::Type field_type,
                   MemberOffset field_offset,
                   bool is_volatile,
                   uint32_t field_idx,
@@ -6085,7 +6087,7 @@
 
   const FieldInfo& GetFieldInfo() const { return field_info_; }
   MemberOffset GetFieldOffset() const { return field_info_.GetFieldOffset(); }
-  Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
+  DataType::Type GetFieldType() const { return field_info_.GetFieldType(); }
   bool IsVolatile() const { return field_info_.IsVolatile(); }
 
   DECLARE_INSTRUCTION(StaticFieldGet);
@@ -6101,7 +6103,7 @@
   HStaticFieldSet(HInstruction* cls,
                   HInstruction* value,
                   ArtField* field,
-                  Primitive::Type field_type,
+                  DataType::Type field_type,
                   MemberOffset field_offset,
                   bool is_volatile,
                   uint32_t field_idx,
@@ -6123,7 +6125,7 @@
 
   const FieldInfo& GetFieldInfo() const { return field_info_; }
   MemberOffset GetFieldOffset() const { return field_info_.GetFieldOffset(); }
-  Primitive::Type GetFieldType() const { return field_info_.GetFieldType(); }
+  DataType::Type GetFieldType() const { return field_info_.GetFieldType(); }
   bool IsVolatile() const { return field_info_.IsVolatile(); }
 
   HInstruction* GetValue() const { return InputAt(1); }
@@ -6146,7 +6148,7 @@
 class HUnresolvedInstanceFieldGet FINAL : public HExpression<1> {
  public:
   HUnresolvedInstanceFieldGet(HInstruction* obj,
-                              Primitive::Type field_type,
+                              DataType::Type field_type,
                               uint32_t field_index,
                               uint32_t dex_pc)
       : HExpression(field_type, SideEffects::AllExceptGCDependency(), dex_pc),
@@ -6157,7 +6159,7 @@
   bool NeedsEnvironment() const OVERRIDE { return true; }
   bool CanThrow() const OVERRIDE { return true; }
 
-  Primitive::Type GetFieldType() const { return GetType(); }
+  DataType::Type GetFieldType() const { return GetType(); }
   uint32_t GetFieldIndex() const { return field_index_; }
 
   DECLARE_INSTRUCTION(UnresolvedInstanceFieldGet);
@@ -6172,13 +6174,13 @@
  public:
   HUnresolvedInstanceFieldSet(HInstruction* obj,
                               HInstruction* value,
-                              Primitive::Type field_type,
+                              DataType::Type field_type,
                               uint32_t field_index,
                               uint32_t dex_pc)
       : HTemplateInstruction(SideEffects::AllExceptGCDependency(), dex_pc),
         field_index_(field_index) {
     SetPackedField<FieldTypeField>(field_type);
-    DCHECK_EQ(Primitive::PrimitiveKind(field_type), Primitive::PrimitiveKind(value->GetType()));
+    DCHECK_EQ(DataType::Kind(field_type), DataType::Kind(value->GetType()));
     SetRawInputAt(0, obj);
     SetRawInputAt(1, value);
   }
@@ -6186,7 +6188,7 @@
   bool NeedsEnvironment() const OVERRIDE { return true; }
   bool CanThrow() const OVERRIDE { return true; }
 
-  Primitive::Type GetFieldType() const { return GetPackedField<FieldTypeField>(); }
+  DataType::Type GetFieldType() const { return GetPackedField<FieldTypeField>(); }
   uint32_t GetFieldIndex() const { return field_index_; }
 
   DECLARE_INSTRUCTION(UnresolvedInstanceFieldSet);
@@ -6194,12 +6196,12 @@
  private:
   static constexpr size_t kFieldFieldType = HInstruction::kNumberOfGenericPackedBits;
   static constexpr size_t kFieldFieldTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kNumberOfUnresolvedStaticFieldSetPackedBits =
       kFieldFieldType + kFieldFieldTypeSize;
   static_assert(kNumberOfUnresolvedStaticFieldSetPackedBits <= HInstruction::kMaxNumberOfPackedBits,
                 "Too many packed fields.");
-  using FieldTypeField = BitField<Primitive::Type, kFieldFieldType, kFieldFieldTypeSize>;
+  using FieldTypeField = BitField<DataType::Type, kFieldFieldType, kFieldFieldTypeSize>;
 
   const uint32_t field_index_;
 
@@ -6208,7 +6210,7 @@
 
 class HUnresolvedStaticFieldGet FINAL : public HExpression<0> {
  public:
-  HUnresolvedStaticFieldGet(Primitive::Type field_type,
+  HUnresolvedStaticFieldGet(DataType::Type field_type,
                             uint32_t field_index,
                             uint32_t dex_pc)
       : HExpression(field_type, SideEffects::AllExceptGCDependency(), dex_pc),
@@ -6218,7 +6220,7 @@
   bool NeedsEnvironment() const OVERRIDE { return true; }
   bool CanThrow() const OVERRIDE { return true; }
 
-  Primitive::Type GetFieldType() const { return GetType(); }
+  DataType::Type GetFieldType() const { return GetType(); }
   uint32_t GetFieldIndex() const { return field_index_; }
 
   DECLARE_INSTRUCTION(UnresolvedStaticFieldGet);
@@ -6232,20 +6234,20 @@
 class HUnresolvedStaticFieldSet FINAL : public HTemplateInstruction<1> {
  public:
   HUnresolvedStaticFieldSet(HInstruction* value,
-                            Primitive::Type field_type,
+                            DataType::Type field_type,
                             uint32_t field_index,
                             uint32_t dex_pc)
       : HTemplateInstruction(SideEffects::AllExceptGCDependency(), dex_pc),
         field_index_(field_index) {
     SetPackedField<FieldTypeField>(field_type);
-    DCHECK_EQ(Primitive::PrimitiveKind(field_type), Primitive::PrimitiveKind(value->GetType()));
+    DCHECK_EQ(DataType::Kind(field_type), DataType::Kind(value->GetType()));
     SetRawInputAt(0, value);
   }
 
   bool NeedsEnvironment() const OVERRIDE { return true; }
   bool CanThrow() const OVERRIDE { return true; }
 
-  Primitive::Type GetFieldType() const { return GetPackedField<FieldTypeField>(); }
+  DataType::Type GetFieldType() const { return GetPackedField<FieldTypeField>(); }
   uint32_t GetFieldIndex() const { return field_index_; }
 
   DECLARE_INSTRUCTION(UnresolvedStaticFieldSet);
@@ -6253,12 +6255,12 @@
  private:
   static constexpr size_t kFieldFieldType = HInstruction::kNumberOfGenericPackedBits;
   static constexpr size_t kFieldFieldTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kNumberOfUnresolvedStaticFieldSetPackedBits =
       kFieldFieldType + kFieldFieldTypeSize;
   static_assert(kNumberOfUnresolvedStaticFieldSetPackedBits <= HInstruction::kMaxNumberOfPackedBits,
                 "Too many packed fields.");
-  using FieldTypeField = BitField<Primitive::Type, kFieldFieldType, kFieldFieldTypeSize>;
+  using FieldTypeField = BitField<DataType::Type, kFieldFieldType, kFieldFieldTypeSize>;
 
   const uint32_t field_index_;
 
@@ -6269,7 +6271,7 @@
 class HLoadException FINAL : public HExpression<0> {
  public:
   explicit HLoadException(uint32_t dex_pc = kNoDexPc)
-      : HExpression(Primitive::kPrimNot, SideEffects::None(), dex_pc) {}
+      : HExpression(DataType::Type::kReference, SideEffects::None(), dex_pc) {}
 
   bool CanBeNull() const OVERRIDE { return false; }
 
@@ -6335,7 +6337,7 @@
               HLoadClass* constant,
               TypeCheckKind check_kind,
               uint32_t dex_pc)
-      : HExpression(Primitive::kPrimBoolean,
+      : HExpression(DataType::Type::kBool,
                     SideEffectsForArchRuntimeCalls(check_kind),
                     dex_pc) {
     SetPackedField<TypeCheckKindField>(check_kind);
@@ -6386,11 +6388,11 @@
 class HBoundType FINAL : public HExpression<1> {
  public:
   explicit HBoundType(HInstruction* input, uint32_t dex_pc = kNoDexPc)
-      : HExpression(Primitive::kPrimNot, SideEffects::None(), dex_pc),
+      : HExpression(DataType::Type::kReference, SideEffects::None(), dex_pc),
         upper_bound_(ReferenceTypeInfo::CreateInvalid()) {
     SetPackedFlag<kFlagUpperCanBeNull>(true);
     SetPackedFlag<kFlagCanBeNull>(true);
-    DCHECK_EQ(input->GetType(), Primitive::kPrimNot);
+    DCHECK_EQ(input->GetType(), DataType::Type::kReference);
     SetRawInputAt(0, input);
   }
 
@@ -6761,7 +6763,7 @@
  public:
   MoveOperands(Location source,
                Location destination,
-               Primitive::Type type,
+               DataType::Type type,
                HInstruction* instruction)
       : source_(source), destination_(destination), type_(type), instruction_(instruction) {}
 
@@ -6811,10 +6813,10 @@
     return source_.IsInvalid();
   }
 
-  Primitive::Type GetType() const { return type_; }
+  DataType::Type GetType() const { return type_; }
 
   bool Is64BitMove() const {
-    return Primitive::Is64BitType(type_);
+    return DataType::Is64BitType(type_);
   }
 
   HInstruction* GetInstruction() const { return instruction_; }
@@ -6823,7 +6825,7 @@
   Location source_;
   Location destination_;
   // The type this move is for.
-  Primitive::Type type_;
+  DataType::Type type_;
   // The instruction this move is assocatied with. Null when this move is
   // for moving an input in the expected locations of user (including a phi user).
   // This is only used in debug mode, to ensure we do not connect interval siblings
@@ -6845,7 +6847,7 @@
 
   void AddMove(Location source,
                Location destination,
-               Primitive::Type type,
+               DataType::Type type,
                HInstruction* instruction) {
     DCHECK(source.IsValid());
     DCHECK(destination.IsValid());
diff --git a/compiler/optimizing/nodes_mips.h b/compiler/optimizing/nodes_mips.h
index 8e439d9..80e652e 100644
--- a/compiler/optimizing/nodes_mips.h
+++ b/compiler/optimizing/nodes_mips.h
@@ -24,7 +24,7 @@
  public:
   // Treat the value as an int32_t, but it is really a 32 bit native pointer.
   HMipsComputeBaseMethodAddress()
-      : HExpression(Primitive::kPrimInt, SideEffects::None(), kNoDexPc) {}
+      : HExpression(DataType::Type::kInt32, SideEffects::None(), kNoDexPc) {}
 
   bool CanBeMoved() const OVERRIDE { return true; }
 
diff --git a/compiler/optimizing/nodes_shared.cc b/compiler/optimizing/nodes_shared.cc
index f6d33f0..f982523 100644
--- a/compiler/optimizing/nodes_shared.cc
+++ b/compiler/optimizing/nodes_shared.cc
@@ -42,20 +42,20 @@
     *shift_amount = instruction->AsUShr()->GetRight()->AsIntConstant()->GetValue();
   } else {
     DCHECK(instruction->IsTypeConversion());
-    Primitive::Type result_type = instruction->AsTypeConversion()->GetResultType();
-    Primitive::Type input_type = instruction->AsTypeConversion()->GetInputType();
-    int result_size = Primitive::ComponentSize(result_type);
-    int input_size = Primitive::ComponentSize(input_type);
+    DataType::Type result_type = instruction->AsTypeConversion()->GetResultType();
+    DataType::Type input_type = instruction->AsTypeConversion()->GetInputType();
+    int result_size = DataType::Size(result_type);
+    int input_size = DataType::Size(input_type);
     int min_size = std::min(result_size, input_size);
-    if (result_type == Primitive::kPrimInt && input_type == Primitive::kPrimLong) {
+    if (result_type == DataType::Type::kInt32 && input_type == DataType::Type::kInt64) {
       // There is actually nothing to do. On ARM the high register from the
       // pair will be ignored. On ARM64 the register will be used as a W
       // register, discarding the top bits. This is represented by the
       // default encoding 'LSL 0'.
       *op_kind = kLSL;
       *shift_amount = 0;
-    } else if (result_type == Primitive::kPrimChar ||
-               (input_type == Primitive::kPrimChar && input_size < result_size)) {
+    } else if (result_type == DataType::Type::kUint16 ||
+               (input_type == DataType::Type::kUint16 && input_size < result_size)) {
       *op_kind = kUXTH;
     } else {
       switch (min_size) {
diff --git a/compiler/optimizing/nodes_shared.h b/compiler/optimizing/nodes_shared.h
index 075a816..14cbf85 100644
--- a/compiler/optimizing/nodes_shared.h
+++ b/compiler/optimizing/nodes_shared.h
@@ -26,7 +26,7 @@
 
 class HMultiplyAccumulate FINAL : public HExpression<3> {
  public:
-  HMultiplyAccumulate(Primitive::Type type,
+  HMultiplyAccumulate(DataType::Type type,
                       InstructionKind op,
                       HInstruction* accumulator,
                       HInstruction* mul_left,
@@ -60,11 +60,11 @@
 
 class HBitwiseNegatedRight FINAL : public HBinaryOperation {
  public:
-  HBitwiseNegatedRight(Primitive::Type result_type,
-                            InstructionKind op,
-                            HInstruction* left,
-                            HInstruction* right,
-                            uint32_t dex_pc = kNoDexPc)
+  HBitwiseNegatedRight(DataType::Type result_type,
+                       InstructionKind op,
+                       HInstruction* left,
+                       HInstruction* right,
+                       uint32_t dex_pc = kNoDexPc)
     : HBinaryOperation(result_type, left, right, SideEffects::None(), dex_pc),
       op_kind_(op) {
     DCHECK(op == HInstruction::kAnd || op == HInstruction::kOr || op == HInstruction::kXor) << op;
@@ -122,14 +122,14 @@
 // This instruction computes an intermediate address pointing in the 'middle' of an object. The
 // result pointer cannot be handled by GC, so extra care is taken to make sure that this value is
 // never used across anything that can trigger GC.
-// The result of this instruction is not a pointer in the sense of `Primitive::kPrimNot`. So we
-// represent it by the type `Primitive::kPrimInt`.
+// The result of this instruction is not a pointer in the sense of `DataType::Type::kreference`.
+// So we represent it by the type `DataType::Type::kInt`.
 class HIntermediateAddress FINAL : public HExpression<2> {
  public:
   HIntermediateAddress(HInstruction* base_address, HInstruction* offset, uint32_t dex_pc)
-      : HExpression(Primitive::kPrimInt, SideEffects::DependsOnGC(), dex_pc) {
-        DCHECK_EQ(Primitive::ComponentSize(Primitive::kPrimInt),
-                  Primitive::ComponentSize(Primitive::kPrimNot))
+      : HExpression(DataType::Type::kInt32, SideEffects::DependsOnGC(), dex_pc) {
+        DCHECK_EQ(DataType::Size(DataType::Type::kInt32),
+                  DataType::Size(DataType::Type::kReference))
             << "kPrimInt and kPrimNot have different sizes.";
     SetRawInputAt(0, base_address);
     SetRawInputAt(1, offset);
@@ -171,7 +171,7 @@
  public:
   HIntermediateAddressIndex(
       HInstruction* index, HInstruction* offset, HInstruction* shift, uint32_t dex_pc)
-      : HExpression(Primitive::kPrimInt, SideEffects::None(), dex_pc) {
+      : HExpression(DataType::Type::kInt32, SideEffects::None(), dex_pc) {
     SetRawInputAt(0, index);
     SetRawInputAt(1, offset);
     SetRawInputAt(2, shift);
@@ -222,7 +222,7 @@
                          uint32_t dex_pc = kNoDexPc)
       : HExpression(instr->GetType(), SideEffects::None(), dex_pc),
         instr_kind_(instr->GetKind()), op_kind_(op),
-        shift_amount_(shift & (instr->GetType() == Primitive::kPrimInt
+        shift_amount_(shift & (instr->GetType() == DataType::Type::kInt32
             ? kMaxIntShiftDistance
             : kMaxLongShiftDistance)) {
     DCHECK(!instr->HasSideEffects());
diff --git a/compiler/optimizing/nodes_test.cc b/compiler/optimizing/nodes_test.cc
index f3a78a0..ada6177 100644
--- a/compiler/optimizing/nodes_test.cc
+++ b/compiler/optimizing/nodes_test.cc
@@ -36,7 +36,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
   entry->AddInstruction(new (&allocator) HGoto());
 
@@ -79,9 +79,9 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter1 = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* parameter2 = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter1);
   entry->AddInstruction(parameter2);
   entry->AddInstruction(new (&allocator) HExit());
@@ -107,7 +107,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   ASSERT_FALSE(parameter->HasUses());
@@ -128,7 +128,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter1 = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* with_environment = new (&allocator) HNullCheck(parameter1, 0);
   entry->AddInstruction(parameter1);
   entry->AddInstruction(with_environment);
diff --git a/compiler/optimizing/nodes_vector.h b/compiler/optimizing/nodes_vector.h
index 1488b70..0aac260 100644
--- a/compiler/optimizing/nodes_vector.h
+++ b/compiler/optimizing/nodes_vector.h
@@ -65,10 +65,10 @@
  public:
   // A SIMD operation looks like a FPU location.
   // TODO: we could introduce SIMD types in HIR.
-  static constexpr Primitive::Type kSIMDType = Primitive::kPrimDouble;
+  static constexpr DataType::Type kSIMDType = DataType::Type::kFloat64;
 
   HVecOperation(ArenaAllocator* arena,
-                Primitive::Type packed_type,
+                DataType::Type packed_type,
                 SideEffects side_effects,
                 size_t number_of_inputs,
                 size_t vector_length,
@@ -90,16 +90,16 @@
 
   // Returns the number of bytes in a full vector.
   size_t GetVectorNumberOfBytes() const {
-    return vector_length_ * Primitive::ComponentSize(GetPackedType());
+    return vector_length_ * DataType::Size(GetPackedType());
   }
 
   // Returns the type of the vector operation.
-  Primitive::Type GetType() const OVERRIDE {
+  DataType::Type GetType() const OVERRIDE {
     return kSIMDType;
   }
 
   // Returns the true component type packed in a vector.
-  Primitive::Type GetPackedType() const {
+  DataType::Type GetPackedType() const {
     return GetPackedField<TypeField>();
   }
 
@@ -122,10 +122,10 @@
   // Additional packed bits.
   static constexpr size_t kFieldType = HInstruction::kNumberOfGenericPackedBits;
   static constexpr size_t kFieldTypeSize =
-      MinimumBitsToStore(static_cast<size_t>(Primitive::kPrimLast));
+      MinimumBitsToStore(static_cast<size_t>(DataType::Type::kLast));
   static constexpr size_t kNumberOfVectorOpPackedBits = kFieldType + kFieldTypeSize;
   static_assert(kNumberOfVectorOpPackedBits <= kMaxNumberOfPackedBits, "Too many packed fields.");
-  using TypeField = BitField<Primitive::Type, kFieldType, kFieldTypeSize>;
+  using TypeField = BitField<DataType::Type, kFieldType, kFieldTypeSize>;
 
  private:
   const size_t vector_length_;
@@ -138,7 +138,7 @@
  public:
   HVecUnaryOperation(ArenaAllocator* arena,
                      HInstruction* input,
-                     Primitive::Type packed_type,
+                     DataType::Type packed_type,
                      size_t vector_length,
                      uint32_t dex_pc)
       : HVecOperation(arena,
@@ -164,7 +164,7 @@
   HVecBinaryOperation(ArenaAllocator* arena,
                       HInstruction* left,
                       HInstruction* right,
-                      Primitive::Type packed_type,
+                      DataType::Type packed_type,
                       size_t vector_length,
                       uint32_t dex_pc)
       : HVecOperation(arena,
@@ -192,13 +192,13 @@
 class HVecMemoryOperation : public HVecOperation {
  public:
   HVecMemoryOperation(ArenaAllocator* arena,
-                      Primitive::Type packed_type,
+                      DataType::Type packed_type,
                       SideEffects side_effects,
                       size_t number_of_inputs,
                       size_t vector_length,
                       uint32_t dex_pc)
       : HVecOperation(arena, packed_type, side_effects, number_of_inputs, vector_length, dex_pc),
-        alignment_(Primitive::ComponentSize(packed_type), 0) {
+        alignment_(DataType::Size(packed_type), 0) {
     DCHECK_GE(number_of_inputs, 2u);
   }
 
@@ -224,21 +224,21 @@
 };
 
 // Packed type consistency checker ("same vector length" integral types may mix freely).
-inline static bool HasConsistentPackedTypes(HInstruction* input, Primitive::Type type) {
+inline static bool HasConsistentPackedTypes(HInstruction* input, DataType::Type type) {
   if (input->IsPhi()) {
     return input->GetType() == HVecOperation::kSIMDType;  // carries SIMD
   }
   DCHECK(input->IsVecOperation());
-  Primitive::Type input_type = input->AsVecOperation()->GetPackedType();
+  DataType::Type input_type = input->AsVecOperation()->GetPackedType();
   switch (input_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-      return type == Primitive::kPrimBoolean ||
-             type == Primitive::kPrimByte;
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
-      return type == Primitive::kPrimChar ||
-             type == Primitive::kPrimShort;
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+      return type == DataType::Type::kBool ||
+             type == DataType::Type::kInt8;
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
+      return type == DataType::Type::kUint16 ||
+             type == DataType::Type::kInt16;
     default:
       return type == input_type;
   }
@@ -254,7 +254,7 @@
  public:
   HVecReplicateScalar(ArenaAllocator* arena,
                       HInstruction* scalar,
-                      Primitive::Type packed_type,
+                      DataType::Type packed_type,
                       size_t vector_length,
                       uint32_t dex_pc = kNoDexPc)
       : HVecUnaryOperation(arena, scalar, packed_type, vector_length, dex_pc) {
@@ -279,7 +279,7 @@
  public:
   HVecExtractScalar(ArenaAllocator* arena,
                     HInstruction* input,
-                    Primitive::Type packed_type,
+                    DataType::Type packed_type,
                     size_t vector_length,
                     size_t index,
                     uint32_t dex_pc = kNoDexPc)
@@ -290,7 +290,7 @@
   }
 
   // Yields a single component in the vector.
-  Primitive::Type GetType() const OVERRIDE {
+  DataType::Type GetType() const OVERRIDE {
     return GetPackedType();
   }
 
@@ -317,7 +317,7 @@
 
   HVecReduce(ArenaAllocator* arena,
              HInstruction* input,
-             Primitive::Type packed_type,
+             DataType::Type packed_type,
              size_t vector_length,
              ReductionKind kind,
              uint32_t dex_pc = kNoDexPc)
@@ -350,7 +350,7 @@
  public:
   HVecCnv(ArenaAllocator* arena,
           HInstruction* input,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecUnaryOperation(arena, input, packed_type, vector_length, dex_pc) {
@@ -358,8 +358,8 @@
     DCHECK_NE(GetInputType(), GetResultType());  // actual convert
   }
 
-  Primitive::Type GetInputType() const { return InputAt(0)->AsVecOperation()->GetPackedType(); }
-  Primitive::Type GetResultType() const { return GetPackedType(); }
+  DataType::Type GetInputType() const { return InputAt(0)->AsVecOperation()->GetPackedType(); }
+  DataType::Type GetResultType() const { return GetPackedType(); }
 
   bool CanBeMoved() const OVERRIDE { return true; }
 
@@ -375,7 +375,7 @@
  public:
   HVecNeg(ArenaAllocator* arena,
           HInstruction* input,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecUnaryOperation(arena, input, packed_type, vector_length, dex_pc) {
@@ -396,7 +396,7 @@
  public:
   HVecAbs(ArenaAllocator* arena,
           HInstruction* input,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecUnaryOperation(arena, input, packed_type, vector_length, dex_pc) {
@@ -418,7 +418,7 @@
  public:
   HVecNot(ArenaAllocator* arena,
           HInstruction* input,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecUnaryOperation(arena, input, packed_type, vector_length, dex_pc) {
@@ -444,7 +444,7 @@
   HVecAdd(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -469,7 +469,7 @@
   HVecHalvingAdd(ArenaAllocator* arena,
                  HInstruction* left,
                  HInstruction* right,
-                 Primitive::Type packed_type,
+                 DataType::Type packed_type,
                  size_t vector_length,
                  bool is_unsigned,
                  bool is_rounded,
@@ -513,7 +513,7 @@
   HVecSub(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -536,7 +536,7 @@
   HVecMul(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -559,7 +559,7 @@
   HVecDiv(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -582,7 +582,7 @@
   HVecMin(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           bool is_unsigned,
           uint32_t dex_pc = kNoDexPc)
@@ -620,7 +620,7 @@
   HVecMax(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           bool is_unsigned,
           uint32_t dex_pc = kNoDexPc)
@@ -658,7 +658,7 @@
   HVecAnd(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -680,7 +680,7 @@
   HVecAndNot(ArenaAllocator* arena,
              HInstruction* left,
              HInstruction* right,
-             Primitive::Type packed_type,
+             DataType::Type packed_type,
              size_t vector_length,
              uint32_t dex_pc = kNoDexPc)
          : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -702,7 +702,7 @@
   HVecOr(ArenaAllocator* arena,
          HInstruction* left,
          HInstruction* right,
-         Primitive::Type packed_type,
+         DataType::Type packed_type,
          size_t vector_length,
          uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -724,7 +724,7 @@
   HVecXor(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -746,7 +746,7 @@
   HVecShl(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -768,7 +768,7 @@
   HVecShr(ArenaAllocator* arena,
           HInstruction* left,
           HInstruction* right,
-          Primitive::Type packed_type,
+          DataType::Type packed_type,
           size_t vector_length,
           uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -790,7 +790,7 @@
   HVecUShr(ArenaAllocator* arena,
            HInstruction* left,
            HInstruction* right,
-           Primitive::Type packed_type,
+           DataType::Type packed_type,
            size_t vector_length,
            uint32_t dex_pc = kNoDexPc)
       : HVecBinaryOperation(arena, left, right, packed_type, vector_length, dex_pc) {
@@ -816,7 +816,7 @@
  public:
   HVecSetScalars(ArenaAllocator* arena,
                  HInstruction* scalars[],
-                 Primitive::Type packed_type,
+                 DataType::Type packed_type,
                  size_t vector_length,
                  size_t number_of_scalars,
                  uint32_t dex_pc = kNoDexPc)
@@ -851,7 +851,7 @@
                          HInstruction* accumulator,
                          HInstruction* mul_left,
                          HInstruction* mul_right,
-                         Primitive::Type packed_type,
+                         DataType::Type packed_type,
                          size_t vector_length,
                          uint32_t dex_pc = kNoDexPc)
       : HVecOperation(arena,
@@ -900,7 +900,7 @@
                     HInstruction* accumulator,
                     HInstruction* sad_left,
                     HInstruction* sad_right,
-                    Primitive::Type packed_type,
+                    DataType::Type packed_type,
                     size_t vector_length,
                     uint32_t dex_pc = kNoDexPc)
       : HVecOperation(arena,
@@ -932,7 +932,7 @@
   HVecLoad(ArenaAllocator* arena,
            HInstruction* base,
            HInstruction* index,
-           Primitive::Type packed_type,
+           DataType::Type packed_type,
            size_t vector_length,
            bool is_string_char_at,
            uint32_t dex_pc = kNoDexPc)
@@ -976,7 +976,7 @@
             HInstruction* base,
             HInstruction* index,
             HInstruction* value,
-            Primitive::Type packed_type,
+            DataType::Type packed_type,
             size_t vector_length,
             uint32_t dex_pc = kNoDexPc)
       : HVecMemoryOperation(arena,
diff --git a/compiler/optimizing/nodes_vector_test.cc b/compiler/optimizing/nodes_vector_test.cc
index 5a56a2c..3acdb20 100644
--- a/compiler/optimizing/nodes_vector_test.cc
+++ b/compiler/optimizing/nodes_vector_test.cc
@@ -45,7 +45,7 @@
     parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                    dex::TypeIndex(0),
                                                    0,
-                                                   Primitive::kPrimInt);
+                                                   DataType::Type::kInt32);
     entry_block_->AddInstruction(parameter_);
   }
 
@@ -119,15 +119,15 @@
 
 TEST_F(NodesVectorTest, VectorOperationProperties) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
   HVecOperation* v1 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
   HVecOperation* v2 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 2);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 2);
   HVecOperation* v3 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimShort, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt16, 4);
   HVecOperation* v4 = new (&allocator_)
-      HVecStore(&allocator_, parameter_, parameter_, v0, Primitive::kPrimInt, 4);
+      HVecStore(&allocator_, parameter_, parameter_, v0, DataType::Type::kInt32, 4);
 
   EXPECT_TRUE(v0->Equals(v0));
   EXPECT_TRUE(v1->Equals(v1));
@@ -149,17 +149,17 @@
   EXPECT_EQ(4u, v3->GetVectorLength());
   EXPECT_EQ(4u, v4->GetVectorLength());
 
-  EXPECT_EQ(Primitive::kPrimDouble, v0->GetType());
-  EXPECT_EQ(Primitive::kPrimDouble, v1->GetType());
-  EXPECT_EQ(Primitive::kPrimDouble, v2->GetType());
-  EXPECT_EQ(Primitive::kPrimDouble, v3->GetType());
-  EXPECT_EQ(Primitive::kPrimDouble, v4->GetType());
+  EXPECT_EQ(DataType::Type::kFloat64, v0->GetType());
+  EXPECT_EQ(DataType::Type::kFloat64, v1->GetType());
+  EXPECT_EQ(DataType::Type::kFloat64, v2->GetType());
+  EXPECT_EQ(DataType::Type::kFloat64, v3->GetType());
+  EXPECT_EQ(DataType::Type::kFloat64, v4->GetType());
 
-  EXPECT_EQ(Primitive::kPrimInt, v0->GetPackedType());
-  EXPECT_EQ(Primitive::kPrimInt, v1->GetPackedType());
-  EXPECT_EQ(Primitive::kPrimInt, v2->GetPackedType());
-  EXPECT_EQ(Primitive::kPrimShort, v3->GetPackedType());
-  EXPECT_EQ(Primitive::kPrimInt, v4->GetPackedType());
+  EXPECT_EQ(DataType::Type::kInt32, v0->GetPackedType());
+  EXPECT_EQ(DataType::Type::kInt32, v1->GetPackedType());
+  EXPECT_EQ(DataType::Type::kInt32, v2->GetPackedType());
+  EXPECT_EQ(DataType::Type::kInt16, v3->GetPackedType());
+  EXPECT_EQ(DataType::Type::kInt32, v4->GetPackedType());
 
   EXPECT_EQ(16u, v0->GetVectorNumberOfBytes());
   EXPECT_EQ(16u, v1->GetVectorNumberOfBytes());
@@ -175,12 +175,12 @@
 }
 
 TEST_F(NodesVectorTest, VectorAlignmentAndStringCharAtMatterOnLoad) {
-  HVecLoad* v0 = new (&allocator_)
-      HVecLoad(&allocator_, parameter_, parameter_, Primitive::kPrimInt, 4, /*is_string_char_at*/ false);
-  HVecLoad* v1 = new (&allocator_)
-      HVecLoad(&allocator_, parameter_, parameter_, Primitive::kPrimInt, 4, /*is_string_char_at*/ false);
-  HVecLoad* v2 = new (&allocator_)
-      HVecLoad(&allocator_, parameter_, parameter_, Primitive::kPrimInt, 4, /*is_string_char_at*/ true);
+  HVecLoad* v0 = new (&allocator_) HVecLoad(
+      &allocator_, parameter_, parameter_, DataType::Type::kInt32, 4, /*is_string_char_at*/ false);
+  HVecLoad* v1 = new (&allocator_) HVecLoad(
+      &allocator_, parameter_, parameter_, DataType::Type::kInt32, 4, /*is_string_char_at*/ false);
+  HVecLoad* v2 = new (&allocator_) HVecLoad(
+      &allocator_, parameter_, parameter_, DataType::Type::kInt32, 4, /*is_string_char_at*/ true);
 
   EXPECT_TRUE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
@@ -210,14 +210,14 @@
 
 TEST_F(NodesVectorTest, VectorSignMattersOnMin) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
 
   HVecMin* v1 = new (&allocator_)
-      HVecMin(&allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ true);
+      HVecMin(&allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ true);
   HVecMin* v2 = new (&allocator_)
-      HVecMin(&allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ false);
+      HVecMin(&allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ false);
   HVecMin* v3 = new (&allocator_)
-      HVecMin(&allocator_, v0, v0, Primitive::kPrimInt, 2, /*is_unsigned*/ true);
+      HVecMin(&allocator_, v0, v0, DataType::Type::kInt32, 2, /*is_unsigned*/ true);
 
   EXPECT_FALSE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
@@ -238,14 +238,14 @@
 
 TEST_F(NodesVectorTest, VectorSignMattersOnMax) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
 
   HVecMax* v1 = new (&allocator_)
-      HVecMax(&allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ true);
+      HVecMax(&allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ true);
   HVecMax* v2 = new (&allocator_)
-      HVecMax(&allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ false);
+      HVecMax(&allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ false);
   HVecMax* v3 = new (&allocator_)
-      HVecMax(&allocator_, v0, v0, Primitive::kPrimInt, 2, /*is_unsigned*/ true);
+      HVecMax(&allocator_, v0, v0, DataType::Type::kInt32, 2, /*is_unsigned*/ true);
 
   EXPECT_FALSE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
@@ -266,18 +266,18 @@
 
 TEST_F(NodesVectorTest, VectorAttributesMatterOnHalvingAdd) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
 
   HVecHalvingAdd* v1 = new (&allocator_) HVecHalvingAdd(
-      &allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ true, /*is_rounded*/ true);
+      &allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ true, /*is_rounded*/ true);
   HVecHalvingAdd* v2 = new (&allocator_) HVecHalvingAdd(
-      &allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ true, /*is_rounded*/ false);
+      &allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ true, /*is_rounded*/ false);
   HVecHalvingAdd* v3 = new (&allocator_) HVecHalvingAdd(
-      &allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ false, /*is_rounded*/ true);
+      &allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ false, /*is_rounded*/ true);
   HVecHalvingAdd* v4 = new (&allocator_) HVecHalvingAdd(
-      &allocator_, v0, v0, Primitive::kPrimInt, 4, /*is_unsigned*/ false, /*is_rounded*/ false);
+      &allocator_, v0, v0, DataType::Type::kInt32, 4, /*is_unsigned*/ false, /*is_rounded*/ false);
   HVecHalvingAdd* v5 = new (&allocator_) HVecHalvingAdd(
-      &allocator_, v0, v0, Primitive::kPrimInt, 2, /*is_unsigned*/ true, /*is_rounded*/ true);
+      &allocator_, v0, v0, DataType::Type::kInt32, 2, /*is_unsigned*/ true, /*is_rounded*/ true);
 
   EXPECT_FALSE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
@@ -306,14 +306,14 @@
 
 TEST_F(NodesVectorTest, VectorOperationMattersOnMultiplyAccumulate) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
 
-  HVecMultiplyAccumulate* v1 = new (&allocator_)
-      HVecMultiplyAccumulate(&allocator_, HInstruction::kAdd, v0, v0, v0, Primitive::kPrimInt, 4);
-  HVecMultiplyAccumulate* v2 = new (&allocator_)
-      HVecMultiplyAccumulate(&allocator_, HInstruction::kSub, v0, v0, v0, Primitive::kPrimInt, 4);
-  HVecMultiplyAccumulate* v3 = new (&allocator_)
-      HVecMultiplyAccumulate(&allocator_, HInstruction::kAdd, v0, v0, v0, Primitive::kPrimInt, 2);
+  HVecMultiplyAccumulate* v1 = new (&allocator_) HVecMultiplyAccumulate(
+      &allocator_, HInstruction::kAdd, v0, v0, v0, DataType::Type::kInt32, 4);
+  HVecMultiplyAccumulate* v2 = new (&allocator_) HVecMultiplyAccumulate(
+      &allocator_, HInstruction::kSub, v0, v0, v0, DataType::Type::kInt32, 4);
+  HVecMultiplyAccumulate* v3 = new (&allocator_) HVecMultiplyAccumulate(
+      &allocator_, HInstruction::kAdd, v0, v0, v0, DataType::Type::kInt32, 2);
 
   EXPECT_FALSE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
@@ -334,14 +334,14 @@
 
 TEST_F(NodesVectorTest, VectorKindMattersOnReduce) {
   HVecOperation* v0 = new (&allocator_)
-      HVecReplicateScalar(&allocator_, parameter_, Primitive::kPrimInt, 4);
+      HVecReplicateScalar(&allocator_, parameter_, DataType::Type::kInt32, 4);
 
   HVecReduce* v1 = new (&allocator_) HVecReduce(
-      &allocator_, v0, Primitive::kPrimInt, 4, HVecReduce::kSum);
+      &allocator_, v0, DataType::Type::kInt32, 4, HVecReduce::kSum);
   HVecReduce* v2 = new (&allocator_) HVecReduce(
-      &allocator_, v0, Primitive::kPrimInt, 4, HVecReduce::kMin);
+      &allocator_, v0, DataType::Type::kInt32, 4, HVecReduce::kMin);
   HVecReduce* v3 = new (&allocator_) HVecReduce(
-      &allocator_, v0, Primitive::kPrimInt, 4, HVecReduce::kMax);
+      &allocator_, v0, DataType::Type::kInt32, 4, HVecReduce::kMax);
 
   EXPECT_FALSE(v0->CanBeMoved());
   EXPECT_TRUE(v1->CanBeMoved());
diff --git a/compiler/optimizing/nodes_x86.h b/compiler/optimizing/nodes_x86.h
index 75893c3..22e92ea 100644
--- a/compiler/optimizing/nodes_x86.h
+++ b/compiler/optimizing/nodes_x86.h
@@ -24,7 +24,7 @@
  public:
   // Treat the value as an int32_t, but it is really a 32 bit native pointer.
   HX86ComputeBaseMethodAddress()
-      : HExpression(Primitive::kPrimInt, SideEffects::None(), kNoDexPc) {}
+      : HExpression(DataType::Type::kInt32, SideEffects::None(), kNoDexPc) {}
 
   bool CanBeMoved() const OVERRIDE { return true; }
 
@@ -61,12 +61,12 @@
 // Version of HNeg with access to the constant table for FP types.
 class HX86FPNeg FINAL : public HExpression<2> {
  public:
-  HX86FPNeg(Primitive::Type result_type,
+  HX86FPNeg(DataType::Type result_type,
             HInstruction* input,
             HX86ComputeBaseMethodAddress* method_base,
             uint32_t dex_pc)
       : HExpression(result_type, SideEffects::None(), dex_pc) {
-    DCHECK(Primitive::IsFloatingPointType(result_type));
+    DCHECK(DataType::IsFloatingPointType(result_type));
     SetRawInputAt(0, input);
     SetRawInputAt(1, method_base);
   }
diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc
index 7451196..1218586 100644
--- a/compiler/optimizing/optimizing_compiler.cc
+++ b/compiler/optimizing/optimizing_compiler.cc
@@ -669,22 +669,42 @@
 #endif
 #ifdef ART_ENABLE_CODEGEN_mips
     case kMips: {
+      SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
+      GVNOptimization* gvn = new (arena) GVNOptimization(graph, *side_effects, "GVN$after_arch");
       mips::PcRelativeFixups* pc_relative_fixups =
           new (arena) mips::PcRelativeFixups(graph, codegen, stats);
       HOptimization* mips_optimizations[] = {
+          side_effects,
+          gvn,
           pc_relative_fixups,
       };
       RunOptimizations(mips_optimizations, arraysize(mips_optimizations), pass_observer);
       break;
     }
 #endif
+#ifdef ART_ENABLE_CODEGEN_mips64
+    case kMips64: {
+      SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
+      GVNOptimization* gvn = new (arena) GVNOptimization(graph, *side_effects, "GVN$after_arch");
+      HOptimization* mips64_optimizations[] = {
+          side_effects,
+          gvn,
+      };
+      RunOptimizations(mips64_optimizations, arraysize(mips64_optimizations), pass_observer);
+      break;
+    }
+#endif
 #ifdef ART_ENABLE_CODEGEN_x86
     case kX86: {
+      SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
+      GVNOptimization* gvn = new (arena) GVNOptimization(graph, *side_effects, "GVN$after_arch");
       x86::PcRelativeFixups* pc_relative_fixups =
           new (arena) x86::PcRelativeFixups(graph, codegen, stats);
       x86::X86MemoryOperandGeneration* memory_gen =
           new (arena) x86::X86MemoryOperandGeneration(graph, codegen, stats);
       HOptimization* x86_optimizations[] = {
+          side_effects,
+          gvn,
           pc_relative_fixups,
           memory_gen
       };
@@ -694,9 +714,13 @@
 #endif
 #ifdef ART_ENABLE_CODEGEN_x86_64
     case kX86_64: {
+      SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
+      GVNOptimization* gvn = new (arena) GVNOptimization(graph, *side_effects, "GVN$after_arch");
       x86::X86MemoryOperandGeneration* memory_gen =
           new (arena) x86::X86MemoryOperandGeneration(graph, codegen, stats);
       HOptimization* x86_64_optimizations[] = {
+          side_effects,
+          gvn,
           memory_gen
       };
       RunOptimizations(x86_64_optimizations, arraysize(x86_64_optimizations), pass_observer);
@@ -990,8 +1014,6 @@
     HGraphBuilder builder(graph,
                           &dex_compilation_unit,
                           &dex_compilation_unit,
-                          &dex_file,
-                          *code_item,
                           compiler_driver,
                           codegen.get(),
                           compilation_stats_.get(),
diff --git a/compiler/optimizing/optimizing_unit_test.h b/compiler/optimizing/optimizing_unit_test.h
index 08493fa..33f1a4a 100644
--- a/compiler/optimizing/optimizing_unit_test.h
+++ b/compiler/optimizing/optimizing_unit_test.h
@@ -50,7 +50,8 @@
                             ArenaAllocator* allocator,
                             int reg = -1,
                             HInstruction* defined_by = nullptr) {
-  LiveInterval* interval = LiveInterval::MakeInterval(allocator, Primitive::kPrimInt, defined_by);
+  LiveInterval* interval =
+      LiveInterval::MakeInterval(allocator, DataType::Type::kInt32, defined_by);
   if (defined_by != nullptr) {
     defined_by->SetLiveInterval(interval);
   }
@@ -88,7 +89,7 @@
 // Create a control-flow graph from Dex instructions.
 inline HGraph* CreateCFG(ArenaAllocator* allocator,
                          const uint16_t* data,
-                         Primitive::Type return_type = Primitive::kPrimInt) {
+                         DataType::Type return_type = DataType::Type::kInt32) {
   const DexFile::CodeItem* item =
     reinterpret_cast<const DexFile::CodeItem*>(data);
   HGraph* graph = CreateGraph(allocator);
diff --git a/compiler/optimizing/parallel_move_resolver.cc b/compiler/optimizing/parallel_move_resolver.cc
index be470cc..2036b4a 100644
--- a/compiler/optimizing/parallel_move_resolver.cc
+++ b/compiler/optimizing/parallel_move_resolver.cc
@@ -457,7 +457,7 @@
     DCHECK_NE(kind, Location::kConstant);
     Location scratch = AllocateScratchLocationFor(kind);
     // We only care about the move size.
-    Primitive::Type type = move->Is64BitMove() ? Primitive::kPrimLong : Primitive::kPrimInt;
+    DataType::Type type = move->Is64BitMove() ? DataType::Type::kInt64 : DataType::Type::kInt32;
     // Perform (C -> scratch)
     move->SetDestination(scratch);
     EmitMove(index);
@@ -521,7 +521,8 @@
 }
 
 void ParallelMoveResolverNoSwap::AddPendingMove(Location source,
-    Location destination, Primitive::Type type) {
+                                                Location destination,
+                                                DataType::Type type) {
   pending_moves_.push_back(new (allocator_) MoveOperands(source, destination, type, nullptr));
 }
 
diff --git a/compiler/optimizing/parallel_move_resolver.h b/compiler/optimizing/parallel_move_resolver.h
index 4278861..e6e069f 100644
--- a/compiler/optimizing/parallel_move_resolver.h
+++ b/compiler/optimizing/parallel_move_resolver.h
@@ -19,8 +19,8 @@
 
 #include "base/arena_containers.h"
 #include "base/value_object.h"
+#include "data_type.h"
 #include "locations.h"
-#include "primitive.h"
 
 namespace art {
 
@@ -177,7 +177,7 @@
 
   void UpdateMoveSource(Location from, Location to);
 
-  void AddPendingMove(Location source, Location destination, Primitive::Type type);
+  void AddPendingMove(Location source, Location destination, DataType::Type type);
 
   void DeletePendingMove(MoveOperands* move);
 
diff --git a/compiler/optimizing/parallel_move_test.cc b/compiler/optimizing/parallel_move_test.cc
index 50620f0..cb87cab 100644
--- a/compiler/optimizing/parallel_move_test.cc
+++ b/compiler/optimizing/parallel_move_test.cc
@@ -158,7 +158,7 @@
     moves->AddMove(
         Location::RegisterLocation(operands[i][0]),
         Location::RegisterLocation(operands[i][1]),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
   }
   return moves;
@@ -264,12 +264,12 @@
   moves->AddMove(
       Location::ConstantLocation(new (&allocator) HIntConstant(0)),
       Location::RegisterLocation(0),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   moves->AddMove(
       Location::RegisterLocation(1),
       Location::RegisterLocation(2),
-      Primitive::kPrimInt,
+      DataType::Type::kInt32,
       nullptr);
   resolver.EmitNativeCode(moves);
   ASSERT_STREQ("(1 -> 2) (C -> 0)", resolver.GetMessage().c_str());
@@ -285,12 +285,12 @@
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(4),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     ASSERT_STREQ("(2 -> 4) (0,1 -> 2,3)", resolver.GetMessage().c_str());
@@ -302,12 +302,12 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(4),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     ASSERT_STREQ("(2 -> 4) (0,1 -> 2,3)", resolver.GetMessage().c_str());
@@ -319,12 +319,12 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(0),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -339,17 +339,17 @@
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(7),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(7),
         Location::RegisterLocation(1),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -365,17 +365,17 @@
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(7),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(7),
         Location::RegisterLocation(1),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -391,17 +391,17 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(7),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(7),
         Location::RegisterLocation(1),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -416,12 +416,12 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(2, 3),
         Location::RegisterPairLocation(0, 1),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -436,12 +436,12 @@
     moves->AddMove(
         Location::RegisterPairLocation(2, 3),
         Location::RegisterPairLocation(0, 1),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -473,17 +473,17 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(0),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(3),
         Location::RegisterLocation(1),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -499,17 +499,17 @@
     moves->AddMove(
         Location::RegisterLocation(2),
         Location::RegisterLocation(0),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(3),
         Location::RegisterLocation(1),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -527,17 +527,17 @@
     moves->AddMove(
         Location::RegisterLocation(10),
         Location::RegisterLocation(5),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(4, 5),
         Location::DoubleStackSlot(32),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::DoubleStackSlot(32),
         Location::RegisterPairLocation(10, 11),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -560,17 +560,17 @@
     moves->AddMove(
         Location::RegisterLocation(0),
         Location::RegisterLocation(1),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(1),
         Location::StackSlot(48),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::StackSlot(48),
         Location::RegisterLocation(0),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -587,17 +587,17 @@
     moves->AddMove(
         Location::RegisterPairLocation(0, 1),
         Location::RegisterPairLocation(2, 3),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(2, 3),
         Location::DoubleStackSlot(32),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::DoubleStackSlot(32),
         Location::RegisterPairLocation(0, 1),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
@@ -619,17 +619,17 @@
     moves->AddMove(
         Location::RegisterLocation(0),
         Location::RegisterLocation(3),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     moves->AddMove(
         Location::RegisterPairLocation(2, 3),
         Location::RegisterPairLocation(0, 1),
-        Primitive::kPrimLong,
+        DataType::Type::kInt64,
         nullptr);
     moves->AddMove(
         Location::RegisterLocation(7),
         Location::RegisterLocation(2),
-        Primitive::kPrimInt,
+        DataType::Type::kInt32,
         nullptr);
     resolver.EmitNativeCode(moves);
     if (TestFixture::has_swap) {
diff --git a/compiler/optimizing/pc_relative_fixups_x86.cc b/compiler/optimizing/pc_relative_fixups_x86.cc
index 9877e10..a114e78 100644
--- a/compiler/optimizing/pc_relative_fixups_x86.cc
+++ b/compiler/optimizing/pc_relative_fixups_x86.cc
@@ -63,7 +63,7 @@
 
   void VisitReturn(HReturn* ret) OVERRIDE {
     HConstant* value = ret->InputAt(0)->AsConstant();
-    if ((value != nullptr && Primitive::IsFloatingPointType(value->GetType()))) {
+    if ((value != nullptr && DataType::IsFloatingPointType(value->GetType()))) {
       ReplaceInput(ret, value, 0, true);
     }
   }
@@ -102,7 +102,7 @@
 
   void BinaryFP(HBinaryOperation* bin) {
     HConstant* rhs = bin->InputAt(1)->AsConstant();
-    if (rhs != nullptr && Primitive::IsFloatingPointType(rhs->GetType())) {
+    if (rhs != nullptr && DataType::IsFloatingPointType(rhs->GetType())) {
       ReplaceInput(bin, rhs, 1, false);
     }
   }
@@ -132,7 +132,7 @@
   }
 
   void VisitNeg(HNeg* neg) OVERRIDE {
-    if (Primitive::IsFloatingPointType(neg->GetType())) {
+    if (DataType::IsFloatingPointType(neg->GetType())) {
       // We need to replace the HNeg with a HX86FPNeg in order to address the constant area.
       HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(neg);
       HGraph* graph = GetGraph();
@@ -225,7 +225,7 @@
     HInputsRef inputs = invoke->GetInputs();
     for (size_t i = 0; i < inputs.size(); i++) {
       HConstant* input = inputs[i]->AsConstant();
-      if (input != nullptr && Primitive::IsFloatingPointType(input->GetType())) {
+      if (input != nullptr && DataType::IsFloatingPointType(input->GetType())) {
         ReplaceInput(invoke, input, i, true);
       }
     }
diff --git a/compiler/optimizing/prepare_for_register_allocation.cc b/compiler/optimizing/prepare_for_register_allocation.cc
index 2c856cd..b52de36 100644
--- a/compiler/optimizing/prepare_for_register_allocation.cc
+++ b/compiler/optimizing/prepare_for_register_allocation.cc
@@ -77,7 +77,7 @@
   // BoundType (as value input of this ArraySet) with a NullConstant.
   // If so, this ArraySet no longer needs a type check.
   if (value->IsNullConstant()) {
-    DCHECK_EQ(value->GetType(), Primitive::kPrimNot);
+    DCHECK_EQ(value->GetType(), DataType::Type::kReference);
     if (instruction->NeedsTypeCheck()) {
       instruction->ClearNeedsTypeCheck();
     }
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index 93613a5..f5064c3 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -133,7 +133,7 @@
     for (HBasicBlock* block : graph_->GetReversePostOrder()) {
       for (HInstructionIterator iti(block->GetInstructions()); !iti.Done(); iti.Advance()) {
         HInstruction* instr = iti.Current();
-        if (instr->GetType() == Primitive::kPrimNot) {
+        if (instr->GetType() == DataType::Type::kReference) {
           DCHECK(instr->GetReferenceTypeInfo().IsValid())
               << "Invalid RTI for instruction: " << instr->DebugName();
           if (instr->IsBoundType()) {
@@ -555,7 +555,7 @@
                                                                    dex::TypeIndex type_idx,
                                                                    const DexFile& dex_file,
                                                                    bool is_exact) {
-  DCHECK_EQ(instr->GetType(), Primitive::kPrimNot);
+  DCHECK_EQ(instr->GetType(), DataType::Type::kReference);
 
   ScopedObjectAccess soa(Thread::Current());
   ObjPtr<mirror::DexCache> dex_cache = FindDexCacheWithHint(soa.Self(), dex_file, hint_dex_cache_);
@@ -576,7 +576,7 @@
 
 void ReferenceTypePropagation::RTPVisitor::VisitParameterValue(HParameterValue* instr) {
   // We check if the existing type is valid: the inliner may have set it.
-  if (instr->GetType() == Primitive::kPrimNot && !instr->GetReferenceTypeInfo().IsValid()) {
+  if (instr->GetType() == DataType::Type::kReference && !instr->GetReferenceTypeInfo().IsValid()) {
     UpdateReferenceTypeInfo(instr,
                             instr->GetTypeIndex(),
                             instr->GetDexFile(),
@@ -586,7 +586,7 @@
 
 void ReferenceTypePropagation::RTPVisitor::UpdateFieldAccessTypeInfo(HInstruction* instr,
                                                                      const FieldInfo& info) {
-  if (instr->GetType() != Primitive::kPrimNot) {
+  if (instr->GetType() != DataType::Type::kReference) {
     return;
   }
 
@@ -612,7 +612,7 @@
 void ReferenceTypePropagation::RTPVisitor::VisitUnresolvedInstanceFieldGet(
     HUnresolvedInstanceFieldGet* instr) {
   // TODO: Use descriptor to get the actual type.
-  if (instr->GetFieldType() == Primitive::kPrimNot) {
+  if (instr->GetFieldType() == DataType::Type::kReference) {
     instr->SetReferenceTypeInfo(instr->GetBlock()->GetGraph()->GetInexactObjectRti());
   }
 }
@@ -620,7 +620,7 @@
 void ReferenceTypePropagation::RTPVisitor::VisitUnresolvedStaticFieldGet(
     HUnresolvedStaticFieldGet* instr) {
   // TODO: Use descriptor to get the actual type.
-  if (instr->GetFieldType() == Primitive::kPrimNot) {
+  if (instr->GetFieldType() == DataType::Type::kReference) {
     instr->SetReferenceTypeInfo(instr->GetBlock()->GetGraph()->GetInexactObjectRti());
   }
 }
@@ -729,7 +729,7 @@
 }
 
 void ReferenceTypePropagation::VisitPhi(HPhi* phi) {
-  if (phi->IsDead() || phi->GetType() != Primitive::kPrimNot) {
+  if (phi->IsDead() || phi->GetType() != DataType::Type::kReference) {
     return;
   }
 
@@ -813,7 +813,7 @@
 }
 
 void ReferenceTypePropagation::UpdateArrayGet(HArrayGet* instr, HandleCache* handle_cache) {
-  DCHECK_EQ(Primitive::kPrimNot, instr->GetType());
+  DCHECK_EQ(DataType::Type::kReference, instr->GetType());
 
   ReferenceTypeInfo parent_rti = instr->InputAt(0)->GetReferenceTypeInfo();
   if (!parent_rti.IsValid()) {
@@ -857,7 +857,7 @@
 }
 
 void ReferenceTypePropagation::RTPVisitor::VisitInvoke(HInvoke* instr) {
-  if (instr->GetType() != Primitive::kPrimNot) {
+  if (instr->GetType() != DataType::Type::kReference) {
     return;
   }
 
@@ -868,7 +868,7 @@
 }
 
 void ReferenceTypePropagation::RTPVisitor::VisitArrayGet(HArrayGet* instr) {
-  if (instr->GetType() != Primitive::kPrimNot) {
+  if (instr->GetType() != DataType::Type::kReference) {
     return;
   }
 
@@ -989,7 +989,7 @@
 }
 
 void ReferenceTypePropagation::AddToWorklist(HInstruction* instruction) {
-  DCHECK_EQ(instruction->GetType(), Primitive::kPrimNot)
+  DCHECK_EQ(instruction->GetType(), DataType::Type::kReference)
       << instruction->DebugName() << ":" << instruction->GetType();
   worklist_.push_back(instruction);
 }
@@ -1000,7 +1000,7 @@
     if ((user->IsPhi() && user->AsPhi()->IsLive())
        || user->IsBoundType()
        || user->IsNullCheck()
-       || (user->IsArrayGet() && (user->GetType() == Primitive::kPrimNot))) {
+       || (user->IsArrayGet() && (user->GetType() == DataType::Type::kReference))) {
       AddToWorklist(user);
     }
   }
diff --git a/compiler/optimizing/register_allocation_resolver.cc b/compiler/optimizing/register_allocation_resolver.cc
index ce3a496..f0057c3 100644
--- a/compiler/optimizing/register_allocation_resolver.cc
+++ b/compiler/optimizing/register_allocation_resolver.cc
@@ -100,24 +100,24 @@
       // [art method            ].
       size_t slot = current->GetSpillSlot();
       switch (current->GetType()) {
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           slot += long_spill_slots;
           FALLTHROUGH_INTENDED;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           slot += float_spill_slots;
           FALLTHROUGH_INTENDED;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           slot += int_spill_slots;
           FALLTHROUGH_INTENDED;
-        case Primitive::kPrimNot:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
-        case Primitive::kPrimByte:
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimShort:
+        case DataType::Type::kReference:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt8:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt16:
           slot += reserved_out_slots;
           break;
-        case Primitive::kPrimVoid:
+        case DataType::Type::kVoid:
           LOG(FATAL) << "Unexpected type for interval " << current->GetType();
       }
       current->SetSpillSlot(slot * kVRegSize);
@@ -205,12 +205,12 @@
     size_t temp_index = liveness_.GetTempIndex(temp);
     LocationSummary* locations = at->GetLocations();
     switch (temp->GetType()) {
-      case Primitive::kPrimInt:
+      case DataType::Type::kInt32:
         locations->SetTempAt(temp_index, Location::RegisterLocation(temp->GetRegister()));
         break;
 
-      case Primitive::kPrimDouble:
-        if (codegen_->NeedsTwoRegisters(Primitive::kPrimDouble)) {
+      case DataType::Type::kFloat64:
+        if (codegen_->NeedsTwoRegisters(DataType::Type::kFloat64)) {
           Location location = Location::FpuRegisterPairLocation(
               temp->GetRegister(), temp->GetHighInterval()->GetRegister());
           locations->SetTempAt(temp_index, location);
@@ -383,7 +383,7 @@
          safepoint_position = safepoint_position->GetNext()) {
       DCHECK(current->CoversSlow(safepoint_position->GetPosition()));
 
-      if (current->GetType() == Primitive::kPrimNot) {
+      if (current->GetType() == DataType::Type::kReference) {
         DCHECK(interval->GetDefinedBy()->IsActualObject())
             << interval->GetDefinedBy()->DebugName()
             << '(' << interval->GetDefinedBy()->GetId() << ')'
@@ -507,13 +507,13 @@
                                          Location source,
                                          Location destination,
                                          HInstruction* instruction,
-                                         Primitive::Type type) const {
-  if (type == Primitive::kPrimLong
+                                         DataType::Type type) const {
+  if (type == DataType::Type::kInt64
       && codegen_->ShouldSplitLongMoves()
       // The parallel move resolver knows how to deal with long constants.
       && !source.IsConstant()) {
-    move->AddMove(source.ToLow(), destination.ToLow(), Primitive::kPrimInt, instruction);
-    move->AddMove(source.ToHigh(), destination.ToHigh(), Primitive::kPrimInt, nullptr);
+    move->AddMove(source.ToLow(), destination.ToLow(), DataType::Type::kInt32, instruction);
+    move->AddMove(source.ToHigh(), destination.ToHigh(), DataType::Type::kInt32, nullptr);
   } else {
     move->AddMove(source, destination, type, instruction);
   }
diff --git a/compiler/optimizing/register_allocation_resolver.h b/compiler/optimizing/register_allocation_resolver.h
index d48b1a0..4a148e0 100644
--- a/compiler/optimizing/register_allocation_resolver.h
+++ b/compiler/optimizing/register_allocation_resolver.h
@@ -20,7 +20,7 @@
 #include "base/arena_containers.h"
 #include "base/array_ref.h"
 #include "base/value_object.h"
-#include "primitive.h"
+#include "data_type.h"
 
 namespace art {
 
@@ -88,7 +88,7 @@
                Location source,
                Location destination,
                HInstruction* instruction,
-               Primitive::Type type) const;
+               DataType::Type type) const;
 
   ArenaAllocator* const allocator_;
   CodeGenerator* const codegen_;
diff --git a/compiler/optimizing/register_allocator.h b/compiler/optimizing/register_allocator.h
index 7e1fff8..4375d68 100644
--- a/compiler/optimizing/register_allocator.h
+++ b/compiler/optimizing/register_allocator.h
@@ -21,7 +21,6 @@
 #include "base/arena_containers.h"
 #include "base/arena_object.h"
 #include "base/macros.h"
-#include "primitive.h"
 
 namespace art {
 
diff --git a/compiler/optimizing/register_allocator_graph_color.cc b/compiler/optimizing/register_allocator_graph_color.cc
index 5e22772..4ff7315 100644
--- a/compiler/optimizing/register_allocator_graph_color.cc
+++ b/compiler/optimizing/register_allocator_graph_color.cc
@@ -540,7 +540,7 @@
 };
 
 static bool IsCoreInterval(LiveInterval* interval) {
-  return !Primitive::IsFloatingPointType(interval->GetType());
+  return !DataType::IsFloatingPointType(interval->GetType());
 }
 
 static size_t ComputeReservedArtMethodSlots(const CodeGenerator& codegen) {
@@ -573,7 +573,7 @@
   // This includes globally blocked registers, such as the stack pointer.
   physical_core_nodes_.resize(codegen_->GetNumberOfCoreRegisters(), nullptr);
   for (size_t i = 0; i < codegen_->GetNumberOfCoreRegisters(); ++i) {
-    LiveInterval* interval = LiveInterval::MakeFixedInterval(allocator_, i, Primitive::kPrimInt);
+    LiveInterval* interval = LiveInterval::MakeFixedInterval(allocator_, i, DataType::Type::kInt32);
     physical_core_nodes_[i] =
         new (allocator_) InterferenceNode(allocator_, interval, liveness);
     physical_core_nodes_[i]->stage = NodeStage::kPrecolored;
@@ -585,7 +585,8 @@
   // Initialize physical floating point register live intervals and blocked registers.
   physical_fp_nodes_.resize(codegen_->GetNumberOfFloatingPointRegisters(), nullptr);
   for (size_t i = 0; i < codegen_->GetNumberOfFloatingPointRegisters(); ++i) {
-    LiveInterval* interval = LiveInterval::MakeFixedInterval(allocator_, i, Primitive::kPrimFloat);
+    LiveInterval* interval =
+        LiveInterval::MakeFixedInterval(allocator_, i, DataType::Type::kFloat32);
     physical_fp_nodes_[i] =
         new (allocator_) InterferenceNode(allocator_, interval, liveness);
     physical_fp_nodes_[i]->stage = NodeStage::kPrecolored;
@@ -936,7 +937,7 @@
       switch (temp.GetPolicy()) {
         case Location::kRequiresRegister: {
           LiveInterval* interval =
-              LiveInterval::MakeTempInterval(allocator_, Primitive::kPrimInt);
+              LiveInterval::MakeTempInterval(allocator_, DataType::Type::kInt32);
           interval->AddTempUse(instruction, i);
           core_intervals_.push_back(interval);
           temp_intervals_.push_back(interval);
@@ -945,11 +946,11 @@
 
         case Location::kRequiresFpuRegister: {
           LiveInterval* interval =
-              LiveInterval::MakeTempInterval(allocator_, Primitive::kPrimDouble);
+              LiveInterval::MakeTempInterval(allocator_, DataType::Type::kFloat64);
           interval->AddTempUse(instruction, i);
           fp_intervals_.push_back(interval);
           temp_intervals_.push_back(interval);
-          if (codegen_->NeedsTwoRegisters(Primitive::kPrimDouble)) {
+          if (codegen_->NeedsTwoRegisters(DataType::Type::kFloat64)) {
             interval->AddHighInterval(/*is_temp*/ true);
             temp_intervals_.push_back(interval->GetHighInterval());
           }
@@ -1927,24 +1928,24 @@
       // We need to find a spill slot for this interval. Place it in the correct
       // worklist to be processed later.
       switch (node->GetInterval()->GetType()) {
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           double_intervals.push_back(parent);
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           long_intervals.push_back(parent);
           break;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           float_intervals.push_back(parent);
           break;
-        case Primitive::kPrimNot:
-        case Primitive::kPrimInt:
-        case Primitive::kPrimChar:
-        case Primitive::kPrimByte:
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimShort:
+        case DataType::Type::kReference:
+        case DataType::Type::kInt32:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt8:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt16:
           int_intervals.push_back(parent);
           break;
-        case Primitive::kPrimVoid:
+        case DataType::Type::kVoid:
           LOG(FATAL) << "Unexpected type for interval " << node->GetInterval()->GetType();
           UNREACHABLE();
       }
diff --git a/compiler/optimizing/register_allocator_graph_color.h b/compiler/optimizing/register_allocator_graph_color.h
index 548687f..3f6d674 100644
--- a/compiler/optimizing/register_allocator_graph_color.h
+++ b/compiler/optimizing/register_allocator_graph_color.h
@@ -21,7 +21,6 @@
 #include "base/arena_containers.h"
 #include "base/arena_object.h"
 #include "base/macros.h"
-#include "primitive.h"
 #include "register_allocator.h"
 
 namespace art {
diff --git a/compiler/optimizing/register_allocator_linear_scan.cc b/compiler/optimizing/register_allocator_linear_scan.cc
index ab8d540..2012cd5 100644
--- a/compiler/optimizing/register_allocator_linear_scan.cc
+++ b/compiler/optimizing/register_allocator_linear_scan.cc
@@ -83,8 +83,8 @@
 
 static bool ShouldProcess(bool processing_core_registers, LiveInterval* interval) {
   if (interval == nullptr) return false;
-  bool is_core_register = (interval->GetType() != Primitive::kPrimDouble)
-      && (interval->GetType() != Primitive::kPrimFloat);
+  bool is_core_register = (interval->GetType() != DataType::Type::kFloat64)
+      && (interval->GetType() != DataType::Type::kFloat32);
   return processing_core_registers == is_core_register;
 }
 
@@ -132,9 +132,9 @@
   LiveInterval* interval = location.IsRegister()
       ? physical_core_register_intervals_[reg]
       : physical_fp_register_intervals_[reg];
-  Primitive::Type type = location.IsRegister()
-      ? Primitive::kPrimInt
-      : Primitive::kPrimFloat;
+  DataType::Type type = location.IsRegister()
+      ? DataType::Type::kInt32
+      : DataType::Type::kFloat32;
   if (interval == nullptr) {
     interval = LiveInterval::MakeFixedInterval(allocator_, reg, type);
     if (location.IsRegister()) {
@@ -237,7 +237,7 @@
       switch (temp.GetPolicy()) {
         case Location::kRequiresRegister: {
           LiveInterval* interval =
-              LiveInterval::MakeTempInterval(allocator_, Primitive::kPrimInt);
+              LiveInterval::MakeTempInterval(allocator_, DataType::Type::kInt32);
           temp_intervals_.push_back(interval);
           interval->AddTempUse(instruction, i);
           unhandled_core_intervals_.push_back(interval);
@@ -246,10 +246,10 @@
 
         case Location::kRequiresFpuRegister: {
           LiveInterval* interval =
-              LiveInterval::MakeTempInterval(allocator_, Primitive::kPrimDouble);
+              LiveInterval::MakeTempInterval(allocator_, DataType::Type::kFloat64);
           temp_intervals_.push_back(interval);
           interval->AddTempUse(instruction, i);
-          if (codegen_->NeedsTwoRegisters(Primitive::kPrimDouble)) {
+          if (codegen_->NeedsTwoRegisters(DataType::Type::kFloat64)) {
             interval->AddHighInterval(/* is_temp */ true);
             LiveInterval* high = interval->GetHighInterval();
             temp_intervals_.push_back(high);
@@ -266,8 +266,8 @@
     }
   }
 
-  bool core_register = (instruction->GetType() != Primitive::kPrimDouble)
-      && (instruction->GetType() != Primitive::kPrimFloat);
+  bool core_register = (instruction->GetType() != DataType::Type::kFloat64)
+      && (instruction->GetType() != DataType::Type::kFloat32);
 
   if (locations->NeedsSafepoint()) {
     if (codegen_->IsLeafMethod()) {
@@ -1104,24 +1104,24 @@
 
   ArenaVector<size_t>* spill_slots = nullptr;
   switch (interval->GetType()) {
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       spill_slots = &double_spill_slots_;
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       spill_slots = &long_spill_slots_;
       break;
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       spill_slots = &float_spill_slots_;
       break;
-    case Primitive::kPrimNot:
-    case Primitive::kPrimInt:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimShort:
+    case DataType::Type::kReference:
+    case DataType::Type::kInt32:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt8:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt16:
       spill_slots = &int_spill_slots_;
       break;
-    case Primitive::kPrimVoid:
+    case DataType::Type::kVoid:
       LOG(FATAL) << "Unexpected type for interval " << interval->GetType();
   }
 
diff --git a/compiler/optimizing/register_allocator_linear_scan.h b/compiler/optimizing/register_allocator_linear_scan.h
index b3834f4..9c650a4 100644
--- a/compiler/optimizing/register_allocator_linear_scan.h
+++ b/compiler/optimizing/register_allocator_linear_scan.h
@@ -20,7 +20,6 @@
 #include "arch/instruction_set.h"
 #include "base/arena_containers.h"
 #include "base/macros.h"
-#include "primitive.h"
 #include "register_allocator.h"
 
 namespace art {
diff --git a/compiler/optimizing/register_allocator_test.cc b/compiler/optimizing/register_allocator_test.cc
index bcdd7f9..59987e2 100644
--- a/compiler/optimizing/register_allocator_test.cc
+++ b/compiler/optimizing/register_allocator_test.cc
@@ -461,15 +461,15 @@
   // Add three temps holding the same register, and starting at different positions.
   // Put the one that should be picked in the middle of the inactive list to ensure
   // we do not depend on an order.
-  LiveInterval* interval = LiveInterval::MakeFixedInterval(&allocator, 0, Primitive::kPrimInt);
+  LiveInterval* interval = LiveInterval::MakeFixedInterval(&allocator, 0, DataType::Type::kInt32);
   interval->AddRange(40, 50);
   register_allocator.inactive_.push_back(interval);
 
-  interval = LiveInterval::MakeFixedInterval(&allocator, 0, Primitive::kPrimInt);
+  interval = LiveInterval::MakeFixedInterval(&allocator, 0, DataType::Type::kInt32);
   interval->AddRange(20, 30);
   register_allocator.inactive_.push_back(interval);
 
-  interval = LiveInterval::MakeFixedInterval(&allocator, 0, Primitive::kPrimInt);
+  interval = LiveInterval::MakeFixedInterval(&allocator, 0, DataType::Type::kInt32);
   interval->AddRange(60, 70);
   register_allocator.inactive_.push_back(interval);
 
@@ -496,7 +496,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HBasicBlock* block = new (allocator) HBasicBlock(graph);
@@ -505,7 +505,7 @@
 
   HInstruction* test = new (allocator) HInstanceFieldGet(parameter,
                                                          nullptr,
-                                                         Primitive::kPrimBoolean,
+                                                         DataType::Type::kBool,
                                                          MemberOffset(22),
                                                          false,
                                                          kUnknownFieldIndex,
@@ -528,11 +528,11 @@
   then->AddInstruction(new (allocator) HGoto());
   else_->AddInstruction(new (allocator) HGoto());
 
-  *phi = new (allocator) HPhi(allocator, 0, 0, Primitive::kPrimInt);
+  *phi = new (allocator) HPhi(allocator, 0, 0, DataType::Type::kInt32);
   join->AddPhi(*phi);
   *input1 = new (allocator) HInstanceFieldGet(parameter,
                                               nullptr,
-                                              Primitive::kPrimInt,
+                                              DataType::Type::kInt32,
                                               MemberOffset(42),
                                               false,
                                               kUnknownFieldIndex,
@@ -541,7 +541,7 @@
                                               0);
   *input2 = new (allocator) HInstanceFieldGet(parameter,
                                               nullptr,
-                                              Primitive::kPrimInt,
+                                              DataType::Type::kInt32,
                                               MemberOffset(42),
                                               false,
                                               kUnknownFieldIndex,
@@ -658,7 +658,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   entry->AddInstruction(parameter);
 
   HBasicBlock* block = new (allocator) HBasicBlock(graph);
@@ -667,7 +667,7 @@
 
   *field = new (allocator) HInstanceFieldGet(parameter,
                                              nullptr,
-                                             Primitive::kPrimInt,
+                                             DataType::Type::kInt32,
                                              MemberOffset(42),
                                              false,
                                              kUnknownFieldIndex,
@@ -742,7 +742,7 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* parameter = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   entry->AddInstruction(parameter);
 
   HInstruction* constant1 = graph->GetIntConstant(1);
@@ -752,9 +752,9 @@
   graph->AddBlock(block);
   entry->AddSuccessor(block);
 
-  *first_sub = new (allocator) HSub(Primitive::kPrimInt, parameter, constant1);
+  *first_sub = new (allocator) HSub(DataType::Type::kInt32, parameter, constant1);
   block->AddInstruction(*first_sub);
-  *second_sub = new (allocator) HSub(Primitive::kPrimInt, *first_sub, constant2);
+  *second_sub = new (allocator) HSub(DataType::Type::kInt32, *first_sub, constant2);
   block->AddInstruction(*second_sub);
 
   block->AddInstruction(new (allocator) HExit());
@@ -821,9 +821,9 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* first = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   HInstruction* second = new (allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   entry->AddInstruction(first);
   entry->AddInstruction(second);
 
@@ -831,7 +831,8 @@
   graph->AddBlock(block);
   entry->AddSuccessor(block);
 
-  *div = new (allocator) HDiv(Primitive::kPrimInt, first, second, 0);  // don't care about dex_pc.
+  *div =
+      new (allocator) HDiv(DataType::Type::kInt32, first, second, 0);  // don't care about dex_pc.
   block->AddInstruction(*div);
 
   block->AddInstruction(new (allocator) HExit());
@@ -883,13 +884,13 @@
   graph->AddBlock(entry);
   graph->SetEntryBlock(entry);
   HInstruction* one = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   HInstruction* two = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   HInstruction* three = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   HInstruction* four = new (&allocator) HParameterValue(
-      graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   entry->AddInstruction(one);
   entry->AddInstruction(two);
   entry->AddInstruction(three);
@@ -902,7 +903,7 @@
 
   // We create a synthesized user requesting a register, to avoid just spilling the
   // intervals.
-  HPhi* user = new (&allocator) HPhi(&allocator, 0, 1, Primitive::kPrimInt);
+  HPhi* user = new (&allocator) HPhi(&allocator, 0, 1, DataType::Type::kInt32);
   user->AddInput(one);
   user->SetBlock(block);
   LocationSummary* locations = new (&allocator) LocationSummary(user, LocationSummary::kNoCall);
diff --git a/compiler/optimizing/scheduler.cc b/compiler/optimizing/scheduler.cc
index 38cd51b..5212e86 100644
--- a/compiler/optimizing/scheduler.cc
+++ b/compiler/optimizing/scheduler.cc
@@ -16,9 +16,11 @@
 
 #include <string>
 
-#include "prepare_for_register_allocation.h"
 #include "scheduler.h"
 
+#include "data_type-inl.h"
+#include "prepare_for_register_allocation.h"
+
 #ifdef ART_ENABLE_CODEGEN_arm64
 #include "scheduler_arm64.h"
 #endif
@@ -399,17 +401,7 @@
 }
 
 static const std::string InstructionTypeId(const HInstruction* instruction) {
-  std::string id;
-  Primitive::Type type = instruction->GetType();
-  if (type == Primitive::kPrimNot) {
-    id.append("l");
-  } else {
-    id.append(Primitive::Descriptor(instruction->GetType()));
-  }
-  // Use lower-case to be closer to the `HGraphVisualizer` output.
-  id[0] = std::tolower(id[0]);
-  id.append(std::to_string(instruction->GetId()));
-  return id;
+  return DataType::TypeId(instruction->GetType()) + std::to_string(instruction->GetId());
 }
 
 // Ideally we would reuse the graph visualizer code, but it is not available
diff --git a/compiler/optimizing/scheduler_arm.cc b/compiler/optimizing/scheduler_arm.cc
index 66756a5..110db47 100644
--- a/compiler/optimizing/scheduler_arm.cc
+++ b/compiler/optimizing/scheduler_arm.cc
@@ -31,15 +31,15 @@
 
 void SchedulingLatencyVisitorARM::HandleBinaryOperationLantencies(HBinaryOperation* instr) {
   switch (instr->GetResultType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       // HAdd and HSub long operations translate to ADDS+ADC or SUBS+SBC pairs,
       // so a bubble (kArmNopLatency) is added to represent the internal carry flag
       // dependency inside these pairs.
       last_visited_internal_latency_ = kArmIntegerOpLatency + kArmNopLatency;
       last_visited_latency_ = kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       last_visited_latency_ = kArmFloatingPointOpLatency;
       break;
     default:
@@ -58,12 +58,12 @@
 
 void SchedulingLatencyVisitorARM::VisitMul(HMul* instr) {
   switch (instr->GetResultType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       last_visited_internal_latency_ = 3 * kArmMulIntegerLatency;
       last_visited_latency_ = kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       last_visited_latency_ = kArmMulFloatingPointLatency;
       break;
     default:
@@ -74,12 +74,12 @@
 
 void SchedulingLatencyVisitorARM::HandleBitwiseOperationLantencies(HBinaryOperation* instr) {
   switch (instr->GetResultType()) {
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       last_visited_internal_latency_ = kArmIntegerOpLatency;
       last_visited_latency_ = kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       last_visited_latency_ = kArmFloatingPointOpLatency;
       break;
     default:
@@ -102,10 +102,10 @@
 
 void SchedulingLatencyVisitorARM::VisitRor(HRor* instr) {
   switch (instr->GetResultType()) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       last_visited_latency_ = kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       // HandleLongRotate
       HInstruction* rhs = instr->GetRight();
       if (rhs->IsConstant()) {
@@ -130,16 +130,16 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleShiftLatencies(HBinaryOperation* instr) {
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   HInstruction* rhs = instr->GetRight();
   switch (type) {
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       if (!rhs->IsConstant()) {
         last_visited_internal_latency_ = kArmIntegerOpLatency;
       }
       last_visited_latency_ = kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (!rhs->IsConstant()) {
         last_visited_internal_latency_ = 8 * kArmIntegerOpLatency;
       } else {
@@ -204,7 +204,7 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateLongTestConstant(HCondition* condition) {
-  DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(condition->GetLeft()->GetType(), DataType::Type::kInt64);
 
   IfCondition cond = condition->GetCondition();
 
@@ -270,7 +270,7 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateLongTest(HCondition* condition) {
-  DCHECK_EQ(condition->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(condition->GetLeft()->GetType(), DataType::Type::kInt64);
 
   IfCondition cond = condition->GetCondition();
 
@@ -301,13 +301,13 @@
 
 // The GenerateTest series of function all counted as internal latency.
 void SchedulingLatencyVisitorARM::HandleGenerateTest(HCondition* condition) {
-  const Primitive::Type type = condition->GetLeft()->GetType();
+  const DataType::Type type = condition->GetLeft()->GetType();
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     condition->InputAt(1)->IsConstant()
         ? HandleGenerateLongTestConstant(condition)
         : HandleGenerateLongTest(condition);
-  } else if (Primitive::IsFloatingPointType(type)) {
+  } else if (DataType::IsFloatingPointType(type)) {
     // GenerateVcmp + Vmrs
     last_visited_internal_latency_ += 2 * kArmFloatingPointOpLatency;
   } else {
@@ -317,7 +317,7 @@
 }
 
 bool SchedulingLatencyVisitorARM::CanGenerateTest(HCondition* condition) {
-  if (condition->GetLeft()->GetType() == Primitive::kPrimLong) {
+  if (condition->GetLeft()->GetType() == DataType::Type::kInt64) {
     HInstruction* right = condition->InputAt(1);
 
     if (right->IsConstant()) {
@@ -353,7 +353,7 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateEqualLong(HCondition* cond) {
-  DCHECK_EQ(cond->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(cond->GetLeft()->GetType(), DataType::Type::kInt64);
 
   IfCondition condition = cond->GetCondition();
 
@@ -374,7 +374,7 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateConditionLong(HCondition* cond) {
-  DCHECK_EQ(cond->GetLeft()->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(cond->GetLeft()->GetType(), DataType::Type::kInt64);
 
   IfCondition condition = cond->GetCondition();
   HInstruction* right = cond->InputAt(1);
@@ -424,11 +424,11 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateConditionIntegralOrNonPrimitive(HCondition* cond) {
-  const Primitive::Type type = cond->GetLeft()->GetType();
+  const DataType::Type type = cond->GetLeft()->GetType();
 
-  DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+  DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
 
-  if (type == Primitive::kPrimLong) {
+  if (type == DataType::Type::kInt64) {
     HandleGenerateConditionLong(cond);
     return;
   }
@@ -482,19 +482,19 @@
     return;
   }
 
-  const Primitive::Type type = cond->GetLeft()->GetType();
+  const DataType::Type type = cond->GetLeft()->GetType();
 
-  if (Primitive::IsFloatingPointType(type)) {
+  if (DataType::IsFloatingPointType(type)) {
     HandleGenerateConditionGeneric(cond);
     return;
   }
 
-  DCHECK(Primitive::IsIntegralType(type) || type == Primitive::kPrimNot) << type;
+  DCHECK(DataType::IsIntegralType(type) || type == DataType::Type::kReference) << type;
 
   const IfCondition condition = cond->GetCondition();
 
-  if (type == Primitive::kPrimBoolean &&
-      cond->GetRight()->GetType() == Primitive::kPrimBoolean &&
+  if (type == DataType::Type::kBool &&
+      cond->GetRight()->GetType() == DataType::Type::kBool &&
       (condition == kCondEQ || condition == kCondNE)) {
     if (condition == kCondEQ) {
       last_visited_internal_latency_ = kArmIntegerOpLatency;
@@ -511,20 +511,20 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitCompare(HCompare* instr) {
-  Primitive::Type type = instr->InputAt(0)->GetType();
+  DataType::Type type = instr->InputAt(0)->GetType();
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
       last_visited_internal_latency_ = 2 * kArmIntegerOpLatency;
       break;
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       last_visited_internal_latency_ = 2 * kArmIntegerOpLatency + 3 * kArmBranchLatency;
       break;
-    case Primitive::kPrimFloat:
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat32:
+    case DataType::Type::kFloat64:
       last_visited_internal_latency_ = kArmIntegerOpLatency + 2 * kArmFloatingPointOpLatency;
       break;
     default:
@@ -535,7 +535,7 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitBitwiseNegatedRight(HBitwiseNegatedRight* instruction) {
-  if (instruction->GetResultType() == Primitive::kPrimInt) {
+  if (instruction->GetResultType() == DataType::Type::kInt32) {
     last_visited_latency_ = kArmIntegerOpLatency;
   } else {
     last_visited_internal_latency_ = kArmIntegerOpLatency;
@@ -566,7 +566,7 @@
 }
 
 void SchedulingLatencyVisitorARM::HandleGenerateLongDataProc(HDataProcWithShifterOp* instruction) {
-  DCHECK_EQ(instruction->GetType(), Primitive::kPrimLong);
+  DCHECK_EQ(instruction->GetType(), DataType::Type::kInt64);
   DCHECK(HDataProcWithShifterOp::IsShiftOp(instruction->GetOpKind()));
 
   const uint32_t shift_value = instruction->GetShiftAmount();
@@ -595,10 +595,10 @@
 void SchedulingLatencyVisitorARM::VisitDataProcWithShifterOp(HDataProcWithShifterOp* instruction) {
   const HDataProcWithShifterOp::OpKind op_kind = instruction->GetOpKind();
 
-  if (instruction->GetType() == Primitive::kPrimInt) {
+  if (instruction->GetType() == DataType::Type::kInt32) {
     HandleGenerateDataProcInstruction();
   } else {
-    DCHECK_EQ(instruction->GetType(), Primitive::kPrimLong);
+    DCHECK_EQ(instruction->GetType(), DataType::Type::kInt64);
     if (HDataProcWithShifterOp::IsExtensionOp(op_kind)) {
       HandleGenerateDataProc(instruction);
     } else {
@@ -624,7 +624,7 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitArrayGet(HArrayGet* instruction) {
-  Primitive::Type type = instruction->GetType();
+  DataType::Type type = instruction->GetType();
   const bool maybe_compressed_char_at =
       mirror::kUseStringCompression && instruction->IsStringCharAt();
   HInstruction* array_instr = instruction->GetArray();
@@ -632,11 +632,11 @@
   HInstruction* index = instruction->InputAt(1);
 
   switch (type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       if (maybe_compressed_char_at) {
         last_visited_internal_latency_ += kArmMemoryLoadLatency;
       }
@@ -664,7 +664,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         last_visited_latency_ = kArmLoadWithBakerReadBarrierLatency;
       } else {
@@ -681,7 +681,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -691,7 +691,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -701,7 +701,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -727,16 +727,16 @@
 
 void SchedulingLatencyVisitorARM::VisitArraySet(HArraySet* instruction) {
   HInstruction* index = instruction->InputAt(1);
-  Primitive::Type value_type = instruction->GetComponentType();
+  DataType::Type value_type = instruction->GetComponentType();
   HInstruction* array_instr = instruction->GetArray();
   bool has_intermediate_address = array_instr->IsIntermediateAddress();
 
   switch (value_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt: {
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryStoreLatency;
       } else {
@@ -749,7 +749,7 @@
       break;
     }
 
-    case Primitive::kPrimNot: {
+    case DataType::Type::kReference: {
       if (instruction->InputAt(2)->IsNullConstant()) {
         if (index->IsConstant()) {
           last_visited_latency_ = kArmMemoryStoreLatency;
@@ -765,7 +765,7 @@
       break;
     }
 
-    case Primitive::kPrimLong: {
+    case DataType::Type::kInt64: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -775,7 +775,7 @@
       break;
     }
 
-    case Primitive::kPrimFloat: {
+    case DataType::Type::kFloat32: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -785,7 +785,7 @@
       break;
     }
 
-    case Primitive::kPrimDouble: {
+    case DataType::Type::kFloat64: {
       if (index->IsConstant()) {
         last_visited_latency_ = kArmMemoryLoadLatency;
       } else {
@@ -823,9 +823,9 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitDiv(HDiv* instruction) {
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       HInstruction* rhs = instruction->GetRight();
       if (rhs->IsConstant()) {
         int32_t imm = Int32ConstantFrom(rhs->AsConstant());
@@ -835,10 +835,10 @@
       }
       break;
     }
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       last_visited_latency_ = kArmDivFloatLatency;
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       last_visited_latency_ = kArmDivDoubleLatency;
       break;
     default:
@@ -886,9 +886,9 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitRem(HRem* instruction) {
-  Primitive::Type type = instruction->GetResultType();
+  DataType::Type type = instruction->GetResultType();
   switch (type) {
-    case Primitive::kPrimInt: {
+    case DataType::Type::kInt32: {
       HInstruction* rhs = instruction->GetRight();
       if (rhs->IsConstant()) {
         int32_t imm = Int32ConstantFrom(rhs->AsConstant());
@@ -911,19 +911,19 @@
   DCHECK(instruction->IsInstanceFieldGet() || instruction->IsStaticFieldGet());
   DCHECK(codegen_ != nullptr);
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   bool atomic_ldrd_strd = codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimInt:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt32:
       last_visited_latency_ = kArmMemoryLoadLatency;
       break;
 
-    case Primitive::kPrimNot:
+    case DataType::Type::kReference:
       if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
         last_visited_internal_latency_ = kArmMemoryLoadLatency + kArmIntegerOpLatency;
         last_visited_latency_ = kArmMemoryLoadLatency;
@@ -932,7 +932,7 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (is_volatile && !atomic_ldrd_strd) {
         last_visited_internal_latency_ = kArmMemoryLoadLatency + kArmIntegerOpLatency;
         last_visited_latency_ = kArmMemoryLoadLatency;
@@ -941,11 +941,11 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       last_visited_latency_ = kArmMemoryLoadLatency;
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       if (is_volatile && !atomic_ldrd_strd) {
         last_visited_internal_latency_ =
             kArmMemoryLoadLatency + kArmIntegerOpLatency + kArmMemoryLoadLatency;
@@ -970,16 +970,16 @@
   DCHECK(instruction->IsInstanceFieldSet() || instruction->IsStaticFieldSet());
   DCHECK(codegen_ != nullptr);
   bool is_volatile = field_info.IsVolatile();
-  Primitive::Type field_type = field_info.GetFieldType();
+  DataType::Type field_type = field_info.GetFieldType();
   bool needs_write_barrier =
       CodeGenerator::StoreNeedsWriteBarrier(field_type, instruction->InputAt(1));
   bool atomic_ldrd_strd = codegen_->GetInstructionSetFeatures().HasAtomicLdrdAndStrd();
 
   switch (field_type) {
-    case Primitive::kPrimBoolean:
-    case Primitive::kPrimByte:
-    case Primitive::kPrimShort:
-    case Primitive::kPrimChar:
+    case DataType::Type::kBool:
+    case DataType::Type::kInt8:
+    case DataType::Type::kInt16:
+    case DataType::Type::kUint16:
       if (is_volatile) {
         last_visited_internal_latency_ = kArmMemoryBarrierLatency + kArmMemoryStoreLatency;
         last_visited_latency_ = kArmMemoryBarrierLatency;
@@ -988,15 +988,15 @@
       }
       break;
 
-    case Primitive::kPrimInt:
-    case Primitive::kPrimNot:
+    case DataType::Type::kInt32:
+    case DataType::Type::kReference:
       if (kPoisonHeapReferences && needs_write_barrier) {
         last_visited_internal_latency_ += kArmIntegerOpLatency * 2;
       }
       last_visited_latency_ = kArmMemoryStoreLatency;
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       if (is_volatile && !atomic_ldrd_strd) {
         last_visited_internal_latency_ =
             kArmIntegerOpLatency + kArmMemoryLoadLatency + kArmMemoryStoreLatency;
@@ -1006,11 +1006,11 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       last_visited_latency_ = kArmMemoryStoreLatency;
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       if (is_volatile && !atomic_ldrd_strd) {
         last_visited_internal_latency_ = kArmIntegerOpLatency +
             kArmIntegerOpLatency + kArmMemoryLoadLatency + kArmMemoryStoreLatency;
@@ -1043,23 +1043,23 @@
 }
 
 void SchedulingLatencyVisitorARM::VisitTypeConversion(HTypeConversion* instr) {
-  Primitive::Type result_type = instr->GetResultType();
-  Primitive::Type input_type = instr->GetInputType();
+  DataType::Type result_type = instr->GetResultType();
+  DataType::Type input_type = instr->GetInputType();
 
   switch (result_type) {
-    case Primitive::kPrimByte:
-    case Primitive::kPrimChar:
-    case Primitive::kPrimShort:
+    case DataType::Type::kInt8:
+    case DataType::Type::kUint16:
+    case DataType::Type::kInt16:
       last_visited_latency_ = kArmIntegerOpLatency;  // SBFX or UBFX
       break;
 
-    case Primitive::kPrimInt:
+    case DataType::Type::kInt32:
       switch (input_type) {
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           last_visited_latency_ = kArmIntegerOpLatency;  // MOV
           break;
-        case Primitive::kPrimFloat:
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat32:
+        case DataType::Type::kFloat64:
           last_visited_internal_latency_ = kArmTypeConversionFloatingPointIntegerLatency;
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
@@ -1069,19 +1069,19 @@
       }
       break;
 
-    case Primitive::kPrimLong:
+    case DataType::Type::kInt64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte:
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           // MOV and extension
           last_visited_internal_latency_ = kArmIntegerOpLatency;
           last_visited_latency_ = kArmIntegerOpLatency;
           break;
-        case Primitive::kPrimFloat:
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat32:
+        case DataType::Type::kFloat64:
           // invokes runtime
           last_visited_internal_latency_ = kArmCallInternalLatency;
           break;
@@ -1092,21 +1092,21 @@
       }
       break;
 
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte:
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           last_visited_internal_latency_ = kArmTypeConversionFloatingPointIntegerLatency;
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           // invokes runtime
           last_visited_internal_latency_ = kArmCallInternalLatency;
           break;
-        case Primitive::kPrimDouble:
+        case DataType::Type::kFloat64:
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
         default:
@@ -1115,21 +1115,21 @@
       }
       break;
 
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       switch (input_type) {
-        case Primitive::kPrimBoolean:
-        case Primitive::kPrimByte:
-        case Primitive::kPrimChar:
-        case Primitive::kPrimShort:
-        case Primitive::kPrimInt:
+        case DataType::Type::kBool:
+        case DataType::Type::kInt8:
+        case DataType::Type::kUint16:
+        case DataType::Type::kInt16:
+        case DataType::Type::kInt32:
           last_visited_internal_latency_ = kArmTypeConversionFloatingPointIntegerLatency;
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
-        case Primitive::kPrimLong:
+        case DataType::Type::kInt64:
           last_visited_internal_latency_ = 5 * kArmFloatingPointOpLatency;
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
-        case Primitive::kPrimFloat:
+        case DataType::Type::kFloat32:
           last_visited_latency_ = kArmFloatingPointOpLatency;
           break;
         default:
diff --git a/compiler/optimizing/scheduler_arm64.cc b/compiler/optimizing/scheduler_arm64.cc
index 1d9d28a..7bcf4e7 100644
--- a/compiler/optimizing/scheduler_arm64.cc
+++ b/compiler/optimizing/scheduler_arm64.cc
@@ -24,7 +24,7 @@
 namespace arm64 {
 
 void SchedulingLatencyVisitorARM64::VisitBinaryOperation(HBinaryOperation* instr) {
-  last_visited_latency_ = Primitive::IsFloatingPointType(instr->GetResultType())
+  last_visited_latency_ = DataType::IsFloatingPointType(instr->GetResultType())
       ? kArm64FloatingPointOpLatency
       : kArm64IntegerOpLatency;
 }
@@ -80,12 +80,12 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitDiv(HDiv* instr) {
-  Primitive::Type type = instr->GetResultType();
+  DataType::Type type = instr->GetResultType();
   switch (type) {
-    case Primitive::kPrimFloat:
+    case DataType::Type::kFloat32:
       last_visited_latency_ = kArm64DivFloatLatency;
       break;
-    case Primitive::kPrimDouble:
+    case DataType::Type::kFloat64:
       last_visited_latency_ = kArm64DivDoubleLatency;
       break;
     default:
@@ -133,7 +133,7 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitMul(HMul* instr) {
-  last_visited_latency_ = Primitive::IsFloatingPointType(instr->GetResultType())
+  last_visited_latency_ = DataType::IsFloatingPointType(instr->GetResultType())
       ? kArm64MulFloatingPointLatency
       : kArm64MulIntegerLatency;
 }
@@ -153,7 +153,7 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitRem(HRem* instruction) {
-  if (Primitive::IsFloatingPointType(instruction->GetResultType())) {
+  if (DataType::IsFloatingPointType(instruction->GetResultType())) {
     last_visited_internal_latency_ = kArm64CallInternalLatency;
     last_visited_latency_ = kArm64CallLatency;
   } else {
@@ -194,8 +194,8 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitTypeConversion(HTypeConversion* instr) {
-  if (Primitive::IsFloatingPointType(instr->GetResultType()) ||
-      Primitive::IsFloatingPointType(instr->GetInputType())) {
+  if (DataType::IsFloatingPointType(instr->GetResultType()) ||
+      DataType::IsFloatingPointType(instr->GetInputType())) {
     last_visited_latency_ = kArm64TypeConversionFloatingPointIntegerLatency;
   } else {
     last_visited_latency_ = kArm64IntegerOpLatency;
@@ -203,7 +203,7 @@
 }
 
 void SchedulingLatencyVisitorARM64::HandleSimpleArithmeticSIMD(HVecOperation *instr) {
-  if (Primitive::IsFloatingPointType(instr->GetPackedType())) {
+  if (DataType::IsFloatingPointType(instr->GetPackedType())) {
     last_visited_latency_ = kArm64SIMDFloatingPointOpLatency;
   } else {
     last_visited_latency_ = kArm64SIMDIntegerOpLatency;
@@ -236,7 +236,7 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitVecNot(HVecNot* instr) {
-  if (instr->GetPackedType() == Primitive::kPrimBoolean) {
+  if (instr->GetPackedType() == DataType::Type::kBool) {
     last_visited_internal_latency_ = kArm64SIMDIntegerOpLatency;
   }
   last_visited_latency_ = kArm64SIMDIntegerOpLatency;
@@ -255,7 +255,7 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitVecMul(HVecMul* instr) {
-  if (Primitive::IsFloatingPointType(instr->GetPackedType())) {
+  if (DataType::IsFloatingPointType(instr->GetPackedType())) {
     last_visited_latency_ = kArm64SIMDMulFloatingPointLatency;
   } else {
     last_visited_latency_ = kArm64SIMDMulIntegerLatency;
@@ -263,10 +263,10 @@
 }
 
 void SchedulingLatencyVisitorARM64::VisitVecDiv(HVecDiv* instr) {
-  if (instr->GetPackedType() == Primitive::kPrimFloat) {
+  if (instr->GetPackedType() == DataType::Type::kFloat32) {
     last_visited_latency_ = kArm64SIMDDivFloatLatency;
   } else {
-    DCHECK(instr->GetPackedType() == Primitive::kPrimDouble);
+    DCHECK(instr->GetPackedType() == DataType::Type::kFloat64);
     last_visited_latency_ = kArm64SIMDDivDoubleLatency;
   }
 }
@@ -327,9 +327,9 @@
 
 void SchedulingLatencyVisitorARM64::VisitVecLoad(HVecLoad* instr) {
   last_visited_internal_latency_ = 0;
-  size_t size = Primitive::ComponentSize(instr->GetPackedType());
+  size_t size = DataType::Size(instr->GetPackedType());
 
-  if (instr->GetPackedType() == Primitive::kPrimChar
+  if (instr->GetPackedType() == DataType::Type::kUint16
       && mirror::kUseStringCompression
       && instr->IsStringCharAt()) {
     // Set latencies for the uncompressed case.
@@ -344,7 +344,7 @@
 
 void SchedulingLatencyVisitorARM64::VisitVecStore(HVecStore* instr) {
   last_visited_internal_latency_ = 0;
-  size_t size = Primitive::ComponentSize(instr->GetPackedType());
+  size_t size = DataType::Size(instr->GetPackedType());
   HandleVecAddress(instr, size);
   last_visited_latency_ = kArm64SIMDMemoryStoreLatency;
 }
diff --git a/compiler/optimizing/scheduler_test.cc b/compiler/optimizing/scheduler_test.cc
index cdb6666..0e6e0c5 100644
--- a/compiler/optimizing/scheduler_test.cc
+++ b/compiler/optimizing/scheduler_test.cc
@@ -103,18 +103,20 @@
     HInstruction* array = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                             dex::TypeIndex(0),
                                                             0,
-                                                            Primitive::kPrimNot);
+                                                            DataType::Type::kReference);
     HInstruction* c1 = graph_->GetIntConstant(1);
     HInstruction* c2 = graph_->GetIntConstant(10);
-    HInstruction* add1 = new (&allocator_) HAdd(Primitive::kPrimInt, c1, c2);
-    HInstruction* add2 = new (&allocator_) HAdd(Primitive::kPrimInt, add1, c2);
-    HInstruction* mul = new (&allocator_) HMul(Primitive::kPrimInt, add1, add2);
+    HInstruction* add1 = new (&allocator_) HAdd(DataType::Type::kInt32, c1, c2);
+    HInstruction* add2 = new (&allocator_) HAdd(DataType::Type::kInt32, add1, c2);
+    HInstruction* mul = new (&allocator_) HMul(DataType::Type::kInt32, add1, add2);
     HInstruction* div_check = new (&allocator_) HDivZeroCheck(add2, 0);
-    HInstruction* div = new (&allocator_) HDiv(Primitive::kPrimInt, add1, div_check, 0);
-    HInstruction* array_get1 = new (&allocator_) HArrayGet(array, add1, Primitive::kPrimInt, 0);
-    HInstruction* array_set1 = new (&allocator_) HArraySet(array, add1, add2, Primitive::kPrimInt, 0);
-    HInstruction* array_get2 = new (&allocator_) HArrayGet(array, add1, Primitive::kPrimInt, 0);
-    HInstruction* array_set2 = new (&allocator_) HArraySet(array, add1, add2, Primitive::kPrimInt, 0);
+    HInstruction* div = new (&allocator_) HDiv(DataType::Type::kInt32, add1, div_check, 0);
+    HInstruction* array_get1 = new (&allocator_) HArrayGet(array, add1, DataType::Type::kInt32, 0);
+    HInstruction* array_set1 =
+        new (&allocator_) HArraySet(array, add1, add2, DataType::Type::kInt32, 0);
+    HInstruction* array_get2 = new (&allocator_) HArrayGet(array, add1, DataType::Type::kInt32, 0);
+    HInstruction* array_set2 =
+        new (&allocator_) HArraySet(array, add1, add2, DataType::Type::kInt32, 0);
 
     DCHECK(div_check->CanThrow());
 
@@ -204,37 +206,41 @@
     HInstruction* arr = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                           dex::TypeIndex(0),
                                                           0,
-                                                          Primitive::kPrimNot);
+                                                          DataType::Type::kReference);
     HInstruction* i = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                         dex::TypeIndex(1),
                                                         1,
-                                                        Primitive::kPrimInt);
+                                                        DataType::Type::kInt32);
     HInstruction* j = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                         dex::TypeIndex(1),
                                                         1,
-                                                        Primitive::kPrimInt);
+                                                        DataType::Type::kInt32);
     HInstruction* object = new (&allocator_) HParameterValue(graph_->GetDexFile(),
                                                              dex::TypeIndex(0),
                                                              0,
-                                                             Primitive::kPrimNot);
+                                                             DataType::Type::kReference);
     HInstruction* c0 = graph_->GetIntConstant(0);
     HInstruction* c1 = graph_->GetIntConstant(1);
-    HInstruction* add0 = new (&allocator_) HAdd(Primitive::kPrimInt, i, c0);
-    HInstruction* add1 = new (&allocator_) HAdd(Primitive::kPrimInt, i, c1);
-    HInstruction* sub0 = new (&allocator_) HSub(Primitive::kPrimInt, i, c0);
-    HInstruction* sub1 = new (&allocator_) HSub(Primitive::kPrimInt, i, c1);
-    HInstruction* arr_set_0 = new (&allocator_) HArraySet(arr, c0, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_1 = new (&allocator_) HArraySet(arr, c1, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_i = new (&allocator_) HArraySet(arr, i, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_add0 = new (&allocator_) HArraySet(arr, add0, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_add1 = new (&allocator_) HArraySet(arr, add1, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_sub0 = new (&allocator_) HArraySet(arr, sub0, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_sub1 = new (&allocator_) HArraySet(arr, sub1, c0, Primitive::kPrimInt, 0);
-    HInstruction* arr_set_j = new (&allocator_) HArraySet(arr, j, c0, Primitive::kPrimInt, 0);
+    HInstruction* add0 = new (&allocator_) HAdd(DataType::Type::kInt32, i, c0);
+    HInstruction* add1 = new (&allocator_) HAdd(DataType::Type::kInt32, i, c1);
+    HInstruction* sub0 = new (&allocator_) HSub(DataType::Type::kInt32, i, c0);
+    HInstruction* sub1 = new (&allocator_) HSub(DataType::Type::kInt32, i, c1);
+    HInstruction* arr_set_0 = new (&allocator_) HArraySet(arr, c0, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_1 = new (&allocator_) HArraySet(arr, c1, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_i = new (&allocator_) HArraySet(arr, i, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_add0 =
+        new (&allocator_) HArraySet(arr, add0, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_add1 =
+        new (&allocator_) HArraySet(arr, add1, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_sub0 =
+        new (&allocator_) HArraySet(arr, sub0, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_sub1 =
+        new (&allocator_) HArraySet(arr, sub1, c0, DataType::Type::kInt32, 0);
+    HInstruction* arr_set_j = new (&allocator_) HArraySet(arr, j, c0, DataType::Type::kInt32, 0);
     HInstanceFieldSet* set_field10 = new (&allocator_) HInstanceFieldSet(object,
                                                                          c1,
                                                                          nullptr,
-                                                                         Primitive::kPrimInt,
+                                                                         DataType::Type::kInt32,
                                                                          MemberOffset(10),
                                                                          false,
                                                                          kUnknownFieldIndex,
diff --git a/compiler/optimizing/select_generator.cc b/compiler/optimizing/select_generator.cc
index e220d32..827b591 100644
--- a/compiler/optimizing/select_generator.cc
+++ b/compiler/optimizing/select_generator.cc
@@ -140,11 +140,11 @@
                                                        false_value,
                                                        if_instruction->GetDexPc());
     if (both_successors_return) {
-      if (true_value->GetType() == Primitive::kPrimNot) {
-        DCHECK(false_value->GetType() == Primitive::kPrimNot);
+      if (true_value->GetType() == DataType::Type::kReference) {
+        DCHECK(false_value->GetType() == DataType::Type::kReference);
         ReferenceTypePropagation::FixUpInstructionType(select, handle_scope_);
       }
-    } else if (phi->GetType() == Primitive::kPrimNot) {
+    } else if (phi->GetType() == DataType::Type::kReference) {
       select->SetReferenceTypeInfo(phi->GetReferenceTypeInfo());
     }
     block->InsertInstructionBefore(select, if_instruction);
diff --git a/compiler/optimizing/side_effects_test.cc b/compiler/optimizing/side_effects_test.cc
index b01bc1c..ac5eb15 100644
--- a/compiler/optimizing/side_effects_test.cc
+++ b/compiler/optimizing/side_effects_test.cc
@@ -14,9 +14,10 @@
  * limitations under the License.
  */
 
-#include "gtest/gtest.h"
+#include <gtest/gtest.h>
+
+#include "data_type.h"
 #include "nodes.h"
-#include "primitive.h"
 
 namespace art {
 
@@ -89,18 +90,18 @@
 }
 
 TEST(SideEffectsTest, DependencesAndNoDependences) {
-  // Apply test to each individual primitive type.
-  for (Primitive::Type type = Primitive::kPrimNot;
-      type < Primitive::kPrimVoid;
-      type = Primitive::Type(type + 1)) {
-    // Same primitive type and access type: proper write/read dep.
+  // Apply test to each individual data type.
+  for (DataType::Type type = DataType::Type::kReference;
+       type < DataType::Type::kVoid;
+       type = static_cast<DataType::Type>(static_cast<uint8_t>(type) + 1u)) {
+    // Same data type and access type: proper write/read dep.
     testWriteAndReadDependence(
         SideEffects::FieldWriteOfType(type, false),
         SideEffects::FieldReadOfType(type, false));
     testWriteAndReadDependence(
         SideEffects::ArrayWriteOfType(type),
         SideEffects::ArrayReadOfType(type));
-    // Same primitive type but different access type: no write/read dep.
+    // Same data type but different access type: no write/read dep.
     testNoWriteAndReadDependence(
         SideEffects::FieldWriteOfType(type, false),
         SideEffects::ArrayReadOfType(type));
@@ -111,31 +112,31 @@
 }
 
 TEST(SideEffectsTest, NoDependences) {
-  // Different primitive type, same access type: no write/read dep.
+  // Different data type, same access type: no write/read dep.
   testNoWriteAndReadDependence(
-      SideEffects::FieldWriteOfType(Primitive::kPrimInt, false),
-      SideEffects::FieldReadOfType(Primitive::kPrimDouble, false));
+      SideEffects::FieldWriteOfType(DataType::Type::kInt32, false),
+      SideEffects::FieldReadOfType(DataType::Type::kFloat64, false));
   testNoWriteAndReadDependence(
-      SideEffects::ArrayWriteOfType(Primitive::kPrimInt),
-      SideEffects::ArrayReadOfType(Primitive::kPrimDouble));
+      SideEffects::ArrayWriteOfType(DataType::Type::kInt32),
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat64));
   // Everything different: no write/read dep.
   testNoWriteAndReadDependence(
-      SideEffects::FieldWriteOfType(Primitive::kPrimInt, false),
-      SideEffects::ArrayReadOfType(Primitive::kPrimDouble));
+      SideEffects::FieldWriteOfType(DataType::Type::kInt32, false),
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat64));
   testNoWriteAndReadDependence(
-      SideEffects::ArrayWriteOfType(Primitive::kPrimInt),
-      SideEffects::FieldReadOfType(Primitive::kPrimDouble, false));
+      SideEffects::ArrayWriteOfType(DataType::Type::kInt32),
+      SideEffects::FieldReadOfType(DataType::Type::kFloat64, false));
 }
 
 TEST(SideEffectsTest, VolatileDependences) {
   SideEffects volatile_write =
-      SideEffects::FieldWriteOfType(Primitive::kPrimInt, /* is_volatile */ true);
+      SideEffects::FieldWriteOfType(DataType::Type::kInt32, /* is_volatile */ true);
   SideEffects any_write =
-      SideEffects::FieldWriteOfType(Primitive::kPrimInt, /* is_volatile */ false);
+      SideEffects::FieldWriteOfType(DataType::Type::kInt32, /* is_volatile */ false);
   SideEffects volatile_read =
-      SideEffects::FieldReadOfType(Primitive::kPrimByte, /* is_volatile */ true);
+      SideEffects::FieldReadOfType(DataType::Type::kInt8, /* is_volatile */ true);
   SideEffects any_read =
-      SideEffects::FieldReadOfType(Primitive::kPrimByte, /* is_volatile */ false);
+      SideEffects::FieldReadOfType(DataType::Type::kInt8, /* is_volatile */ false);
 
   EXPECT_FALSE(volatile_write.MayDependOn(any_read));
   EXPECT_TRUE(any_read.MayDependOn(volatile_write));
@@ -151,26 +152,26 @@
 TEST(SideEffectsTest, SameWidthTypesNoAlias) {
   // Type I/F.
   testNoWriteAndReadDependence(
-      SideEffects::FieldWriteOfType(Primitive::kPrimInt, /* is_volatile */ false),
-      SideEffects::FieldReadOfType(Primitive::kPrimFloat, /* is_volatile */ false));
+      SideEffects::FieldWriteOfType(DataType::Type::kInt32, /* is_volatile */ false),
+      SideEffects::FieldReadOfType(DataType::Type::kFloat32, /* is_volatile */ false));
   testNoWriteAndReadDependence(
-      SideEffects::ArrayWriteOfType(Primitive::kPrimInt),
-      SideEffects::ArrayReadOfType(Primitive::kPrimFloat));
+      SideEffects::ArrayWriteOfType(DataType::Type::kInt32),
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat32));
   // Type L/D.
   testNoWriteAndReadDependence(
-      SideEffects::FieldWriteOfType(Primitive::kPrimLong, /* is_volatile */ false),
-      SideEffects::FieldReadOfType(Primitive::kPrimDouble, /* is_volatile */ false));
+      SideEffects::FieldWriteOfType(DataType::Type::kInt64, /* is_volatile */ false),
+      SideEffects::FieldReadOfType(DataType::Type::kFloat64, /* is_volatile */ false));
   testNoWriteAndReadDependence(
-      SideEffects::ArrayWriteOfType(Primitive::kPrimLong),
-      SideEffects::ArrayReadOfType(Primitive::kPrimDouble));
+      SideEffects::ArrayWriteOfType(DataType::Type::kInt64),
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat64));
 }
 
 TEST(SideEffectsTest, AllWritesAndReads) {
   SideEffects s = SideEffects::None();
   // Keep taking the union of different writes and reads.
-  for (Primitive::Type type = Primitive::kPrimNot;
-        type < Primitive::kPrimVoid;
-        type = Primitive::Type(type + 1)) {
+  for (DataType::Type type = DataType::Type::kReference;
+       type < DataType::Type::kVoid;
+       type = static_cast<DataType::Type>(static_cast<uint8_t>(type) + 1u)) {
     s = s.Union(SideEffects::FieldWriteOfType(type, /* is_volatile */ false));
     s = s.Union(SideEffects::ArrayWriteOfType(type));
     s = s.Union(SideEffects::FieldReadOfType(type, /* is_volatile */ false));
@@ -214,41 +215,41 @@
       SideEffects::AllReads().ToString().c_str());
   EXPECT_STREQ(
       "||||||L|",
-      SideEffects::FieldWriteOfType(Primitive::kPrimNot, false).ToString().c_str());
+      SideEffects::FieldWriteOfType(DataType::Type::kReference, false).ToString().c_str());
   EXPECT_STREQ(
       "||DFJISCBZL|DFJISCBZL||DFJISCBZL|DFJISCBZL|",
-      SideEffects::FieldWriteOfType(Primitive::kPrimNot, true).ToString().c_str());
+      SideEffects::FieldWriteOfType(DataType::Type::kReference, true).ToString().c_str());
   EXPECT_STREQ(
       "|||||Z||",
-      SideEffects::ArrayWriteOfType(Primitive::kPrimBoolean).ToString().c_str());
+      SideEffects::ArrayWriteOfType(DataType::Type::kBool).ToString().c_str());
   EXPECT_STREQ(
       "|||||C||",
-      SideEffects::ArrayWriteOfType(Primitive::kPrimChar).ToString().c_str());
+      SideEffects::ArrayWriteOfType(DataType::Type::kUint16).ToString().c_str());
   EXPECT_STREQ(
       "|||||S||",
-      SideEffects::ArrayWriteOfType(Primitive::kPrimShort).ToString().c_str());
+      SideEffects::ArrayWriteOfType(DataType::Type::kInt16).ToString().c_str());
   EXPECT_STREQ(
       "|||B||||",
-      SideEffects::FieldReadOfType(Primitive::kPrimByte, false).ToString().c_str());
+      SideEffects::FieldReadOfType(DataType::Type::kInt8, false).ToString().c_str());
   EXPECT_STREQ(
       "||D|||||",
-      SideEffects::ArrayReadOfType(Primitive::kPrimDouble).ToString().c_str());
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat64).ToString().c_str());
   EXPECT_STREQ(
       "||J|||||",
-      SideEffects::ArrayReadOfType(Primitive::kPrimLong).ToString().c_str());
+      SideEffects::ArrayReadOfType(DataType::Type::kInt64).ToString().c_str());
   EXPECT_STREQ(
       "||F|||||",
-      SideEffects::ArrayReadOfType(Primitive::kPrimFloat).ToString().c_str());
+      SideEffects::ArrayReadOfType(DataType::Type::kFloat32).ToString().c_str());
   EXPECT_STREQ(
       "||I|||||",
-      SideEffects::ArrayReadOfType(Primitive::kPrimInt).ToString().c_str());
+      SideEffects::ArrayReadOfType(DataType::Type::kInt32).ToString().c_str());
   SideEffects s = SideEffects::None();
-  s = s.Union(SideEffects::FieldWriteOfType(Primitive::kPrimChar, /* is_volatile */ false));
-  s = s.Union(SideEffects::FieldWriteOfType(Primitive::kPrimLong, /* is_volatile */ false));
-  s = s.Union(SideEffects::ArrayWriteOfType(Primitive::kPrimShort));
-  s = s.Union(SideEffects::FieldReadOfType(Primitive::kPrimInt, /* is_volatile */ false));
-  s = s.Union(SideEffects::ArrayReadOfType(Primitive::kPrimFloat));
-  s = s.Union(SideEffects::ArrayReadOfType(Primitive::kPrimDouble));
+  s = s.Union(SideEffects::FieldWriteOfType(DataType::Type::kUint16, /* is_volatile */ false));
+  s = s.Union(SideEffects::FieldWriteOfType(DataType::Type::kInt64, /* is_volatile */ false));
+  s = s.Union(SideEffects::ArrayWriteOfType(DataType::Type::kInt16));
+  s = s.Union(SideEffects::FieldReadOfType(DataType::Type::kInt32, /* is_volatile */ false));
+  s = s.Union(SideEffects::ArrayReadOfType(DataType::Type::kFloat32));
+  s = s.Union(SideEffects::ArrayReadOfType(DataType::Type::kFloat64));
   EXPECT_STREQ("||DF|I||S|JC|", s.ToString().c_str());
 }
 
diff --git a/compiler/optimizing/ssa_builder.cc b/compiler/optimizing/ssa_builder.cc
index 50ab11b..77b7a22 100644
--- a/compiler/optimizing/ssa_builder.cc
+++ b/compiler/optimizing/ssa_builder.cc
@@ -17,6 +17,7 @@
 #include "ssa_builder.h"
 
 #include "bytecode_utils.h"
+#include "data_type-inl.h"
 #include "mirror/class-inl.h"
 #include "nodes.h"
 #include "reference_type_propagation.h"
@@ -37,10 +38,11 @@
       HInstruction* right = equality_instr->InputAt(1);
       HInstruction* int_operand = nullptr;
 
-      if ((left->GetType() == Primitive::kPrimNot) && (right->GetType() == Primitive::kPrimInt)) {
+      if ((left->GetType() == DataType::Type::kReference) &&
+          (right->GetType() == DataType::Type::kInt32)) {
         int_operand = right;
-      } else if ((right->GetType() == Primitive::kPrimNot)
-                 && (left->GetType() == Primitive::kPrimInt)) {
+      } else if ((right->GetType() == DataType::Type::kReference) &&
+                 (left->GetType() == DataType::Type::kInt32)) {
         int_operand = left;
       } else {
         continue;
@@ -122,7 +124,7 @@
 // Find a candidate primitive type for `phi` by merging the type of its inputs.
 // Return false if conflict is identified.
 static bool TypePhiFromInputs(HPhi* phi) {
-  Primitive::Type common_type = phi->GetType();
+  DataType::Type common_type = phi->GetType();
 
   for (HInstruction* input : phi->GetInputs()) {
     if (input->IsPhi() && input->AsPhi()->IsDead()) {
@@ -131,26 +133,29 @@
       return false;
     }
 
-    Primitive::Type input_type = HPhi::ToPhiType(input->GetType());
+    DataType::Type input_type = HPhi::ToPhiType(input->GetType());
     if (common_type == input_type) {
       // No change in type.
-    } else if (Primitive::Is64BitType(common_type) != Primitive::Is64BitType(input_type)) {
+    } else if (DataType::Is64BitType(common_type) != DataType::Is64BitType(input_type)) {
       // Types are of different sizes, e.g. int vs. long. Must be a conflict.
       return false;
-    } else if (Primitive::IsIntegralType(common_type)) {
+    } else if (DataType::IsIntegralType(common_type)) {
       // Previous inputs were integral, this one is not but is of the same size.
       // This does not imply conflict since some bytecode instruction types are
       // ambiguous. TypeInputsOfPhi will either type them or detect a conflict.
-      DCHECK(Primitive::IsFloatingPointType(input_type) || input_type == Primitive::kPrimNot);
+      DCHECK(DataType::IsFloatingPointType(input_type) ||
+             input_type == DataType::Type::kReference);
       common_type = input_type;
-    } else if (Primitive::IsIntegralType(input_type)) {
+    } else if (DataType::IsIntegralType(input_type)) {
       // Input is integral, common type is not. Same as in the previous case, if
       // there is a conflict, it will be detected during TypeInputsOfPhi.
-      DCHECK(Primitive::IsFloatingPointType(common_type) || common_type == Primitive::kPrimNot);
+      DCHECK(DataType::IsFloatingPointType(common_type) ||
+             common_type == DataType::Type::kReference);
     } else {
       // Combining float and reference types. Clearly a conflict.
-      DCHECK((common_type == Primitive::kPrimFloat && input_type == Primitive::kPrimNot) ||
-             (common_type == Primitive::kPrimNot && input_type == Primitive::kPrimFloat));
+      DCHECK(
+          (common_type == DataType::Type::kFloat32 && input_type == DataType::Type::kReference) ||
+          (common_type == DataType::Type::kReference && input_type == DataType::Type::kFloat32));
       return false;
     }
   }
@@ -163,8 +168,8 @@
 
 // Replace inputs of `phi` to match its type. Return false if conflict is identified.
 bool SsaBuilder::TypeInputsOfPhi(HPhi* phi, ArenaVector<HPhi*>* worklist) {
-  Primitive::Type common_type = phi->GetType();
-  if (Primitive::IsIntegralType(common_type)) {
+  DataType::Type common_type = phi->GetType();
+  if (DataType::IsIntegralType(common_type)) {
     // We do not need to retype ambiguous inputs because they are always constructed
     // with the integral type candidate.
     if (kIsDebugBuild) {
@@ -175,14 +180,15 @@
     // Inputs did not need to be replaced, hence no conflict. Report success.
     return true;
   } else {
-    DCHECK(common_type == Primitive::kPrimNot || Primitive::IsFloatingPointType(common_type));
+    DCHECK(common_type == DataType::Type::kReference ||
+           DataType::IsFloatingPointType(common_type));
     HInputsRef inputs = phi->GetInputs();
     for (size_t i = 0; i < inputs.size(); ++i) {
       HInstruction* input = inputs[i];
       if (input->GetType() != common_type) {
         // Input type does not match phi's type. Try to retype the input or
         // generate a suitably typed equivalent.
-        HInstruction* equivalent = (common_type == Primitive::kPrimNot)
+        HInstruction* equivalent = (common_type == DataType::Type::kReference)
             ? GetReferenceTypeEquivalent(input)
             : GetFloatOrDoubleEquivalent(input, common_type);
         if (equivalent == nullptr) {
@@ -209,7 +215,7 @@
 // it was changed by the algorithm or not.
 bool SsaBuilder::UpdatePrimitiveType(HPhi* phi, ArenaVector<HPhi*>* worklist) {
   DCHECK(phi->IsLive());
-  Primitive::Type original_type = phi->GetType();
+  DataType::Type original_type = phi->GetType();
 
   // Try to type the phi in two stages:
   // (1) find a candidate type for the phi by merging types of all its inputs,
@@ -270,8 +276,8 @@
 }
 
 static HArrayGet* FindFloatOrDoubleEquivalentOfArrayGet(HArrayGet* aget) {
-  Primitive::Type type = aget->GetType();
-  DCHECK(Primitive::IsIntOrLongType(type));
+  DataType::Type type = aget->GetType();
+  DCHECK(DataType::IsIntOrLongType(type));
   HInstruction* next = aget->GetNext();
   if (next != nullptr && next->IsArrayGet()) {
     HArrayGet* next_aget = next->AsArrayGet();
@@ -283,24 +289,25 @@
 }
 
 static HArrayGet* CreateFloatOrDoubleEquivalentOfArrayGet(HArrayGet* aget) {
-  Primitive::Type type = aget->GetType();
-  DCHECK(Primitive::IsIntOrLongType(type));
+  DataType::Type type = aget->GetType();
+  DCHECK(DataType::IsIntOrLongType(type));
   DCHECK(FindFloatOrDoubleEquivalentOfArrayGet(aget) == nullptr);
 
   HArrayGet* equivalent = new (aget->GetBlock()->GetGraph()->GetArena()) HArrayGet(
       aget->GetArray(),
       aget->GetIndex(),
-      type == Primitive::kPrimInt ? Primitive::kPrimFloat : Primitive::kPrimDouble,
+      type == DataType::Type::kInt32 ? DataType::Type::kFloat32 : DataType::Type::kFloat64,
       aget->GetDexPc());
   aget->GetBlock()->InsertInstructionAfter(equivalent, aget);
   return equivalent;
 }
 
-static Primitive::Type GetPrimitiveArrayComponentType(HInstruction* array)
+static DataType::Type GetPrimitiveArrayComponentType(HInstruction* array)
     REQUIRES_SHARED(Locks::mutator_lock_) {
   ReferenceTypeInfo array_type = array->GetReferenceTypeInfo();
   DCHECK(array_type.IsPrimitiveArrayClass());
-  return array_type.GetTypeHandle()->GetComponentType()->GetPrimitiveType();
+  return DataTypeFromPrimitive(
+      array_type.GetTypeHandle()->GetComponentType()->GetPrimitiveType());
 }
 
 bool SsaBuilder::FixAmbiguousArrayOps() {
@@ -325,10 +332,10 @@
       }
 
       HArrayGet* aget_float = FindFloatOrDoubleEquivalentOfArrayGet(aget_int);
-      Primitive::Type array_type = GetPrimitiveArrayComponentType(array);
-      DCHECK_EQ(Primitive::Is64BitType(aget_int->GetType()), Primitive::Is64BitType(array_type));
+      DataType::Type array_type = GetPrimitiveArrayComponentType(array);
+      DCHECK_EQ(DataType::Is64BitType(aget_int->GetType()), DataType::Is64BitType(array_type));
 
-      if (Primitive::IsIntOrLongType(array_type)) {
+      if (DataType::IsIntOrLongType(array_type)) {
         if (aget_float != nullptr) {
           // There is a float/double equivalent. We must replace it and re-run
           // primitive type propagation on all dependent instructions.
@@ -337,7 +344,7 @@
           AddDependentInstructionsToWorklist(aget_int, &worklist);
         }
       } else {
-        DCHECK(Primitive::IsFloatingPointType(array_type));
+        DCHECK(DataType::IsFloatingPointType(array_type));
         if (aget_float == nullptr) {
           // This is a float/double ArrayGet but there were no typed uses which
           // would create the typed equivalent. Create it now.
@@ -365,13 +372,13 @@
       }
 
       HInstruction* value = aset->GetValue();
-      Primitive::Type value_type = value->GetType();
-      Primitive::Type array_type = GetPrimitiveArrayComponentType(array);
-      DCHECK_EQ(Primitive::Is64BitType(value_type), Primitive::Is64BitType(array_type));
+      DataType::Type value_type = value->GetType();
+      DataType::Type array_type = GetPrimitiveArrayComponentType(array);
+      DCHECK_EQ(DataType::Is64BitType(value_type), DataType::Is64BitType(array_type));
 
-      if (Primitive::IsFloatingPointType(array_type)) {
-        if (!Primitive::IsFloatingPointType(value_type)) {
-          DCHECK(Primitive::IsIntegralType(value_type));
+      if (DataType::IsFloatingPointType(array_type)) {
+        if (!DataType::IsFloatingPointType(value_type)) {
+          DCHECK(DataType::IsIntegralType(value_type));
           // Array elements are floating-point but the value has not been replaced
           // with its floating-point equivalent. The replacement must always
           // succeed in code validated by the verifier.
@@ -390,8 +397,8 @@
       } else {
         // Array elements are integral and the value assigned to it initially
         // was integral too. Nothing to do.
-        DCHECK(Primitive::IsIntegralType(array_type));
-        DCHECK(Primitive::IsIntegralType(value_type));
+        DCHECK(DataType::IsIntegralType(array_type));
+        DCHECK(DataType::IsIntegralType(value_type));
       }
     }
   }
@@ -599,7 +606,7 @@
  * floating point registers and core registers), we need to create a copy of the
  * phi with a floating point / reference type.
  */
-HPhi* SsaBuilder::GetFloatDoubleOrReferenceEquivalentOfPhi(HPhi* phi, Primitive::Type type) {
+HPhi* SsaBuilder::GetFloatDoubleOrReferenceEquivalentOfPhi(HPhi* phi, DataType::Type type) {
   DCHECK(phi->IsLive()) << "Cannot get equivalent of a dead phi since it would create a live one.";
 
   // We place the floating point /reference phi next to this phi.
@@ -637,9 +644,9 @@
 }
 
 HArrayGet* SsaBuilder::GetFloatOrDoubleEquivalentOfArrayGet(HArrayGet* aget) {
-  DCHECK(Primitive::IsIntegralType(aget->GetType()));
+  DCHECK(DataType::IsIntegralType(aget->GetType()));
 
-  if (!Primitive::IsIntOrLongType(aget->GetType())) {
+  if (!DataType::IsIntOrLongType(aget->GetType())) {
     // Cannot type boolean, char, byte, short to float/double.
     return nullptr;
   }
@@ -650,7 +657,7 @@
     // int/long. Requesting a float/double equivalent should lead to a conflict.
     if (kIsDebugBuild) {
       ScopedObjectAccess soa(Thread::Current());
-      DCHECK(Primitive::IsIntOrLongType(GetPrimitiveArrayComponentType(aget->GetArray())));
+      DCHECK(DataType::IsIntOrLongType(GetPrimitiveArrayComponentType(aget->GetArray())));
     }
     return nullptr;
   } else {
@@ -661,7 +668,7 @@
   }
 }
 
-HInstruction* SsaBuilder::GetFloatOrDoubleEquivalent(HInstruction* value, Primitive::Type type) {
+HInstruction* SsaBuilder::GetFloatOrDoubleEquivalent(HInstruction* value, DataType::Type type) {
   if (value->IsArrayGet()) {
     return GetFloatOrDoubleEquivalentOfArrayGet(value->AsArrayGet());
   } else if (value->IsLongConstant()) {
@@ -679,7 +686,7 @@
   if (value->IsIntConstant() && value->AsIntConstant()->GetValue() == 0) {
     return graph_->GetNullConstant();
   } else if (value->IsPhi()) {
-    return GetFloatDoubleOrReferenceEquivalentOfPhi(value->AsPhi(), Primitive::kPrimNot);
+    return GetFloatDoubleOrReferenceEquivalentOfPhi(value->AsPhi(), DataType::Type::kReference);
   } else {
     return nullptr;
   }
diff --git a/compiler/optimizing/ssa_builder.h b/compiler/optimizing/ssa_builder.h
index 978f113..1819ee5 100644
--- a/compiler/optimizing/ssa_builder.h
+++ b/compiler/optimizing/ssa_builder.h
@@ -64,20 +64,20 @@
 
   GraphAnalysisResult BuildSsa();
 
-  HInstruction* GetFloatOrDoubleEquivalent(HInstruction* instruction, Primitive::Type type);
+  HInstruction* GetFloatOrDoubleEquivalent(HInstruction* instruction, DataType::Type type);
   HInstruction* GetReferenceTypeEquivalent(HInstruction* instruction);
 
   void MaybeAddAmbiguousArrayGet(HArrayGet* aget) {
-    Primitive::Type type = aget->GetType();
-    DCHECK(!Primitive::IsFloatingPointType(type));
-    if (Primitive::IsIntOrLongType(type)) {
+    DataType::Type type = aget->GetType();
+    DCHECK(!DataType::IsFloatingPointType(type));
+    if (DataType::IsIntOrLongType(type)) {
       ambiguous_agets_.push_back(aget);
     }
   }
 
   void MaybeAddAmbiguousArraySet(HArraySet* aset) {
-    Primitive::Type type = aset->GetValue()->GetType();
-    if (Primitive::IsIntOrLongType(type)) {
+    DataType::Type type = aset->GetValue()->GetType();
+    if (DataType::IsIntOrLongType(type)) {
       ambiguous_asets_.push_back(aset);
     }
   }
@@ -111,7 +111,7 @@
 
   HFloatConstant* GetFloatEquivalent(HIntConstant* constant);
   HDoubleConstant* GetDoubleEquivalent(HLongConstant* constant);
-  HPhi* GetFloatDoubleOrReferenceEquivalentOfPhi(HPhi* phi, Primitive::Type type);
+  HPhi* GetFloatDoubleOrReferenceEquivalentOfPhi(HPhi* phi, DataType::Type type);
   HArrayGet* GetFloatOrDoubleEquivalentOfArrayGet(HArrayGet* aget);
 
   void RemoveRedundantUninitializedStrings();
diff --git a/compiler/optimizing/ssa_liveness_analysis.cc b/compiler/optimizing/ssa_liveness_analysis.cc
index 754a762..f1f1be2 100644
--- a/compiler/optimizing/ssa_liveness_analysis.cc
+++ b/compiler/optimizing/ssa_liveness_analysis.cc
@@ -480,7 +480,7 @@
     return definition->AsVecOperation()->GetVectorNumberOfBytes() / kVRegSize;
   }
   // Return number of needed spill slots based on type.
-  return (type_ == Primitive::kPrimLong || type_ == Primitive::kPrimDouble) ? 2 : 1;
+  return (type_ == DataType::Type::kInt64 || type_ == DataType::Type::kFloat64) ? 2 : 1;
 }
 
 Location LiveInterval::ToLocation() const {
diff --git a/compiler/optimizing/ssa_liveness_analysis.h b/compiler/optimizing/ssa_liveness_analysis.h
index a668157..ec4ab31 100644
--- a/compiler/optimizing/ssa_liveness_analysis.h
+++ b/compiler/optimizing/ssa_liveness_analysis.h
@@ -262,16 +262,16 @@
 class LiveInterval : public ArenaObject<kArenaAllocSsaLiveness> {
  public:
   static LiveInterval* MakeInterval(ArenaAllocator* allocator,
-                                    Primitive::Type type,
+                                    DataType::Type type,
                                     HInstruction* instruction = nullptr) {
     return new (allocator) LiveInterval(allocator, type, instruction);
   }
 
-  static LiveInterval* MakeFixedInterval(ArenaAllocator* allocator, int reg, Primitive::Type type) {
+  static LiveInterval* MakeFixedInterval(ArenaAllocator* allocator, int reg, DataType::Type type) {
     return new (allocator) LiveInterval(allocator, type, nullptr, true, reg, false);
   }
 
-  static LiveInterval* MakeTempInterval(ArenaAllocator* allocator, Primitive::Type type) {
+  static LiveInterval* MakeTempInterval(ArenaAllocator* allocator, DataType::Type type) {
     return new (allocator) LiveInterval(allocator, type, nullptr, false, kNoRegister, true);
   }
 
@@ -608,7 +608,7 @@
     return parent_->env_uses_;
   }
 
-  Primitive::Type GetType() const {
+  DataType::Type GetType() const {
     return type_;
   }
 
@@ -783,7 +783,7 @@
   size_t NumberOfSpillSlotsNeeded() const;
 
   bool IsFloatingPoint() const {
-    return type_ == Primitive::kPrimFloat || type_ == Primitive::kPrimDouble;
+    return type_ == DataType::Type::kFloat32 || type_ == DataType::Type::kFloat64;
   }
 
   // Converts the location of the interval to a `Location` object.
@@ -970,7 +970,7 @@
 
  private:
   LiveInterval(ArenaAllocator* allocator,
-               Primitive::Type type,
+               DataType::Type type,
                HInstruction* defined_by = nullptr,
                bool is_fixed = false,
                int reg = kNoRegister,
@@ -1102,7 +1102,7 @@
   EnvUsePositionList env_uses_;
 
   // The instruction type this interval corresponds to.
-  const Primitive::Type type_;
+  const DataType::Type type_;
 
   // Live interval that is the result of a split.
   LiveInterval* next_sibling_;
@@ -1262,7 +1262,7 @@
     // the exception handler to its location at the top of the catch block.
     if (env_holder->CanThrowIntoCatchBlock()) return true;
     if (instruction->GetBlock()->GetGraph()->IsDebuggable()) return true;
-    return instruction->GetType() == Primitive::kPrimNot;
+    return instruction->GetType() == DataType::Type::kReference;
   }
 
   void CheckNoLiveInIrreducibleLoop(const HBasicBlock& block) const {
diff --git a/compiler/optimizing/ssa_liveness_analysis_test.cc b/compiler/optimizing/ssa_liveness_analysis_test.cc
index b46060a..e89bf6d 100644
--- a/compiler/optimizing/ssa_liveness_analysis_test.cc
+++ b/compiler/optimizing/ssa_liveness_analysis_test.cc
@@ -70,7 +70,7 @@
 
 TEST_F(SsaLivenessAnalysisTest, TestReturnArg) {
   HInstruction* arg = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kInt32);
   entry_->AddInstruction(arg);
 
   HBasicBlock* block = CreateSuccessor(entry_);
@@ -90,15 +90,15 @@
 
 TEST_F(SsaLivenessAnalysisTest, TestAput) {
   HInstruction* array = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* index = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(1), 1, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(1), 1, DataType::Type::kInt32);
   HInstruction* value = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(2), 2, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(2), 2, DataType::Type::kInt32);
   HInstruction* extra_arg1 = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(3), 3, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(3), 3, DataType::Type::kInt32);
   HInstruction* extra_arg2 = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(4), 4, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(4), 4, DataType::Type::kReference);
   ArenaVector<HInstruction*> args({ array, index, value, extra_arg1, extra_arg2 },
                                   allocator_.Adapter());
   for (HInstruction* insn : args) {
@@ -127,7 +127,7 @@
   bounds_check_env->CopyFrom(args);
   bounds_check->SetRawEnvironment(bounds_check_env);
   HInstruction* array_set =
-      new (&allocator_) HArraySet(array, index, value, Primitive::kPrimInt, /* dex_pc */ 0);
+      new (&allocator_) HArraySet(array, index, value, DataType::Type::kInt32, /* dex_pc */ 0);
   block->AddInstruction(array_set);
 
   graph_->BuildDominatorTree();
@@ -160,15 +160,15 @@
 
 TEST_F(SsaLivenessAnalysisTest, TestDeoptimize) {
   HInstruction* array = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(0), 0, DataType::Type::kReference);
   HInstruction* index = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(1), 1, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(1), 1, DataType::Type::kInt32);
   HInstruction* value = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(2), 2, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(2), 2, DataType::Type::kInt32);
   HInstruction* extra_arg1 = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(3), 3, Primitive::kPrimInt);
+      graph_->GetDexFile(), dex::TypeIndex(3), 3, DataType::Type::kInt32);
   HInstruction* extra_arg2 = new (&allocator_) HParameterValue(
-      graph_->GetDexFile(), dex::TypeIndex(4), 4, Primitive::kPrimNot);
+      graph_->GetDexFile(), dex::TypeIndex(4), 4, DataType::Type::kReference);
   ArenaVector<HInstruction*> args({ array, index, value, extra_arg1, extra_arg2 },
                                   allocator_.Adapter());
   for (HInstruction* insn : args) {
@@ -201,7 +201,7 @@
   deoptimize_env->CopyFrom(args);
   deoptimize->SetRawEnvironment(deoptimize_env);
   HInstruction* array_set =
-      new (&allocator_) HArraySet(array, index, value, Primitive::kPrimInt, /* dex_pc */ 0);
+      new (&allocator_) HArraySet(array, index, value, DataType::Type::kInt32, /* dex_pc */ 0);
   block->AddInstruction(array_set);
 
   graph_->BuildDominatorTree();
diff --git a/compiler/optimizing/ssa_test.cc b/compiler/optimizing/ssa_test.cc
index f69f417..ac998db 100644
--- a/compiler/optimizing/ssa_test.cc
+++ b/compiler/optimizing/ssa_test.cc
@@ -89,7 +89,7 @@
   // Test that phis had their type set.
   for (HBasicBlock* block : graph->GetBlocks()) {
     for (HInstructionIterator it(block->GetPhis()); !it.Done(); it.Advance()) {
-      ASSERT_NE(it.Current()->GetType(), Primitive::kPrimVoid);
+      ASSERT_NE(it.Current()->GetType(), DataType::Type::kVoid);
     }
   }
 
diff --git a/compiler/optimizing/x86_memory_gen.cc b/compiler/optimizing/x86_memory_gen.cc
index 4e25683..0271850 100644
--- a/compiler/optimizing/x86_memory_gen.cc
+++ b/compiler/optimizing/x86_memory_gen.cc
@@ -41,7 +41,7 @@
     }
 
     HInstruction* array = array_len->InputAt(0);
-    DCHECK_EQ(array->GetType(), Primitive::kPrimNot);
+    DCHECK_EQ(array->GetType(), DataType::Type::kReference);
 
     // Don't apply this optimization when the array is nullptr.
     if (array->IsConstant() || (array->IsNullCheck() && array->InputAt(0)->IsConstant())) {
diff --git a/compiler/utils/assembler_thumb_test.cc b/compiler/utils/assembler_thumb_test.cc
index e51b622..4dbe71b 100644
--- a/compiler/utils/assembler_thumb_test.cc
+++ b/compiler/utils/assembler_thumb_test.cc
@@ -126,15 +126,8 @@
   int cmd_result = system(cmd);
   ASSERT_EQ(cmd_result, 0) << strerror(errno);
 
-  // Remove the $d symbols to prevent the disassembler dumping the instructions
-  // as .word
-  snprintf(cmd, sizeof(cmd), "%sobjcopy -N '$d' %s.o %s.oo", toolsdir.c_str(), filename, filename);
-  int cmd_result2 = system(cmd);
-  ASSERT_EQ(cmd_result2, 0) << strerror(errno);
-
   // Disassemble.
-
-  snprintf(cmd, sizeof(cmd), "%sobjdump -d %s.oo | grep '^  *[0-9a-f][0-9a-f]*:'",
+  snprintf(cmd, sizeof(cmd), "%sobjdump -D -M force-thumb --section=.text %s.o  | grep '^  *[0-9a-f][0-9a-f]*:'",
     toolsdir.c_str(), filename);
   if (kPrintResults) {
     // Print the results only, don't check. This is used to generate new output for inserting
@@ -169,9 +162,6 @@
   char buf[FILENAME_MAX];
   snprintf(buf, sizeof(buf), "%s.o", filename);
   unlink(buf);
-
-  snprintf(buf, sizeof(buf), "%s.oo", filename);
-  unlink(buf);
 #endif  // ART_TARGET_ANDROID
 }
 
diff --git a/dalvikvm/Android.bp b/dalvikvm/Android.bp
index 09bbbda..0405fe1 100644
--- a/dalvikvm/Android.bp
+++ b/dalvikvm/Android.bp
@@ -30,15 +30,8 @@
     ],
     whole_static_libs: ["libsigchain"],
     target: {
-        host: {
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
-        },
         android: {
             shared_libs: [
-                "libdl",
                 "liblog",
             ],
             ldflags: ["-Wl,--export-dynamic"],
diff --git a/dex2oat/Android.bp b/dex2oat/Android.bp
index bdb8ff1..c9125df 100644
--- a/dex2oat/Android.bp
+++ b/dex2oat/Android.bp
@@ -18,7 +18,6 @@
     name: "libart-dex2oat-defaults",
     defaults: ["art_defaults"],
     host_supported: true,
-    clang: true,
     srcs: [
         "linker/elf_writer.cc",
         "linker/elf_writer_quick.cc",
@@ -27,10 +26,6 @@
         "linker/oat_writer.cc",
     ],
     target: {
-        host: {
-            // For compiler driver TLS.
-            host_ldlibs: ["-lpthread"],
-        },
         android: {
             // For atrace.
             shared_libs: ["libcutils"],
@@ -70,7 +65,7 @@
     defaults: ["libart-dex2oat-defaults"],
     shared_libs: [
         "libart-compiler",
-        "libart"
+        "libart",
     ],
 }
 
@@ -82,7 +77,7 @@
     ],
     shared_libs: [
         "libartd-compiler",
-        "libartd"
+        "libartd",
     ],
 }
 
@@ -126,7 +121,7 @@
     ],
     static_libs: [
         "libart-dex2oat",
-    ]
+    ],
 }
 
 art_cc_binary {
@@ -145,7 +140,7 @@
     ],
     static_libs: [
         "libartd-dex2oat",
-    ]
+    ],
 }
 
 art_cc_binary {
@@ -231,5 +226,5 @@
     ],
     static_libs: [
         "libartd-dex2oat",
-    ]
+    ],
 }
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 28e1d94..7b46531 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -1357,7 +1357,7 @@
       DCHECK(!oat_filenames_.empty());
       for (const char* oat_filename : oat_filenames_) {
         std::unique_ptr<File> oat_file(OS::CreateEmptyFile(oat_filename));
-        if (oat_file.get() == nullptr) {
+        if (oat_file == nullptr) {
           PLOG(ERROR) << "Failed to create oat file: " << oat_filename;
           return false;
         }
@@ -1387,7 +1387,7 @@
           vdex_files_.push_back(std::move(vdex_file));
         } else {
           std::unique_ptr<File> vdex_file(OS::CreateEmptyFile(vdex_filename.c_str()));
-          if (vdex_file.get() == nullptr) {
+          if (vdex_file == nullptr) {
             PLOG(ERROR) << "Failed to open vdex file: " << vdex_filename;
             return false;
           }
@@ -1401,13 +1401,15 @@
       }
     } else {
       std::unique_ptr<File> oat_file(new File(oat_fd_, oat_location_, /* check_usage */ true));
-      if (oat_file.get() == nullptr) {
+      if (oat_file == nullptr) {
         PLOG(ERROR) << "Failed to create oat file: " << oat_location_;
         return false;
       }
       oat_file->DisableAutoClose();
       if (oat_file->SetLength(0) != 0) {
         PLOG(WARNING) << "Truncating oat file " << oat_location_ << " failed.";
+        oat_file->Erase();
+        return false;
       }
       oat_files_.push_back(std::move(oat_file));
 
@@ -1436,7 +1438,7 @@
       DCHECK_NE(output_vdex_fd_, -1);
       std::string vdex_location = ReplaceFileExtension(oat_location_, "vdex");
       std::unique_ptr<File> vdex_file(new File(output_vdex_fd_, vdex_location, /* check_usage */ true));
-      if (vdex_file.get() == nullptr) {
+      if (vdex_file == nullptr) {
         PLOG(ERROR) << "Failed to create vdex file: " << vdex_location;
         return false;
       }
@@ -1446,6 +1448,7 @@
       } else {
         if (vdex_file->SetLength(0) != 0) {
           PLOG(ERROR) << "Truncating vdex file " << vdex_location << " failed.";
+          vdex_file->Erase();
           return false;
         }
       }
@@ -2309,6 +2312,10 @@
     return DoProfileGuidedOptimizations();
   }
 
+  bool DoOatLayoutOptimizations() const {
+    return DoProfileGuidedOptimizations();
+  }
+
   bool DoEagerUnquickeningOfVdex() const {
     // DexLayout can invalidate the vdex metadata, so we need to unquicken
     // the vdex file eagerly, before passing it to dexlayout.
@@ -2521,9 +2528,11 @@
                                                              compiler_options_.get(),
                                                              oat_file.get()));
       elf_writers_.back()->Start();
-      const bool do_dexlayout = DoDexLayoutOptimizations();
+      const bool do_oat_writer_layout = DoDexLayoutOptimizations() || DoOatLayoutOptimizations();
       oat_writers_.emplace_back(new linker::OatWriter(
-          IsBootImage(), timings_, do_dexlayout ? profile_compilation_info_.get() : nullptr));
+          IsBootImage(),
+          timings_,
+          do_oat_writer_layout ? profile_compilation_info_.get() : nullptr));
     }
   }
 
diff --git a/dex2oat/linker/oat_writer.cc b/dex2oat/linker/oat_writer.cc
index 305d4f6..a80dbf6 100644
--- a/dex2oat/linker/oat_writer.cc
+++ b/dex2oat/linker/oat_writer.cc
@@ -16,6 +16,7 @@
 
 #include "oat_writer.h"
 
+#include <algorithm>
 #include <unistd.h>
 #include <zlib.h>
 
@@ -69,6 +70,18 @@
 // If we write dex layout info in the oat file.
 static constexpr bool kWriteDexLayoutInfo = true;
 
+// Force the OAT method layout to be sorted-by-name instead of
+// the default (class_def_idx, method_idx).
+//
+// Otherwise if profiles are used, that will act as
+// the primary sort order.
+//
+// A bit easier to use for development since oatdump can easily
+// show that things are being re-ordered when two methods aren't adjacent.
+static constexpr bool kOatWriterForceOatCodeLayout = false;
+
+static constexpr bool kOatWriterDebugOatCodeLayout = false;
+
 typedef DexFile::Header __attribute__((aligned(1))) UnalignedDexFileHeader;
 
 const UnalignedDexFileHeader* AsUnalignedDexFileHeader(const uint8_t* raw_data) {
@@ -867,158 +880,433 @@
   size_t compiled_methods_with_code_;
 };
 
-class OatWriter::InitCodeMethodVisitor : public OatDexMethodVisitor {
+// CompiledMethod + metadata required to do ordered method layout.
+//
+// See also OrderedMethodVisitor.
+struct OatWriter::OrderedMethodData {
+  ProfileCompilationInfo::MethodHotness method_hotness;
+  OatClass* oat_class;
+  CompiledMethod* compiled_method;
+  MethodReference method_reference;
+  size_t method_offsets_index;
+
+  size_t class_def_index;
+  uint32_t access_flags;
+  const DexFile::CodeItem* code_item;
+
+  // A value of -1 denotes missing debug info
+  static constexpr size_t kDebugInfoIdxInvalid = static_cast<size_t>(-1);
+  // Index into writer_->method_info_
+  size_t debug_info_idx;
+
+  bool HasDebugInfo() const {
+    return debug_info_idx != kDebugInfoIdxInvalid;
+  }
+
+  // Bin each method according to the profile flags.
+  //
+  // Groups by e.g.
+  //  -- not hot at all
+  //  -- hot
+  //  -- hot and startup
+  //  -- hot and post-startup
+  //  -- hot and startup and poststartup
+  //  -- startup
+  //  -- startup and post-startup
+  //  -- post-startup
+  //
+  // (See MethodHotness enum definition for up-to-date binning order.)
+  bool operator<(const OrderedMethodData& other) const {
+    if (kOatWriterForceOatCodeLayout) {
+      // Development flag: Override default behavior by sorting by name.
+
+      std::string name = method_reference.PrettyMethod();
+      std::string other_name = other.method_reference.PrettyMethod();
+      return name < other_name;
+    }
+
+    // Use the profile's method hotness to determine sort order.
+    if (GetMethodHotnessOrder() < other.GetMethodHotnessOrder()) {
+      return true;
+    }
+
+    // Default: retain the original order.
+    return false;
+  }
+
+ private:
+  // Used to determine relative order for OAT code layout when determining
+  // binning.
+  size_t GetMethodHotnessOrder() const {
+    bool hotness[] = {
+      method_hotness.IsHot(),
+      method_hotness.IsStartup(),
+      method_hotness.IsPostStartup()
+    };
+
+
+    // Note: Bin-to-bin order does not matter. If the kernel does or does not read-ahead
+    // any memory, it only goes into the buffer cache and does not grow the PSS until the first
+    // time that memory is referenced in the process.
+
+    size_t hotness_bits = 0;
+    for (size_t i = 0; i < arraysize(hotness); ++i) {
+      if (hotness[i]) {
+        hotness_bits |= (1 << i);
+      }
+    }
+
+    if (kIsDebugBuild) {
+      // Check for bins that are always-empty given a real profile.
+      if (method_hotness.IsHot() &&
+              !method_hotness.IsStartup() && !method_hotness.IsPostStartup()) {
+        std::string name = method_reference.PrettyMethod();
+        LOG(WARNING) << "Method " << name << " had a Hot method that wasn't marked "
+                     << "either start-up or post-startup. Possible corrupted profile?";
+        // This is not fatal, so only warn.
+      }
+    }
+
+    return hotness_bits;
+  }
+};
+
+// Given a queue of CompiledMethod in some total order,
+// visit each one in that order.
+class OatWriter::OrderedMethodVisitor {
  public:
-  InitCodeMethodVisitor(OatWriter* writer, size_t offset)
-      : InitCodeMethodVisitor(writer, offset, writer->GetCompilerDriver()->GetCompilerOptions()) {}
+  explicit OrderedMethodVisitor(OrderedMethodList ordered_methods)
+      : ordered_methods_(std::move(ordered_methods)) {
+  }
+
+  virtual ~OrderedMethodVisitor() {}
+
+  // Invoke VisitMethod in the order of `ordered_methods`, then invoke VisitComplete.
+  bool Visit() REQUIRES_SHARED(Locks::mutator_lock_) {
+    if (!VisitStart()) {
+      return false;
+    }
+
+    for (const OrderedMethodData& method_data : ordered_methods_)  {
+      if (!VisitMethod(method_data)) {
+        return false;
+      }
+    }
+
+    return VisitComplete();
+  }
+
+  // Invoked once at the beginning, prior to visiting anything else.
+  //
+  // Return false to abort further visiting.
+  virtual bool VisitStart() { return true; }
+
+  // Invoked repeatedly in the order specified by `ordered_methods`.
+  //
+  // Return false to short-circuit and to stop visiting further methods.
+  virtual bool VisitMethod(const OrderedMethodData& method_data)
+      REQUIRES_SHARED(Locks::mutator_lock_)  = 0;
+
+  // Invoked once at the end, after every other method has been successfully visited.
+  //
+  // Return false to indicate the overall `Visit` has failed.
+  virtual bool VisitComplete() = 0;
+
+  OrderedMethodList ReleaseOrderedMethods() {
+    return std::move(ordered_methods_);
+  }
+
+ private:
+  // List of compiled methods, sorted by the order defined in OrderedMethodData.
+  // Methods can be inserted more than once in case of duplicated methods.
+  OrderedMethodList ordered_methods_;
+};
+
+// Visit every compiled method in order to determine its order within the OAT file.
+// Methods from the same class do not need to be adjacent in the OAT code.
+class OatWriter::LayoutCodeMethodVisitor : public OatDexMethodVisitor {
+ public:
+  LayoutCodeMethodVisitor(OatWriter* writer, size_t offset)
+      : OatDexMethodVisitor(writer, offset) {
+  }
 
   bool EndClass() OVERRIDE {
     OatDexMethodVisitor::EndClass();
-    if (oat_class_index_ == writer_->oat_classes_.size()) {
-      offset_ = relative_patcher_->ReserveSpaceEnd(offset_);
-      if (generate_debug_info_) {
-        std::vector<debug::MethodDebugInfo> thunk_infos =
-            relative_patcher_->GenerateThunkDebugInfo(executable_offset_);
-        writer_->method_info_.insert(writer_->method_info_.end(),
-                                     std::make_move_iterator(thunk_infos.begin()),
-                                     std::make_move_iterator(thunk_infos.end()));
-      }
-    }
     return true;
   }
 
-  bool VisitMethod(size_t class_def_method_index, const ClassDataItemIterator& it) OVERRIDE
-      REQUIRES_SHARED(Locks::mutator_lock_) {
+  bool VisitMethod(size_t class_def_method_index,
+                   const ClassDataItemIterator& it)
+      OVERRIDE
+      REQUIRES_SHARED(Locks::mutator_lock_)  {
+    Locks::mutator_lock_->AssertSharedHeld(Thread::Current());
+
     OatClass* oat_class = &writer_->oat_classes_[oat_class_index_];
     CompiledMethod* compiled_method = oat_class->GetCompiledMethod(class_def_method_index);
 
     if (HasCompiledCode(compiled_method)) {
-      // Derived from CompiledMethod.
-      uint32_t quick_code_offset = 0;
+      size_t debug_info_idx = OrderedMethodData::kDebugInfoIdxInvalid;
 
-      ArrayRef<const uint8_t> quick_code = compiled_method->GetQuickCode();
-      uint32_t code_size = quick_code.size() * sizeof(uint8_t);
-      uint32_t thumb_offset = compiled_method->CodeDelta();
+      {
+        const CompilerOptions& compiler_options = writer_->compiler_driver_->GetCompilerOptions();
+        ArrayRef<const uint8_t> quick_code = compiled_method->GetQuickCode();
+        uint32_t code_size = quick_code.size() * sizeof(uint8_t);
 
-      // Deduplicate code arrays if we are not producing debuggable code.
-      bool deduped = true;
-      MethodReference method_ref(dex_file_, it.GetMemberIndex());
-      if (debuggable_) {
-        quick_code_offset = relative_patcher_->GetOffset(method_ref);
-        if (quick_code_offset != 0u) {
-          // Duplicate methods, we want the same code for both of them so that the oat writer puts
-          // the same code in both ArtMethods so that we do not get different oat code at runtime.
-        } else {
-          quick_code_offset = NewQuickCodeOffset(compiled_method, it, thumb_offset);
-          deduped = false;
+        // Debug method info must be pushed in the original order
+        // (i.e. all methods from the same class must be adjacent in the debug info sections)
+        // ElfCompilationUnitWriter::Write requires this.
+        if (compiler_options.GenerateAnyDebugInfo() && code_size != 0) {
+          debug::MethodDebugInfo info = debug::MethodDebugInfo();
+          writer_->method_info_.push_back(info);
+
+          // The debug info is filled in LayoutReserveOffsetCodeMethodVisitor
+          // once we know the offsets.
+          //
+          // Store the index into writer_->method_info_ since future push-backs
+          // could reallocate and change the underlying data address.
+          debug_info_idx = writer_->method_info_.size() - 1;
         }
+      }
+
+      MethodReference method_ref(dex_file_, it.GetMemberIndex());
+
+      // Lookup method hotness from profile, if available.
+      // Otherwise assume a default of none-hotness.
+      ProfileCompilationInfo::MethodHotness method_hotness =
+          writer_->profile_compilation_info_ != nullptr
+              ? writer_->profile_compilation_info_->GetMethodHotness(method_ref)
+              : ProfileCompilationInfo::MethodHotness();
+
+      // Handle duplicate methods by pushing them repeatedly.
+      OrderedMethodData method_data = {
+          method_hotness,
+          oat_class,
+          compiled_method,
+          method_ref,
+          method_offsets_index_,
+          class_def_index_,
+          it.GetMethodAccessFlags(),
+          it.GetMethodCodeItem(),
+          debug_info_idx
+      };
+      ordered_methods_.push_back(method_data);
+
+      method_offsets_index_++;
+    }
+
+    return true;
+  }
+
+  OrderedMethodList ReleaseOrderedMethods() {
+    if (kOatWriterForceOatCodeLayout || writer_->profile_compilation_info_ != nullptr) {
+      // Sort by the method ordering criteria (in OrderedMethodData).
+      // Since most methods will have the same ordering criteria,
+      // we preserve the original insertion order within the same sort order.
+      std::stable_sort(ordered_methods_.begin(), ordered_methods_.end());
+    } else {
+      // The profile-less behavior is as if every method had 0 hotness
+      // associated with it.
+      //
+      // Since sorting all methods with hotness=0 should give back the same
+      // order as before, don't do anything.
+      DCHECK(std::is_sorted(ordered_methods_.begin(), ordered_methods_.end()));
+    }
+
+    return std::move(ordered_methods_);
+  }
+
+ private:
+  // List of compiled methods, later to be sorted by order defined in OrderedMethodData.
+  // Methods can be inserted more than once in case of duplicated methods.
+  OrderedMethodList ordered_methods_;
+};
+
+// Given a method order, reserve the offsets for each CompiledMethod in the OAT file.
+class OatWriter::LayoutReserveOffsetCodeMethodVisitor : public OrderedMethodVisitor {
+ public:
+  LayoutReserveOffsetCodeMethodVisitor(OatWriter* writer,
+                                       size_t offset,
+                                       OrderedMethodList ordered_methods)
+      : LayoutReserveOffsetCodeMethodVisitor(writer,
+                                             offset,
+                                             writer->GetCompilerDriver()->GetCompilerOptions(),
+                                             std::move(ordered_methods)) {
+  }
+
+  virtual bool VisitComplete() OVERRIDE {
+    offset_ = writer_->relative_patcher_->ReserveSpaceEnd(offset_);
+    if (generate_debug_info_) {
+      std::vector<debug::MethodDebugInfo> thunk_infos =
+          relative_patcher_->GenerateThunkDebugInfo(executable_offset_);
+      writer_->method_info_.insert(writer_->method_info_.end(),
+                                   std::make_move_iterator(thunk_infos.begin()),
+                                   std::make_move_iterator(thunk_infos.end()));
+    }
+    return true;
+  }
+
+  virtual bool VisitMethod(const OrderedMethodData& method_data)
+      OVERRIDE
+      REQUIRES_SHARED(Locks::mutator_lock_) {
+    OatClass* oat_class = method_data.oat_class;
+    CompiledMethod* compiled_method = method_data.compiled_method;
+    const MethodReference& method_ref = method_data.method_reference;
+    uint16_t method_offsets_index_ = method_data.method_offsets_index;
+    size_t class_def_index = method_data.class_def_index;
+    uint32_t access_flags = method_data.access_flags;
+    const DexFile::CodeItem* code_item = method_data.code_item;
+    bool has_debug_info = method_data.HasDebugInfo();
+    size_t debug_info_idx = method_data.debug_info_idx;
+
+    DCHECK(HasCompiledCode(compiled_method)) << method_ref.PrettyMethod();
+
+    // Derived from CompiledMethod.
+    uint32_t quick_code_offset = 0;
+
+    ArrayRef<const uint8_t> quick_code = compiled_method->GetQuickCode();
+    uint32_t code_size = quick_code.size() * sizeof(uint8_t);
+    uint32_t thumb_offset = compiled_method->CodeDelta();
+
+    // Deduplicate code arrays if we are not producing debuggable code.
+    bool deduped = true;
+    if (debuggable_) {
+      quick_code_offset = relative_patcher_->GetOffset(method_ref);
+      if (quick_code_offset != 0u) {
+        // Duplicate methods, we want the same code for both of them so that the oat writer puts
+        // the same code in both ArtMethods so that we do not get different oat code at runtime.
       } else {
-        quick_code_offset = dedupe_map_.GetOrCreate(
-            compiled_method,
-            [this, &deduped, compiled_method, &it, thumb_offset]() {
-              deduped = false;
-              return NewQuickCodeOffset(compiled_method, it, thumb_offset);
-            });
+        quick_code_offset = NewQuickCodeOffset(compiled_method, method_ref, thumb_offset);
+        deduped = false;
       }
 
       if (code_size != 0) {
         if (relative_patcher_->GetOffset(method_ref) != 0u) {
           // TODO: Should this be a hard failure?
           LOG(WARNING) << "Multiple definitions of "
-              << method_ref.PrettyMethod()
+              << method_ref.dex_file->PrettyMethod(method_ref.index)
               << " offsets " << relative_patcher_->GetOffset(method_ref)
               << " " << quick_code_offset;
         } else {
           relative_patcher_->SetOffset(method_ref, quick_code_offset);
         }
       }
+    } else {
+      quick_code_offset = dedupe_map_.GetOrCreate(
+          compiled_method,
+          [this, &deduped, compiled_method, &method_ref, thumb_offset]() {
+            deduped = false;
+            return NewQuickCodeOffset(compiled_method, method_ref, thumb_offset);
+          });
+    }
 
-      // Update quick method header.
-      DCHECK_LT(method_offsets_index_, oat_class->method_headers_.size());
-      OatQuickMethodHeader* method_header = &oat_class->method_headers_[method_offsets_index_];
-      uint32_t vmap_table_offset = method_header->GetVmapTableOffset();
-      uint32_t method_info_offset = method_header->GetMethodInfoOffset();
-      // The code offset was 0 when the mapping/vmap table offset was set, so it's set
-      // to 0-offset and we need to adjust it by code_offset.
-      uint32_t code_offset = quick_code_offset - thumb_offset;
-      if (!compiled_method->GetQuickCode().empty()) {
-        // If the code is compiled, we write the offset of the stack map relative
-        // to the code,
-        if (vmap_table_offset != 0u) {
-          vmap_table_offset += code_offset;
-          DCHECK_LT(vmap_table_offset, code_offset);
-        }
-        if (method_info_offset != 0u) {
-          method_info_offset += code_offset;
-          DCHECK_LT(method_info_offset, code_offset);
-        }
+    if (code_size != 0) {
+      if (relative_patcher_->GetOffset(method_ref) != 0u) {
+        // TODO: Should this be a hard failure?
+        LOG(WARNING) << "Multiple definitions of "
+            << method_ref.dex_file->PrettyMethod(method_ref.index)
+            << " offsets " << relative_patcher_->GetOffset(method_ref)
+            << " " << quick_code_offset;
       } else {
-        CHECK(!kIsVdexEnabled);
-        // We write the offset of the quickening info relative to the code.
+        relative_patcher_->SetOffset(method_ref, quick_code_offset);
+      }
+    }
+
+    // Update quick method header.
+    DCHECK_LT(method_offsets_index_, oat_class->method_headers_.size());
+    OatQuickMethodHeader* method_header = &oat_class->method_headers_[method_offsets_index_];
+    uint32_t vmap_table_offset = method_header->GetVmapTableOffset();
+    uint32_t method_info_offset = method_header->GetMethodInfoOffset();
+    // The code offset was 0 when the mapping/vmap table offset was set, so it's set
+    // to 0-offset and we need to adjust it by code_offset.
+    uint32_t code_offset = quick_code_offset - thumb_offset;
+    if (!compiled_method->GetQuickCode().empty()) {
+      // If the code is compiled, we write the offset of the stack map relative
+      // to the code,
+      if (vmap_table_offset != 0u) {
         vmap_table_offset += code_offset;
         DCHECK_LT(vmap_table_offset, code_offset);
       }
-      uint32_t frame_size_in_bytes = compiled_method->GetFrameSizeInBytes();
-      uint32_t core_spill_mask = compiled_method->GetCoreSpillMask();
-      uint32_t fp_spill_mask = compiled_method->GetFpSpillMask();
-      *method_header = OatQuickMethodHeader(vmap_table_offset,
-                                            method_info_offset,
-                                            frame_size_in_bytes,
-                                            core_spill_mask,
-                                            fp_spill_mask,
-                                            code_size);
+      if (method_info_offset != 0u) {
+        method_info_offset += code_offset;
+        DCHECK_LT(method_info_offset, code_offset);
+      }
+    } else {
+      CHECK(!kIsVdexEnabled);
+      // We write the offset of the quickening info relative to the code.
+      vmap_table_offset += code_offset;
+      DCHECK_LT(vmap_table_offset, code_offset);
+    }
+    uint32_t frame_size_in_bytes = compiled_method->GetFrameSizeInBytes();
+    uint32_t core_spill_mask = compiled_method->GetCoreSpillMask();
+    uint32_t fp_spill_mask = compiled_method->GetFpSpillMask();
+    *method_header = OatQuickMethodHeader(vmap_table_offset,
+                                          method_info_offset,
+                                          frame_size_in_bytes,
+                                          core_spill_mask,
+                                          fp_spill_mask,
+                                          code_size);
 
-      if (!deduped) {
-        // Update offsets. (Checksum is updated when writing.)
-        offset_ += sizeof(*method_header);  // Method header is prepended before code.
-        offset_ += code_size;
-        // Record absolute patch locations.
-        if (!compiled_method->GetPatches().empty()) {
-          uintptr_t base_loc = offset_ - code_size - writer_->oat_header_->GetExecutableOffset();
-          for (const LinkerPatch& patch : compiled_method->GetPatches()) {
-            if (!patch.IsPcRelative()) {
-              writer_->absolute_patch_locations_.push_back(base_loc + patch.LiteralOffset());
-            }
+    if (!deduped) {
+      // Update offsets. (Checksum is updated when writing.)
+      offset_ += sizeof(*method_header);  // Method header is prepended before code.
+      offset_ += code_size;
+      // Record absolute patch locations.
+      if (!compiled_method->GetPatches().empty()) {
+        uintptr_t base_loc = offset_ - code_size - writer_->oat_header_->GetExecutableOffset();
+        for (const LinkerPatch& patch : compiled_method->GetPatches()) {
+          if (!patch.IsPcRelative()) {
+            writer_->absolute_patch_locations_.push_back(base_loc + patch.LiteralOffset());
           }
         }
       }
-
-      // Exclude quickened dex methods (code_size == 0) since they have no native code.
-      if (generate_debug_info_ && code_size != 0) {
-        bool has_code_info = method_header->IsOptimized();
-        // Record debug information for this function if we are doing that.
-        debug::MethodDebugInfo info = {};
-        DCHECK(info.trampoline_name.empty());
-        info.dex_file = dex_file_;
-        info.class_def_index = class_def_index_;
-        info.dex_method_index = it.GetMemberIndex();
-        info.access_flags = it.GetMethodAccessFlags();
-        info.code_item = it.GetMethodCodeItem();
-        info.isa = compiled_method->GetInstructionSet();
-        info.deduped = deduped;
-        info.is_native_debuggable = native_debuggable_;
-        info.is_optimized = method_header->IsOptimized();
-        info.is_code_address_text_relative = true;
-        info.code_address = code_offset - executable_offset_;
-        info.code_size = code_size;
-        info.frame_size_in_bytes = compiled_method->GetFrameSizeInBytes();
-        info.code_info = has_code_info ? compiled_method->GetVmapTable().data() : nullptr;
-        info.cfi = compiled_method->GetCFIInfo();
-        writer_->method_info_.push_back(info);
-      }
-
-      DCHECK_LT(method_offsets_index_, oat_class->method_offsets_.size());
-      OatMethodOffsets* offsets = &oat_class->method_offsets_[method_offsets_index_];
-      offsets->code_offset_ = quick_code_offset;
-      ++method_offsets_index_;
     }
 
+    // Exclude quickened dex methods (code_size == 0) since they have no native code.
+    if (generate_debug_info_ && code_size != 0) {
+      DCHECK(has_debug_info);
+
+      bool has_code_info = method_header->IsOptimized();
+      // Record debug information for this function if we are doing that.
+      debug::MethodDebugInfo& info = writer_->method_info_[debug_info_idx];
+      DCHECK(info.trampoline_name.empty());
+      info.dex_file = method_ref.dex_file;
+      info.class_def_index = class_def_index;
+      info.dex_method_index = method_ref.index;
+      info.access_flags = access_flags;
+      info.code_item = code_item;
+      info.isa = compiled_method->GetInstructionSet();
+      info.deduped = deduped;
+      info.is_native_debuggable = native_debuggable_;
+      info.is_optimized = method_header->IsOptimized();
+      info.is_code_address_text_relative = true;
+      info.code_address = code_offset - executable_offset_;
+      info.code_size = code_size;
+      info.frame_size_in_bytes = compiled_method->GetFrameSizeInBytes();
+      info.code_info = has_code_info ? compiled_method->GetVmapTable().data() : nullptr;
+      info.cfi = compiled_method->GetCFIInfo();
+    } else {
+      DCHECK(!has_debug_info);
+    }
+
+    DCHECK_LT(method_offsets_index_, oat_class->method_offsets_.size());
+    OatMethodOffsets* offsets = &oat_class->method_offsets_[method_offsets_index_];
+    offsets->code_offset_ = quick_code_offset;
+
     return true;
   }
 
+  size_t GetOffset() const {
+    return offset_;
+  }
+
  private:
-  InitCodeMethodVisitor(OatWriter* writer, size_t offset, const CompilerOptions& compiler_options)
-      : OatDexMethodVisitor(writer, offset),
+  LayoutReserveOffsetCodeMethodVisitor(OatWriter* writer,
+                                       size_t offset,
+                                       const CompilerOptions& compiler_options,
+                                       OrderedMethodList ordered_methods)
+      : OrderedMethodVisitor(std::move(ordered_methods)),
+        writer_(writer),
+        offset_(offset),
         relative_patcher_(writer->relative_patcher_),
         executable_offset_(writer->oat_header_->GetExecutableOffset()),
         debuggable_(compiler_options.GetDebuggable()),
@@ -1049,16 +1337,20 @@
   };
 
   uint32_t NewQuickCodeOffset(CompiledMethod* compiled_method,
-                              const ClassDataItemIterator& it,
+                              const MethodReference& method_ref,
                               uint32_t thumb_offset) {
-    offset_ = relative_patcher_->ReserveSpace(
-        offset_, compiled_method, MethodReference(dex_file_, it.GetMemberIndex()));
+    offset_ = relative_patcher_->ReserveSpace(offset_, compiled_method, method_ref);
     offset_ += CodeAlignmentSize(offset_, *compiled_method);
     DCHECK_ALIGNED_PARAM(offset_ + sizeof(OatQuickMethodHeader),
                          GetInstructionSetAlignment(compiled_method->GetInstructionSet()));
     return offset_ + sizeof(OatQuickMethodHeader) + thumb_offset;
   }
 
+  OatWriter* writer_;
+
+  // Offset of the code of the compiled methods.
+  size_t offset_;
+
   // Deduplication is already done on a pointer basis by the compiler driver,
   // so we can simply compare the pointers to find out if things are duplicated.
   SafeMap<const CompiledMethod*, uint32_t, CodeOffsetsKeyComparator> dedupe_map_;
@@ -1296,19 +1588,24 @@
   std::vector<std::pair<ArtMethod*, ArtMethod*>> methods_to_process_;
 };
 
-class OatWriter::WriteCodeMethodVisitor : public OatDexMethodVisitor {
+class OatWriter::WriteCodeMethodVisitor : public OrderedMethodVisitor {
  public:
-  WriteCodeMethodVisitor(OatWriter* writer, OutputStream* out, const size_t file_offset,
-                         size_t relative_offset) SHARED_LOCK_FUNCTION(Locks::mutator_lock_)
-      : OatDexMethodVisitor(writer, relative_offset),
+  WriteCodeMethodVisitor(OatWriter* writer,
+                         OutputStream* out,
+                         const size_t file_offset,
+                         size_t relative_offset,
+                         OrderedMethodList ordered_methods)
+      : OrderedMethodVisitor(std::move(ordered_methods)),
+        writer_(writer),
+        offset_(relative_offset),
+        dex_file_(nullptr),
         pointer_size_(GetInstructionSetPointerSize(writer_->compiler_driver_->GetInstructionSet())),
         class_loader_(writer->HasImage() ? writer->image_writer_->GetClassLoader() : nullptr),
         out_(out),
         file_offset_(file_offset),
-        soa_(Thread::Current()),
-        no_thread_suspension_("OatWriter patching"),
         class_linker_(Runtime::Current()->GetClassLinker()),
-        dex_cache_(nullptr) {
+        dex_cache_(nullptr),
+        no_thread_suspension_("OatWriter patching") {
     patched_code_.reserve(16 * KB);
     if (writer_->HasBootImage()) {
       // If we're creating the image, the address space must be ready so that we can apply patches.
@@ -1316,12 +1613,17 @@
     }
   }
 
-  ~WriteCodeMethodVisitor() UNLOCK_FUNCTION(Locks::mutator_lock_) {
+  virtual bool VisitStart() OVERRIDE {
+    return true;
   }
 
-  bool StartClass(const DexFile* dex_file, size_t class_def_index) OVERRIDE
+  void UpdateDexFileAndDexCache(const DexFile* dex_file)
       REQUIRES_SHARED(Locks::mutator_lock_) {
-    OatDexMethodVisitor::StartClass(dex_file, class_def_index);
+    dex_file_ = dex_file;
+
+    // Ordered method visiting is only for compiled methods.
+    DCHECK(writer_->MayHaveCompiledMethods());
+
     if (writer_->GetCompilerDriver()->GetCompilerOptions().IsAotCompilationEnabled()) {
       // Only need to set the dex cache if we have compilation. Other modes might have unloaded it.
       if (dex_cache_ == nullptr || dex_cache_->GetDexFile() != dex_file) {
@@ -1329,198 +1631,212 @@
         DCHECK(dex_cache_ != nullptr);
       }
     }
+  }
+
+  virtual bool VisitComplete() {
+    offset_ = writer_->relative_patcher_->WriteThunks(out_, offset_);
+    if (UNLIKELY(offset_ == 0u)) {
+      PLOG(ERROR) << "Failed to write final relative call thunks";
+      return false;
+    }
     return true;
   }
 
-  bool EndClass() OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
-    bool result = OatDexMethodVisitor::EndClass();
-    if (oat_class_index_ == writer_->oat_classes_.size()) {
-      DCHECK(result);  // OatDexMethodVisitor::EndClass() never fails.
-      offset_ = writer_->relative_patcher_->WriteThunks(out_, offset_);
-      if (UNLIKELY(offset_ == 0u)) {
-        PLOG(ERROR) << "Failed to write final relative call thunks";
-        result = false;
-      }
-    }
-    return result;
-  }
-
-  bool VisitMethod(size_t class_def_method_index, const ClassDataItemIterator& it) OVERRIDE
+  virtual bool VisitMethod(const OrderedMethodData& method_data) OVERRIDE
       REQUIRES_SHARED(Locks::mutator_lock_) {
-    OatClass* oat_class = &writer_->oat_classes_[oat_class_index_];
-    const CompiledMethod* compiled_method = oat_class->GetCompiledMethod(class_def_method_index);
+    const MethodReference& method_ref = method_data.method_reference;
+    UpdateDexFileAndDexCache(method_ref.dex_file);
+
+    OatClass* oat_class = method_data.oat_class;
+    CompiledMethod* compiled_method = method_data.compiled_method;
+    uint16_t method_offsets_index = method_data.method_offsets_index;
 
     // No thread suspension since dex_cache_ that may get invalidated if that occurs.
     ScopedAssertNoThreadSuspension tsc(__FUNCTION__);
-    if (HasCompiledCode(compiled_method)) {
-      size_t file_offset = file_offset_;
-      OutputStream* out = out_;
+    DCHECK(HasCompiledCode(compiled_method)) << method_ref.PrettyMethod();
 
-      ArrayRef<const uint8_t> quick_code = compiled_method->GetQuickCode();
-      uint32_t code_size = quick_code.size() * sizeof(uint8_t);
+    // TODO: cleanup DCHECK_OFFSET_ to accept file_offset as parameter.
+    size_t file_offset = file_offset_;  // Used by DCHECK_OFFSET_ macro.
+    OutputStream* out = out_;
 
-      // Deduplicate code arrays.
-      const OatMethodOffsets& method_offsets = oat_class->method_offsets_[method_offsets_index_];
-      if (method_offsets.code_offset_ > offset_) {
-        offset_ = writer_->relative_patcher_->WriteThunks(out, offset_);
-        if (offset_ == 0u) {
-          ReportWriteFailure("relative call thunk", it);
+    ArrayRef<const uint8_t> quick_code = compiled_method->GetQuickCode();
+    uint32_t code_size = quick_code.size() * sizeof(uint8_t);
+
+    // Deduplicate code arrays.
+    const OatMethodOffsets& method_offsets = oat_class->method_offsets_[method_offsets_index];
+    if (method_offsets.code_offset_ > offset_) {
+      offset_ = writer_->relative_patcher_->WriteThunks(out, offset_);
+      if (offset_ == 0u) {
+        ReportWriteFailure("relative call thunk", method_ref);
+        return false;
+      }
+      uint32_t alignment_size = CodeAlignmentSize(offset_, *compiled_method);
+      if (alignment_size != 0) {
+        if (!writer_->WriteCodeAlignment(out, alignment_size)) {
+          ReportWriteFailure("code alignment padding", method_ref);
           return false;
         }
-        uint32_t alignment_size = CodeAlignmentSize(offset_, *compiled_method);
-        if (alignment_size != 0) {
-          if (!writer_->WriteCodeAlignment(out, alignment_size)) {
-            ReportWriteFailure("code alignment padding", it);
-            return false;
-          }
-          offset_ += alignment_size;
-          DCHECK_OFFSET_();
-        }
-        DCHECK_ALIGNED_PARAM(offset_ + sizeof(OatQuickMethodHeader),
-                             GetInstructionSetAlignment(compiled_method->GetInstructionSet()));
-        DCHECK_EQ(method_offsets.code_offset_,
-                  offset_ + sizeof(OatQuickMethodHeader) + compiled_method->CodeDelta())
-            << dex_file_->PrettyMethod(it.GetMemberIndex());
-        const OatQuickMethodHeader& method_header =
-            oat_class->method_headers_[method_offsets_index_];
-        if (!out->WriteFully(&method_header, sizeof(method_header))) {
-          ReportWriteFailure("method header", it);
-          return false;
-        }
-        writer_->size_method_header_ += sizeof(method_header);
-        offset_ += sizeof(method_header);
+        offset_ += alignment_size;
         DCHECK_OFFSET_();
+      }
+      DCHECK_ALIGNED_PARAM(offset_ + sizeof(OatQuickMethodHeader),
+                           GetInstructionSetAlignment(compiled_method->GetInstructionSet()));
+      DCHECK_EQ(method_offsets.code_offset_,
+                offset_ + sizeof(OatQuickMethodHeader) + compiled_method->CodeDelta())
+          << dex_file_->PrettyMethod(method_ref.index);
+      const OatQuickMethodHeader& method_header =
+          oat_class->method_headers_[method_offsets_index];
+      if (!out->WriteFully(&method_header, sizeof(method_header))) {
+        ReportWriteFailure("method header", method_ref);
+        return false;
+      }
+      writer_->size_method_header_ += sizeof(method_header);
+      offset_ += sizeof(method_header);
+      DCHECK_OFFSET_();
 
-        if (!compiled_method->GetPatches().empty()) {
-          patched_code_.assign(quick_code.begin(), quick_code.end());
-          quick_code = ArrayRef<const uint8_t>(patched_code_);
-          for (const LinkerPatch& patch : compiled_method->GetPatches()) {
-            uint32_t literal_offset = patch.LiteralOffset();
-            switch (patch.GetType()) {
-              case LinkerPatch::Type::kMethodBssEntry: {
-                uint32_t target_offset =
-                    writer_->bss_start_ + writer_->bss_method_entries_.Get(patch.TargetMethod());
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kCallRelative: {
-                // NOTE: Relative calls across oat files are not supported.
-                uint32_t target_offset = GetTargetOffset(patch);
-                writer_->relative_patcher_->PatchCall(&patched_code_,
-                                                      literal_offset,
-                                                      offset_ + literal_offset,
-                                                      target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kStringRelative: {
-                uint32_t target_offset = GetTargetObjectOffset(GetTargetString(patch));
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kStringInternTable: {
-                uint32_t target_offset = GetInternTableEntryOffset(patch);
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kStringBssEntry: {
-                StringReference ref(patch.TargetStringDexFile(), patch.TargetStringIndex());
-                uint32_t target_offset =
-                    writer_->bss_start_ + writer_->bss_string_entries_.Get(ref);
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kTypeRelative: {
-                uint32_t target_offset = GetTargetObjectOffset(GetTargetType(patch));
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kTypeClassTable: {
-                uint32_t target_offset = GetClassTableEntryOffset(patch);
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kTypeBssEntry: {
-                TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
-                uint32_t target_offset = writer_->bss_start_ + writer_->bss_type_entries_.Get(ref);
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kCall: {
-                uint32_t target_offset = GetTargetOffset(patch);
-                PatchCodeAddress(&patched_code_, literal_offset, target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kMethodRelative: {
-                uint32_t target_offset = GetTargetMethodOffset(GetTargetMethod(patch));
-                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
-                                                                     patch,
-                                                                     offset_ + literal_offset,
-                                                                     target_offset);
-                break;
-              }
-              case LinkerPatch::Type::kBakerReadBarrierBranch: {
-                writer_->relative_patcher_->PatchBakerReadBarrierBranch(&patched_code_,
-                                                                        patch,
-                                                                        offset_ + literal_offset);
-                break;
-              }
-              default: {
-                DCHECK(false) << "Unexpected linker patch type: " << patch.GetType();
-                break;
-              }
+      if (!compiled_method->GetPatches().empty()) {
+        patched_code_.assign(quick_code.begin(), quick_code.end());
+        quick_code = ArrayRef<const uint8_t>(patched_code_);
+        for (const LinkerPatch& patch : compiled_method->GetPatches()) {
+          uint32_t literal_offset = patch.LiteralOffset();
+          switch (patch.GetType()) {
+            case LinkerPatch::Type::kMethodBssEntry: {
+              uint32_t target_offset =
+                  writer_->bss_start_ + writer_->bss_method_entries_.Get(patch.TargetMethod());
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kCallRelative: {
+              // NOTE: Relative calls across oat files are not supported.
+              uint32_t target_offset = GetTargetOffset(patch);
+              writer_->relative_patcher_->PatchCall(&patched_code_,
+                                                    literal_offset,
+                                                    offset_ + literal_offset,
+                                                    target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kStringRelative: {
+              uint32_t target_offset = GetTargetObjectOffset(GetTargetString(patch));
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kStringInternTable: {
+              uint32_t target_offset = GetInternTableEntryOffset(patch);
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kStringBssEntry: {
+              StringReference ref(patch.TargetStringDexFile(), patch.TargetStringIndex());
+              uint32_t target_offset =
+                  writer_->bss_start_ + writer_->bss_string_entries_.Get(ref);
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kTypeRelative: {
+              uint32_t target_offset = GetTargetObjectOffset(GetTargetType(patch));
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kTypeClassTable: {
+              uint32_t target_offset = GetClassTableEntryOffset(patch);
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kTypeBssEntry: {
+              TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
+              uint32_t target_offset = writer_->bss_start_ + writer_->bss_type_entries_.Get(ref);
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kCall: {
+              uint32_t target_offset = GetTargetOffset(patch);
+              PatchCodeAddress(&patched_code_, literal_offset, target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kMethodRelative: {
+              uint32_t target_offset = GetTargetMethodOffset(GetTargetMethod(patch));
+              writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                   patch,
+                                                                   offset_ + literal_offset,
+                                                                   target_offset);
+              break;
+            }
+            case LinkerPatch::Type::kBakerReadBarrierBranch: {
+              writer_->relative_patcher_->PatchBakerReadBarrierBranch(&patched_code_,
+                                                                      patch,
+                                                                      offset_ + literal_offset);
+              break;
+            }
+            default: {
+              DCHECK(false) << "Unexpected linker patch type: " << patch.GetType();
+              break;
             }
           }
         }
-
-        if (!out->WriteFully(quick_code.data(), code_size)) {
-          ReportWriteFailure("method code", it);
-          return false;
-        }
-        writer_->size_code_ += code_size;
-        offset_ += code_size;
       }
-      DCHECK_OFFSET_();
-      ++method_offsets_index_;
+
+      if (!out->WriteFully(quick_code.data(), code_size)) {
+        ReportWriteFailure("method code", method_ref);
+        return false;
+      }
+      writer_->size_code_ += code_size;
+      offset_ += code_size;
     }
+    DCHECK_OFFSET_();
 
     return true;
   }
 
+  size_t GetOffset() const {
+    return offset_;
+  }
+
  private:
+  OatWriter* const writer_;
+
+  // Updated in VisitMethod as methods are written out.
+  size_t offset_;
+
+  // Potentially varies with every different VisitMethod.
+  // Used to determine which DexCache to use when finding ArtMethods.
+  const DexFile* dex_file_;
+
+  // Pointer size we are compiling to.
   const PointerSize pointer_size_;
+  // The image writer's classloader, if there is one, else null.
   ObjPtr<mirror::ClassLoader> class_loader_;
+  // Stream to output file, where the OAT code will be written to.
   OutputStream* const out_;
   const size_t file_offset_;
-  const ScopedObjectAccess soa_;
-  const ScopedAssertNoThreadSuspension no_thread_suspension_;
   ClassLinker* const class_linker_;
   ObjPtr<mirror::DexCache> dex_cache_;
   std::vector<uint8_t> patched_code_;
+  const ScopedAssertNoThreadSuspension no_thread_suspension_;
 
-  void ReportWriteFailure(const char* what, const ClassDataItemIterator& it) {
+  void ReportWriteFailure(const char* what, const MethodReference& method_ref) {
     PLOG(ERROR) << "Failed to write " << what << " for "
-        << dex_file_->PrettyMethod(it.GetMemberIndex()) << " to " << out_->GetLocation();
+        << method_ref.PrettyMethod() << " to " << out_->GetLocation();
   }
 
   ArtMethod* GetTargetMethod(const LinkerPatch& patch)
@@ -1529,7 +1845,8 @@
     ObjPtr<mirror::DexCache> dex_cache =
         (dex_file_ == ref.dex_file) ? dex_cache_ : class_linker_->FindDexCache(
             Thread::Current(), *ref.dex_file);
-    ArtMethod* method = class_linker_->LookupResolvedMethod(ref.index, dex_cache, class_loader_);
+    ArtMethod* method =
+        class_linker_->LookupResolvedMethod(ref.index, dex_cache, class_loader_);
     CHECK(method != nullptr);
     return method;
   }
@@ -2002,12 +2319,50 @@
 
 size_t OatWriter::InitOatCodeDexFiles(size_t offset) {
   if (!compiler_driver_->GetCompilerOptions().IsAnyCompilationEnabled()) {
+    if (kOatWriterDebugOatCodeLayout) {
+      LOG(INFO) << "InitOatCodeDexFiles: OatWriter("
+                << this << "), "
+                << "compilation is disabled";
+    }
+
     return offset;
   }
-  InitCodeMethodVisitor code_visitor(this, offset);
-  bool success = VisitDexMethods(&code_visitor);
-  DCHECK(success);
-  offset = code_visitor.GetOffset();
+  bool success = false;
+
+  {
+    ScopedObjectAccess soa(Thread::Current());
+
+    LayoutCodeMethodVisitor layout_code_visitor(this, offset);
+    success = VisitDexMethods(&layout_code_visitor);
+    DCHECK(success);
+
+    LayoutReserveOffsetCodeMethodVisitor layout_reserve_code_visitor(
+        this,
+        offset,
+        layout_code_visitor.ReleaseOrderedMethods());
+    success = layout_reserve_code_visitor.Visit();
+    DCHECK(success);
+    offset = layout_reserve_code_visitor.GetOffset();
+
+    // Save the method order because the WriteCodeMethodVisitor will need this
+    // order again.
+    DCHECK(ordered_methods_ == nullptr);
+    ordered_methods_.reset(
+        new OrderedMethodList(
+            layout_reserve_code_visitor.ReleaseOrderedMethods()));
+
+    if (kOatWriterDebugOatCodeLayout) {
+      LOG(INFO) << "IniatOatCodeDexFiles: method order: ";
+      for (const OrderedMethodData& ordered_method : *ordered_methods_) {
+        std::string pretty_name = ordered_method.method_reference.PrettyMethod();
+        LOG(INFO) << pretty_name
+                  << "@ offset "
+                  << relative_patcher_->GetOffset(ordered_method.method_reference)
+                  << " X hotness "
+                  << reinterpret_cast<void*>(ordered_method.method_hotness.GetFlags());
+      }
+    }
+  }
 
   if (HasImage()) {
     InitImageMethodVisitor image_visitor(this, offset, dex_files_);
@@ -2689,18 +3044,30 @@
 size_t OatWriter::WriteCodeDexFiles(OutputStream* out,
                                     size_t file_offset,
                                     size_t relative_offset) {
-  #define VISIT(VisitorType)                                              \
-    do {                                                                  \
-      VisitorType visitor(this, out, file_offset, relative_offset);       \
-      if (UNLIKELY(!VisitDexMethods(&visitor))) {                         \
-        return 0;                                                         \
-      }                                                                   \
-      relative_offset = visitor.GetOffset();                              \
-    } while (false)
+  if (!compiler_driver_->GetCompilerOptions().IsAnyCompilationEnabled()) {
+    // As with InitOatCodeDexFiles, also skip the writer if
+    // compilation was disabled.
+    if (kOatWriterDebugOatCodeLayout) {
+      LOG(INFO) << "WriteCodeDexFiles: OatWriter("
+                << this << "), "
+                << "compilation is disabled";
+    }
 
-  VISIT(WriteCodeMethodVisitor);
-
-  #undef VISIT
+    return relative_offset;
+  }
+  ScopedObjectAccess soa(Thread::Current());
+  DCHECK(ordered_methods_ != nullptr);
+  std::unique_ptr<OrderedMethodList> ordered_methods_ptr =
+      std::move(ordered_methods_);
+  WriteCodeMethodVisitor visitor(this,
+                                 out,
+                                 file_offset,
+                                 relative_offset,
+                                 std::move(*ordered_methods_ptr));
+  if (UNLIKELY(!visitor.Visit())) {
+    return 0;
+  }
+  relative_offset = visitor.GetOffset();
 
   size_code_alignment_ += relative_patcher_->CodeAlignmentSize();
   size_relative_call_thunks_ += relative_patcher_->RelativeCallThunksSize();
diff --git a/dex2oat/linker/oat_writer.h b/dex2oat/linker/oat_writer.h
index a93dd23..c742fd4 100644
--- a/dex2oat/linker/oat_writer.h
+++ b/dex2oat/linker/oat_writer.h
@@ -20,6 +20,7 @@
 #include <stdint.h>
 #include <cstddef>
 #include <memory>
+#include <vector>
 
 #include "base/array_ref.h"
 #include "base/dchecked_vector.h"
@@ -254,6 +255,10 @@
   class OatDexMethodVisitor;
   class InitBssLayoutMethodVisitor;
   class InitOatClassesMethodVisitor;
+  class LayoutCodeMethodVisitor;
+  class LayoutReserveOffsetCodeMethodVisitor;
+  struct OrderedMethodData;
+  class OrderedMethodVisitor;
   class InitCodeMethodVisitor;
   class InitMapMethodVisitor;
   class InitMethodInfoVisitor;
@@ -486,6 +491,13 @@
   // Profile info used to generate new layout of files.
   ProfileCompilationInfo* profile_compilation_info_;
 
+  using OrderedMethodList = std::vector<OrderedMethodData>;
+
+  // List of compiled methods, sorted by the order defined in OrderedMethodData.
+  // Methods can be inserted more than once in case of duplicated methods.
+  // This pointer is only non-null after InitOatCodeDexFiles succeeds.
+  std::unique_ptr<OrderedMethodList> ordered_methods_;
+
   DISALLOW_COPY_AND_ASSIGN(OatWriter);
 };
 
diff --git a/dexlayout/Android.bp b/dexlayout/Android.bp
index 588a3ae..29c9e92 100644
--- a/dexlayout/Android.bp
+++ b/dexlayout/Android.bp
@@ -74,9 +74,9 @@
         android: {
             shared_libs: [
                 "libpagemap",
-            ]
+            ],
         },
-    }
+    },
 }
 
 art_cc_test {
diff --git a/dexlayout/dex_ir.cc b/dexlayout/dex_ir.cc
index 5913832..0c944ce 100644
--- a/dexlayout/dex_ir.cc
+++ b/dexlayout/dex_ir.cc
@@ -185,21 +185,14 @@
                                std::vector<MethodId*>* method_ids,
                                std::vector<FieldId*>* field_ids) {
   bool has_id = false;
-  // Iterate over all instructions.
-  const uint16_t* insns = code->Insns();
-  for (uint32_t insn_idx = 0; insn_idx < code->InsnsSize();) {
-    const Instruction* instruction = Instruction::At(&insns[insn_idx]);
-    const uint32_t insn_width = instruction->SizeInCodeUnits();
-    if (insn_width == 0) {
-      break;
-    }
+  for (const Instruction& instruction : code->Instructions()) {
+    CHECK_GT(instruction.SizeInCodeUnits(), 0u);
     has_id |= GetIdFromInstruction(collections,
-                                   instruction,
+                                   &instruction,
                                    type_ids,
                                    string_ids,
                                    method_ids,
                                    field_ids);
-    insn_idx += insn_width;
   }  // for
   return has_id;
 }
diff --git a/dexlayout/dex_ir.h b/dexlayout/dex_ir.h
index 362c08b..5dcc87d 100644
--- a/dexlayout/dex_ir.h
+++ b/dexlayout/dex_ir.h
@@ -947,6 +947,11 @@
 
   void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
 
+  IterationRange<DexInstructionIterator> Instructions() const {
+    return MakeIterationRange(DexInstructionIterator(Insns()),
+                              DexInstructionIterator(Insns() + InsnsSize()));
+  }
+
  private:
   uint16_t registers_size_;
   uint16_t ins_size_;
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index 92a1366..095c960 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -1079,16 +1079,15 @@
           code_offset, code_offset, dot.c_str(), name, type_descriptor.c_str());
 
   // Iterate over all instructions.
-  const uint16_t* insns = code->Insns();
-  for (uint32_t insn_idx = 0; insn_idx < code->InsnsSize();) {
-    const Instruction* instruction = Instruction::At(&insns[insn_idx]);
-    const uint32_t insn_width = instruction->SizeInCodeUnits();
+  IterationRange<DexInstructionIterator> instructions = code->Instructions();
+  for (auto inst = instructions.begin(); inst != instructions.end(); ++inst) {
+    const uint32_t dex_pc = inst.GetDexPC(instructions.begin());
+    const uint32_t insn_width = inst->SizeInCodeUnits();
     if (insn_width == 0) {
-      fprintf(stderr, "GLITCH: zero-width instruction at idx=0x%04x\n", insn_idx);
+      fprintf(stderr, "GLITCH: zero-width instruction at idx=0x%04x\n", dex_pc);
       break;
     }
-    DumpInstruction(code, code_offset, insn_idx, insn_width, instruction);
-    insn_idx += insn_width;
+    DumpInstruction(code, code_offset, dex_pc, insn_width, &*inst);
   }  // for
 }
 
diff --git a/dexoptanalyzer/Android.bp b/dexoptanalyzer/Android.bp
index 715c209..33366ad 100644
--- a/dexoptanalyzer/Android.bp
+++ b/dexoptanalyzer/Android.bp
@@ -58,7 +58,7 @@
         "art_gtest_defaults",
     ],
     shared_libs: [
-        "libbacktrace"
+        "libbacktrace",
     ],
     srcs: ["dexoptanalyzer_test.cc"],
 }
diff --git a/disassembler/Android.bp b/disassembler/Android.bp
index 086b8c7..8849309 100644
--- a/disassembler/Android.bp
+++ b/disassembler/Android.bp
@@ -18,7 +18,6 @@
     name: "libart-disassembler-defaults",
     defaults: ["art_defaults"],
     host_supported: true,
-    clang: true,
     srcs: [
         "disassembler.cc",
         "disassembler_arm.cc",
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index be78136..bcf007b 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -905,26 +905,23 @@
       if (code_item == nullptr) {
         return;
       }
-      const size_t code_item_size = code_item->insns_size_in_code_units_;
-      const uint16_t* code_ptr = code_item->insns_;
-      const uint16_t* code_end = code_item->insns_ + code_item_size;
 
+      const uint16_t* code_ptr = code_item->insns_;
       // If we inserted a new dex code item pointer, add to total code bytes.
       if (dex_code_item_ptrs_.insert(code_ptr).second) {
-        dex_code_bytes_ += code_item_size * sizeof(code_ptr[0]);
+        dex_code_bytes_ += code_item->insns_size_in_code_units_ * sizeof(code_ptr[0]);
       }
 
-      while (code_ptr < code_end) {
-        const Instruction* inst = Instruction::At(code_ptr);
-        switch (inst->Opcode()) {
+      for (const Instruction& inst : code_item->Instructions()) {
+        switch (inst.Opcode()) {
           case Instruction::CONST_STRING: {
-            const dex::StringIndex string_index(inst->VRegB_21c());
+            const dex::StringIndex string_index(inst.VRegB_21c());
             unique_string_ids_from_code_.insert(StringReference(&dex_file, string_index));
             ++num_string_ids_from_code_;
             break;
           }
           case Instruction::CONST_STRING_JUMBO: {
-            const dex::StringIndex string_index(inst->VRegB_31c());
+            const dex::StringIndex string_index(inst.VRegB_31c());
             unique_string_ids_from_code_.insert(StringReference(&dex_file, string_index));
             ++num_string_ids_from_code_;
             break;
@@ -932,8 +929,6 @@
           default:
             break;
         }
-
-        code_ptr += inst->SizeInCodeUnits();
       }
     }
 
@@ -1520,12 +1515,11 @@
 
   void DumpDexCode(std::ostream& os, const DexFile& dex_file, const DexFile::CodeItem* code_item) {
     if (code_item != nullptr) {
-      size_t i = 0;
-      while (i < code_item->insns_size_in_code_units_) {
-        const Instruction* instruction = Instruction::At(&code_item->insns_[i]);
-        os << StringPrintf("0x%04zx: ", i) << instruction->DumpHexLE(5)
-           << StringPrintf("\t| %s\n", instruction->DumpString(&dex_file).c_str());
-        i += instruction->SizeInCodeUnits();
+      IterationRange<DexInstructionIterator> instructions = code_item->Instructions();
+      for (auto it = instructions.begin(); it != instructions.end(); ++it) {
+        const size_t dex_pc = it.GetDexPC(instructions.begin());
+        os << StringPrintf("0x%04zx: ", dex_pc) << it->DumpHexLE(5)
+           << StringPrintf("\t| %s\n", it->DumpString(&dex_file).c_str());
       }
     }
   }
diff --git a/openjdkjvm/Android.bp b/openjdkjvm/Android.bp
index 071b434..761df02 100644
--- a/openjdkjvm/Android.bp
+++ b/openjdkjvm/Android.bp
@@ -20,7 +20,7 @@
     srcs: ["OpenjdkJvm.cc"],
     shared_libs: [
         "libbase",
-        "libnativehelper"
+        "libnativehelper",
     ],
 }
 
diff --git a/openjdkjvmti/Android.bp b/openjdkjvmti/Android.bp
index b6b1b56..84a90d6 100644
--- a/openjdkjvmti/Android.bp
+++ b/openjdkjvmti/Android.bp
@@ -23,31 +23,33 @@
     name: "libopenjdkjvmti_defaults",
     defaults: ["art_defaults"],
     host_supported: true,
-    srcs: ["events.cc",
-           "fixed_up_dex_file.cc",
-           "object_tagging.cc",
-           "OpenjdkJvmTi.cc",
-           "ti_allocator.cc",
-           "ti_breakpoint.cc",
-           "ti_class.cc",
-           "ti_class_definition.cc",
-           "ti_class_loader.cc",
-           "ti_dump.cc",
-           "ti_field.cc",
-           "ti_heap.cc",
-           "ti_jni.cc",
-           "ti_method.cc",
-           "ti_monitor.cc",
-           "ti_object.cc",
-           "ti_phase.cc",
-           "ti_properties.cc",
-           "ti_search.cc",
-           "ti_stack.cc",
-           "ti_redefine.cc",
-           "ti_thread.cc",
-           "ti_threadgroup.cc",
-           "ti_timers.cc",
-           "transform.cc"],
+    srcs: [
+        "events.cc",
+        "fixed_up_dex_file.cc",
+        "object_tagging.cc",
+        "OpenjdkJvmTi.cc",
+        "ti_allocator.cc",
+        "ti_breakpoint.cc",
+        "ti_class.cc",
+        "ti_class_definition.cc",
+        "ti_class_loader.cc",
+        "ti_dump.cc",
+        "ti_field.cc",
+        "ti_heap.cc",
+        "ti_jni.cc",
+        "ti_method.cc",
+        "ti_monitor.cc",
+        "ti_object.cc",
+        "ti_phase.cc",
+        "ti_properties.cc",
+        "ti_search.cc",
+        "ti_stack.cc",
+        "ti_redefine.cc",
+        "ti_thread.cc",
+        "ti_threadgroup.cc",
+        "ti_timers.cc",
+        "transform.cc",
+    ],
     header_libs: ["libopenjdkjvmti_headers"],
     shared_libs: [
         "libbase",
diff --git a/openjdkjvmti/OpenjdkJvmTi.cc b/openjdkjvmti/OpenjdkJvmTi.cc
index 4339b2b..bac57f9 100644
--- a/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/openjdkjvmti/OpenjdkJvmTi.cc
@@ -1034,14 +1034,13 @@
     ENSURE_VALID_ENV(env);
     art::Thread* art_thread = nullptr;
     if (event_thread != nullptr) {
-      // TODO: Need non-aborting call here, to return JVMTI_ERROR_INVALID_THREAD.
+      // TODO The locking around this call is less then what we really want.
       art::ScopedObjectAccess soa(art::Thread::Current());
       art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
-      art_thread = art::Thread::FromManagedThread(soa, event_thread);
-
-      if (art_thread == nullptr ||  // The thread hasn't been started or is already dead.
-          art_thread->IsStillStarting()) {
-        // TODO: We may want to let the EventHandler know, so it could clean up masks, potentially.
+      jvmtiError err = ERR(INTERNAL);
+      if (!ThreadUtil::GetAliveNativeThread(event_thread, soa, &art_thread, &err)) {
+        return err;
+      } else if (art_thread->IsStillStarting()) {
         return ERR(THREAD_NOT_ALIVE);
       }
     }
diff --git a/openjdkjvmti/ti_method.cc b/openjdkjvmti/ti_method.cc
index 62603aa..f05977a 100644
--- a/openjdkjvmti/ti_method.cc
+++ b/openjdkjvmti/ti_method.cc
@@ -86,20 +86,38 @@
 
 TiMethodCallback gMethodCallback;
 
+// TODO We should make this much more selective in the future so we only return true when we
+// actually care about the method (i.e. had locals changed, have breakpoints, etc.). For now though
+// we can just assume that we care we are loaded at all.
+//
+// Even if we don't keep track of this at the method level we might want to keep track of it at the
+// level of enabled capabilities.
+struct TiMethodInspectionCallback : public art::MethodInspectionCallback {
+  bool IsMethodBeingInspected(art::ArtMethod* method ATTRIBUTE_UNUSED)
+      OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    return true;
+  }
+};
+
+TiMethodInspectionCallback gMethodInspectionCallback;
+
 void MethodUtil::Register(EventHandler* handler) {
   gMethodCallback.event_handler = handler;
   art::ScopedThreadStateChange stsc(art::Thread::Current(),
                                     art::ThreadState::kWaitingForDebuggerToAttach);
   art::ScopedSuspendAll ssa("Add method callback");
-  art::Runtime::Current()->GetRuntimeCallbacks()->AddMethodCallback(&gMethodCallback);
+  art::RuntimeCallbacks* callbacks = art::Runtime::Current()->GetRuntimeCallbacks();
+  callbacks->AddMethodCallback(&gMethodCallback);
+  callbacks->AddMethodInspectionCallback(&gMethodInspectionCallback);
 }
 
 void MethodUtil::Unregister() {
   art::ScopedThreadStateChange stsc(art::Thread::Current(),
                                     art::ThreadState::kWaitingForDebuggerToAttach);
   art::ScopedSuspendAll ssa("Remove method callback");
-  art::Runtime* runtime = art::Runtime::Current();
-  runtime->GetRuntimeCallbacks()->RemoveMethodCallback(&gMethodCallback);
+  art::RuntimeCallbacks* callbacks = art::Runtime::Current()->GetRuntimeCallbacks();
+  callbacks->RemoveMethodCallback(&gMethodCallback);
+  callbacks->AddMethodInspectionCallback(&gMethodInspectionCallback);
 }
 
 jvmtiError MethodUtil::GetBytecodes(jvmtiEnv* env,
@@ -761,12 +779,10 @@
   art::jit::ScopedJitSuspend suspend_jit;
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = ThreadUtil::GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
   GetLocalVariableClosure c(self, depth, slot, type, val);
   if (!target->RequestSynchronousCheckpoint(&c)) {
@@ -890,12 +906,10 @@
   art::jit::ScopedJitSuspend suspend_jit;
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = ThreadUtil::GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
   SetLocalVariableClosure c(self, depth, slot, type, val);
   if (!target->RequestSynchronousCheckpoint(&c)) {
@@ -923,12 +937,6 @@
       result_ = ERR(NO_MORE_FRAMES);
       return;
     }
-    art::ArtMethod* method = visitor.GetMethod();
-    if (!visitor.IsShadowFrame() && !method->IsNative() && !method->IsProxyMethod()) {
-      // TODO We really should support get/set for non-shadow frames.
-      result_ = ERR(OPAQUE_FRAME);
-      return;
-    }
     result_ = OK;
     art::ObjPtr<art::mirror::Object> obj = visitor.GetThisObject();
     *val_ = obj.IsNull() ? nullptr : caller_->GetJniEnv()->AddLocalReference<jobject>(obj);
@@ -955,12 +963,10 @@
   art::Thread* self = art::Thread::Current();
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = ThreadUtil::GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
   GetLocalInstanceClosure c(self, depth, data);
   if (!target->RequestSynchronousCheckpoint(&c)) {
diff --git a/openjdkjvmti/ti_monitor.cc b/openjdkjvmti/ti_monitor.cc
index f92d81e..5a38f46 100644
--- a/openjdkjvmti/ti_monitor.cc
+++ b/openjdkjvmti/ti_monitor.cc
@@ -335,12 +335,10 @@
   art::Thread* self = art::Thread::Current();
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = ThreadUtil::GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
   struct GetContendedMonitorClosure : public art::Closure {
    public:
@@ -395,7 +393,9 @@
     jobject* out_;
   };
   GetContendedMonitorClosure closure(self, monitor);
-  target->RequestSynchronousCheckpoint(&closure);
+  if (!target->RequestSynchronousCheckpoint(&closure)) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
   return OK;
 }
 
diff --git a/openjdkjvmti/ti_stack.cc b/openjdkjvmti/ti_stack.cc
index 699f695..d4cc42a 100644
--- a/openjdkjvmti/ti_stack.cc
+++ b/openjdkjvmti/ti_stack.cc
@@ -211,34 +211,6 @@
   size_t index = 0;
 };
 
-static jvmtiError GetThread(JNIEnv* env,
-                            art::ScopedObjectAccessAlreadyRunnable& soa,
-                            jthread java_thread,
-                            art::Thread** thread)
-    REQUIRES_SHARED(art::Locks::mutator_lock_)  // Needed for FromManagedThread.
-    REQUIRES(art::Locks::thread_list_lock_) {   // Needed for FromManagedThread.
-  if (java_thread == nullptr) {
-    *thread = art::Thread::Current();
-    if (*thread == nullptr) {
-      // GetStackTrace can only be run during the live phase, so the current thread should be
-      // attached and thus available. Getting a null for current means we're starting up or
-      // dying.
-      return ERR(WRONG_PHASE);
-    }
-  } else {
-    if (!env->IsInstanceOf(java_thread, art::WellKnownClasses::java_lang_Thread)) {
-      return ERR(INVALID_THREAD);
-    }
-
-    // TODO: Need non-aborting call here, to return JVMTI_ERROR_INVALID_THREAD.
-    *thread = art::Thread::FromManagedThread(soa, java_thread);
-    if (*thread == nullptr) {
-      return ERR(THREAD_NOT_ALIVE);
-    }
-  }
-  return ERR(NONE);
-}
-
 jvmtiError StackUtil::GetStackTrace(jvmtiEnv* jvmti_env ATTRIBUTE_UNUSED,
                                     jthread java_thread,
                                     jint start_depth,
@@ -251,19 +223,14 @@
   art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
 
   art::Thread* thread;
-  jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(),
-                                      soa,
-                                      java_thread,
-                                      &thread);
-  if (thread_error != ERR(NONE)) {
+  jvmtiError thread_error = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(java_thread, soa, &thread, &thread_error)) {
     return thread_error;
   }
   DCHECK(thread != nullptr);
 
   art::ThreadState state = thread->GetState();
-  if (state == art::ThreadState::kStarting ||
-      state == art::ThreadState::kTerminated ||
-      thread->IsStillStarting()) {
+  if (state == art::ThreadState::kStarting || thread->IsStillStarting()) {
     return ERR(THREAD_NOT_ALIVE);
   }
 
@@ -714,22 +681,25 @@
   art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
 
   art::Thread* thread;
-  jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(),
-                                      soa,
-                                      java_thread,
-                                      &thread);
-
-  if (thread_error != ERR(NONE)) {
+  jvmtiError thread_error = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(java_thread, soa, &thread, &thread_error)) {
     return thread_error;
   }
+
   DCHECK(thread != nullptr);
+  art::ThreadState state = thread->GetState();
+  if (state == art::ThreadState::kStarting || thread->IsStillStarting()) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
 
   if (count_ptr == nullptr) {
     return ERR(NULL_POINTER);
   }
 
   GetFrameCountClosure closure;
-  thread->RequestSynchronousCheckpoint(&closure);
+  if (!thread->RequestSynchronousCheckpoint(&closure)) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
 
   *count_ptr = closure.count;
   return ERR(NONE);
@@ -793,15 +763,17 @@
   art::MutexLock mu(soa.Self(), *art::Locks::thread_list_lock_);
 
   art::Thread* thread;
-  jvmtiError thread_error = GetThread(art::Thread::Current()->GetJniEnv(),
-                                      soa,
-                                      java_thread,
-                                      &thread);
-  if (thread_error != ERR(NONE)) {
+  jvmtiError thread_error = ERR(INTERNAL);
+  if (!ThreadUtil::GetAliveNativeThread(java_thread, soa, &thread, &thread_error)) {
     return thread_error;
   }
   DCHECK(thread != nullptr);
 
+  art::ThreadState state = thread->GetState();
+  if (state == art::ThreadState::kStarting || thread->IsStillStarting()) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
+
   if (depth < 0) {
     return ERR(ILLEGAL_ARGUMENT);
   }
@@ -920,12 +892,10 @@
   bool called_method = false;
   {
     art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-    art::Thread* target = ThreadUtil::GetNativeThread(thread, soa);
-    if (target == nullptr && thread == nullptr) {
-      return ERR(INVALID_THREAD);
-    }
-    if (target == nullptr) {
-      return ERR(THREAD_NOT_ALIVE);
+    art::Thread* target = nullptr;
+    jvmtiError err = ERR(INTERNAL);
+    if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+      return err;
     }
     if (target != self) {
       called_method = true;
@@ -1014,10 +984,11 @@
     // have the 'suspend_lock' locked here.
     art::ScopedObjectAccess soa(self);
     art::MutexLock tll_mu(self, *art::Locks::thread_list_lock_);
-    target = ThreadUtil::GetNativeThread(thread, soa);
-    if (target == nullptr) {
-      return ERR(THREAD_NOT_ALIVE);
-    } else if (target != self) {
+    jvmtiError err = ERR(INTERNAL);
+    if (!ThreadUtil::GetAliveNativeThread(thread, soa, &target, &err)) {
+      return err;
+    }
+    if (target != self) {
       // TODO This is part of the spec but we could easily avoid needing to do it. We would just put
       // all the logic into a sync-checkpoint.
       art::MutexLock tscl_mu(self, *art::Locks::thread_suspend_count_lock_);
diff --git a/openjdkjvmti/ti_thread.cc b/openjdkjvmti/ti_thread.cc
index d437e52..907b515 100644
--- a/openjdkjvmti/ti_thread.cc
+++ b/openjdkjvmti/ti_thread.cc
@@ -161,13 +161,34 @@
 }
 
 // Get the native thread. The spec says a null object denotes the current thread.
-art::Thread* ThreadUtil::GetNativeThread(jthread thread,
-                                         const art::ScopedObjectAccessAlreadyRunnable& soa) {
+bool ThreadUtil::GetNativeThread(jthread thread,
+                                 const art::ScopedObjectAccessAlreadyRunnable& soa,
+                                 /*out*/ art::Thread** thr,
+                                 /*out*/ jvmtiError* err) {
   if (thread == nullptr) {
-    return art::Thread::Current();
+    *thr = art::Thread::Current();
+    return true;
+  } else if (!soa.Env()->IsInstanceOf(thread, art::WellKnownClasses::java_lang_Thread)) {
+    *err = ERR(INVALID_THREAD);
+    return false;
+  } else {
+    *thr = art::Thread::FromManagedThread(soa, thread);
+    return true;
   }
+}
 
-  return art::Thread::FromManagedThread(soa, thread);
+bool ThreadUtil::GetAliveNativeThread(jthread thread,
+                                      const art::ScopedObjectAccessAlreadyRunnable& soa,
+                                      /*out*/ art::Thread** thr,
+                                      /*out*/ jvmtiError* err) {
+  if (!GetNativeThread(thread, soa, thr, err)) {
+    return false;
+  } else if (*thr == nullptr || (*thr)->GetState() == art::ThreadState::kTerminated) {
+    *err = ERR(THREAD_NOT_ALIVE);
+    return false;
+  } else {
+    return true;
+  }
 }
 
 jvmtiError ThreadUtil::GetThreadInfo(jvmtiEnv* env, jthread thread, jvmtiThreadInfo* info_ptr) {
@@ -182,9 +203,10 @@
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
 
-  art::Thread* target = GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
+  art::Thread* target;
+  jvmtiError err = ERR(INTERNAL);
+  if (!GetNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
 
   JvmtiUniquePtr<char[]> name_uptr;
@@ -297,25 +319,18 @@
 };
 
 // Return the thread's (or current thread, if null) thread state.
-static InternalThreadState GetNativeThreadState(jthread thread,
-                                                const art::ScopedObjectAccessAlreadyRunnable& soa)
+static InternalThreadState GetNativeThreadState(art::Thread* target)
     REQUIRES_SHARED(art::Locks::mutator_lock_)
     REQUIRES(art::Locks::thread_list_lock_, art::Locks::user_code_suspension_lock_) {
-  art::Thread* self = nullptr;
-  if (thread == nullptr) {
-    self = art::Thread::Current();
-  } else {
-    self = art::Thread::FromManagedThread(soa, thread);
-  }
   InternalThreadState thread_state = {};
-  art::MutexLock tscl_mu(soa.Self(), *art::Locks::thread_suspend_count_lock_);
-  thread_state.native_thread = self;
-  if (self == nullptr || self->IsStillStarting()) {
+  art::MutexLock tscl_mu(art::Thread::Current(), *art::Locks::thread_suspend_count_lock_);
+  thread_state.native_thread = target;
+  if (target == nullptr || target->IsStillStarting()) {
     thread_state.art_state = art::ThreadState::kStarting;
     thread_state.thread_user_code_suspend_count = 0;
   } else {
-    thread_state.art_state = self->GetState();
-    thread_state.thread_user_code_suspend_count = self->GetUserCodeSuspendCount();
+    thread_state.art_state = target->GetState();
+    thread_state.thread_user_code_suspend_count = target->GetUserCodeSuspendCount();
   }
   return thread_state;
 }
@@ -456,7 +471,12 @@
     }
     art::ScopedObjectAccess soa(self);
     art::MutexLock tll_mu(self, *art::Locks::thread_list_lock_);
-    state = GetNativeThreadState(thread, soa);
+    jvmtiError err = ERR(INTERNAL);
+    art::Thread* target = nullptr;
+    if (!GetNativeThread(thread, soa, &target, &err)) {
+      return err;
+    }
+    state = GetNativeThreadState(target);
     if (state.art_state == art::ThreadState::kStarting) {
       break;
     }
@@ -484,13 +504,18 @@
   }
 
   art::ScopedObjectAccess soa(self);
+  art::StackHandleScope<1> hs(self);
 
   // Need to read the Java "started" field to know whether this is starting or terminated.
-  art::ObjPtr<art::mirror::Object> peer = soa.Decode<art::mirror::Object>(thread);
-  art::ObjPtr<art::mirror::Class> klass = peer->GetClass();
-  art::ArtField* started_field = klass->FindDeclaredInstanceField("started", "Z");
+  art::Handle<art::mirror::Object> peer(hs.NewHandle(soa.Decode<art::mirror::Object>(thread)));
+  art::ObjPtr<art::mirror::Class> thread_klass =
+      soa.Decode<art::mirror::Class>(art::WellKnownClasses::java_lang_Thread);
+  if (!thread_klass->IsAssignableFrom(peer->GetClass())) {
+    return ERR(INVALID_THREAD);
+  }
+  art::ArtField* started_field = thread_klass->FindDeclaredInstanceField("started", "Z");
   CHECK(started_field != nullptr);
-  bool started = started_field->GetBoolean(peer) != 0;
+  bool started = started_field->GetBoolean(peer.Get()) != 0;
   constexpr jint kStartedState = JVMTI_JAVA_LANG_THREAD_STATE_NEW;
   constexpr jint kTerminatedState = JVMTI_THREAD_STATE_TERMINATED |
                                     JVMTI_JAVA_LANG_THREAD_STATE_TERMINATED;
@@ -573,12 +598,10 @@
   art::Thread* self = art::Thread::Current();
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
 
   JvmtiGlobalTLSData* global_tls = reinterpret_cast<JvmtiGlobalTLSData*>(target->GetCustomTLS());
@@ -602,12 +625,10 @@
   art::Thread* self = art::Thread::Current();
   art::ScopedObjectAccess soa(self);
   art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-  art::Thread* target = GetNativeThread(thread, soa);
-  if (target == nullptr && thread == nullptr) {
-    return ERR(INVALID_THREAD);
-  }
-  if (target == nullptr) {
-    return ERR(THREAD_NOT_ALIVE);
+  art::Thread* target = nullptr;
+  jvmtiError err = ERR(INTERNAL);
+  if (!GetAliveNativeThread(thread, soa, &target, &err)) {
+    return err;
   }
 
   JvmtiGlobalTLSData* global_tls = reinterpret_cast<JvmtiGlobalTLSData*>(target->GetCustomTLS());
@@ -726,9 +747,13 @@
     {
       art::ScopedObjectAccess soa(self);
       art::MutexLock thread_list_mu(self, *art::Locks::thread_list_lock_);
-      art::Thread* target = GetNativeThread(target_jthread, soa);
+      art::Thread* target = nullptr;
+      jvmtiError err = ERR(INTERNAL);
+      if (!GetAliveNativeThread(target_jthread, soa, &target, &err)) {
+        return err;
+      }
       art::ThreadState state = target->GetState();
-      if (state == art::ThreadState::kTerminated || state == art::ThreadState::kStarting) {
+      if (state == art::ThreadState::kStarting || target->IsStillStarting()) {
         return ERR(THREAD_NOT_ALIVE);
       } else {
         art::MutexLock thread_suspend_count_mu(self, *art::Locks::thread_suspend_count_lock_);
@@ -784,9 +809,10 @@
   {
     art::ScopedObjectAccess soa(self);
     art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-    art::Thread* target = GetNativeThread(thread, soa);
-    if (target == nullptr) {
-      return ERR(INVALID_THREAD);
+    art::Thread* target = nullptr;
+    jvmtiError err = ERR(INTERNAL);
+    if (!GetAliveNativeThread(thread, soa, &target, &err)) {
+      return err;
     } else if (target == self) {
       target_is_self = true;
     }
@@ -820,16 +846,14 @@
       // have the 'suspend_lock' locked here.
       art::ScopedObjectAccess soa(self);
       art::MutexLock tll_mu(self, *art::Locks::thread_list_lock_);
-      target = GetNativeThread(thread, soa);
-      if (target == nullptr) {
-        return ERR(INVALID_THREAD);
+      jvmtiError err = ERR(INTERNAL);
+      if (!GetAliveNativeThread(thread, soa, &target, &err)) {
+        return err;
       } else if (target == self) {
         // We would have paused until we aren't suspended anymore due to the ScopedObjectAccess so
         // we can just return THREAD_NOT_SUSPENDED. Unfortunately we cannot do any real DCHECKs
         // about current state since it's all concurrent.
         return ERR(THREAD_NOT_SUSPENDED);
-      } else if (target->GetState() == art::ThreadState::kTerminated) {
-        return ERR(THREAD_NOT_ALIVE);
       }
       // The JVMTI spec requires us to return THREAD_NOT_SUSPENDED if it is alive but we really
       // cannot tell why resume failed.
@@ -854,6 +878,22 @@
   } while (true);
 }
 
+static bool IsCurrentThread(jthread thr) {
+  if (thr == nullptr) {
+    return true;
+  }
+  art::Thread* self = art::Thread::Current();
+  art::ScopedObjectAccess soa(self);
+  art::MutexLock mu(self, *art::Locks::thread_list_lock_);
+  art::Thread* target = nullptr;
+  jvmtiError err_unused = ERR(INTERNAL);
+  if (ThreadUtil::GetNativeThread(thr, soa, &target, &err_unused)) {
+    return target == self;
+  } else {
+    return false;
+  }
+}
+
 // Suspends all the threads in the list at the same time. Getting this behavior is a little tricky
 // since we can have threads in the list multiple times. This generally doesn't matter unless the
 // current thread is present multiple times. In that case we need to suspend only once and either
@@ -873,17 +913,12 @@
   // running thread. These indexes we need to handle specially since we need to only actually
   // suspend a single time.
   std::vector<jint> current_thread_indexes;
-  art::Thread* self = art::Thread::Current();
   for (jint i = 0; i < request_count; i++) {
-    {
-      art::ScopedObjectAccess soa(self);
-      art::MutexLock mu(self, *art::Locks::thread_list_lock_);
-      if (threads[i] == nullptr || GetNativeThread(threads[i], soa) == self) {
-        current_thread_indexes.push_back(i);
-        continue;
-      }
+    if (IsCurrentThread(threads[i])) {
+      current_thread_indexes.push_back(i);
+    } else {
+      results[i] = env->SuspendThread(threads[i]);
     }
-    results[i] = env->SuspendThread(threads[i]);
   }
   if (!current_thread_indexes.empty()) {
     jint first_current_thread_index = current_thread_indexes[0];
diff --git a/openjdkjvmti/ti_thread.h b/openjdkjvmti/ti_thread.h
index 57b1943..ceebff6 100644
--- a/openjdkjvmti/ti_thread.h
+++ b/openjdkjvmti/ti_thread.h
@@ -93,8 +93,24 @@
                                      const jthread* threads,
                                      jvmtiError* results);
 
-  static art::Thread* GetNativeThread(jthread thread,
-                                      const art::ScopedObjectAccessAlreadyRunnable& soa)
+  // Returns true if we decoded the thread and it is alive, false otherwise with an appropriate
+  // error placed into 'err'. A thread is alive if it has had it's 'start' function called and has
+  // (or at least could have) executed managed code and has not yet returned past it's first managed
+  // frame. This means that the thread returned might have IsStillStarting() return true. Code that
+  // does not consider that alive should check manually.
+  static bool GetAliveNativeThread(jthread thread,
+                                   const art::ScopedObjectAccessAlreadyRunnable& soa,
+                                   /*out*/ art::Thread** thr,
+                                   /*out*/ jvmtiError* err)
+      REQUIRES_SHARED(art::Locks::mutator_lock_)
+      REQUIRES(art::Locks::thread_list_lock_);
+
+  // Returns true if we decoded the thread, false otherwise with an appropriate error placed into
+  // 'err'
+  static bool GetNativeThread(jthread thread,
+                              const art::ScopedObjectAccessAlreadyRunnable& soa,
+                              /*out*/ art::Thread** thr,
+                              /*out*/ jvmtiError* err)
       REQUIRES_SHARED(art::Locks::mutator_lock_)
       REQUIRES(art::Locks::thread_list_lock_);
 
diff --git a/profman/profile_assistant.cc b/profman/profile_assistant.cc
index c238f0d..ff02b5d 100644
--- a/profman/profile_assistant.cc
+++ b/profman/profile_assistant.cc
@@ -23,8 +23,11 @@
 
 // Minimum number of new methods/classes that profiles
 // must contain to enable recompilation.
-static constexpr const uint32_t kMinNewMethodsForCompilation = 10;
-static constexpr const uint32_t kMinNewClassesForCompilation = 10;
+static constexpr const uint32_t kMinNewMethodsForCompilation = 100;
+static constexpr const uint32_t kMinNewMethodsPercentChangeForCompilation = 2;
+static constexpr const uint32_t kMinNewClassesForCompilation = 50;
+static constexpr const uint32_t kMinNewClassesPercentChangeForCompilation = 2;
+
 
 ProfileAssistant::ProcessingResult ProfileAssistant::ProcessProfilesInternal(
         const std::vector<ScopedFlock>& profile_files,
@@ -55,9 +58,16 @@
     }
   }
 
+  uint32_t min_change_in_methods_for_compilation = std::max(
+      (kMinNewMethodsPercentChangeForCompilation * number_of_methods) / 100,
+      kMinNewMethodsForCompilation);
+  uint32_t min_change_in_classes_for_compilation = std::max(
+      (kMinNewClassesPercentChangeForCompilation * number_of_classes) / 100,
+      kMinNewClassesForCompilation);
   // Check if there is enough new information added by the current profiles.
-  if (((info.GetNumberOfMethods() - number_of_methods) < kMinNewMethodsForCompilation) &&
-      ((info.GetNumberOfResolvedClasses() - number_of_classes) < kMinNewClassesForCompilation)) {
+  if (((info.GetNumberOfMethods() - number_of_methods) < min_change_in_methods_for_compilation) &&
+      ((info.GetNumberOfResolvedClasses() - number_of_classes)
+          < min_change_in_classes_for_compilation)) {
     return kSkipCompilation;
   }
 
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index 8cbf8c3..73724b2 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -335,6 +335,46 @@
     ASSERT_EQ(expected_clases.size(), found);
   }
 
+  int CheckCompilationMethodPercentChange(uint16_t methods_in_cur_profile,
+                                          uint16_t methods_in_ref_profile) {
+    ScratchFile profile;
+    ScratchFile reference_profile;
+    std::vector<int> profile_fds({ GetFd(profile)});
+    int reference_profile_fd = GetFd(reference_profile);
+    std::vector<uint32_t> hot_methods_cur;
+    std::vector<uint32_t> hot_methods_ref;
+    std::vector<uint32_t> empty_vector;
+    for (size_t i = 0; i < methods_in_cur_profile; ++i) {
+      hot_methods_cur.push_back(i);
+    }
+    for (size_t i = 0; i < methods_in_ref_profile; ++i) {
+      hot_methods_ref.push_back(i);
+    }
+    ProfileCompilationInfo info1;
+    uint16_t methods_in_profile = std::max(methods_in_cur_profile, methods_in_ref_profile);
+    SetupBasicProfile("p1", 1, methods_in_profile, hot_methods_cur, empty_vector, empty_vector,
+        profile,  &info1);
+    ProfileCompilationInfo info2;
+    SetupBasicProfile("p1", 1, methods_in_profile, hot_methods_ref, empty_vector, empty_vector,
+        reference_profile,  &info2);
+    return ProcessProfiles(profile_fds, reference_profile_fd);
+  }
+
+  int CheckCompilationClassPercentChange(uint16_t classes_in_cur_profile,
+                                         uint16_t classes_in_ref_profile) {
+    ScratchFile profile;
+    ScratchFile reference_profile;
+
+    std::vector<int> profile_fds({ GetFd(profile)});
+    int reference_profile_fd = GetFd(reference_profile);
+
+    ProfileCompilationInfo info1;
+    SetupProfile("p1", 1, 0, classes_in_cur_profile, profile,  &info1);
+    ProfileCompilationInfo info2;
+    SetupProfile("p1", 1, 0, classes_in_ref_profile, reference_profile, &info2);
+    return ProcessProfiles(profile_fds, reference_profile_fd);
+  }
+
   std::unique_ptr<ArenaAllocator> arena_;
 
   // Cache of inline caches generated during tests.
@@ -460,7 +500,7 @@
       GetFd(profile2)});
   int reference_profile_fd = GetFd(reference_profile);
 
-  const uint16_t kNumberOfMethodsToSkipCompilation = 1;
+  const uint16_t kNumberOfMethodsToSkipCompilation = 24;  // Threshold is 100.
   ProfileCompilationInfo info1;
   SetupProfile("p1", 1, kNumberOfMethodsToSkipCompilation, 0, profile1, &info1);
   ProfileCompilationInfo info2;
@@ -489,6 +529,42 @@
   CheckProfileInfo(profile2, info2);
 }
 
+TEST_F(ProfileAssistantTest, DoNotAdviseCompilationMethodPercentage) {
+  const uint16_t kNumberOfMethodsInRefProfile = 6000;
+  const uint16_t kNumberOfMethodsInCurProfile = 6100;  // Threshold is 2%.
+  // We should not advise compilation.
+  ASSERT_EQ(ProfileAssistant::kSkipCompilation,
+            CheckCompilationMethodPercentChange(kNumberOfMethodsInCurProfile,
+                                                kNumberOfMethodsInRefProfile));
+}
+
+TEST_F(ProfileAssistantTest, ShouldAdviseCompilationMethodPercentage) {
+  const uint16_t kNumberOfMethodsInRefProfile = 6000;
+  const uint16_t kNumberOfMethodsInCurProfile = 6200;  // Threshold is 2%.
+  // We should advise compilation.
+  ASSERT_EQ(ProfileAssistant::kCompile,
+            CheckCompilationMethodPercentChange(kNumberOfMethodsInCurProfile,
+                                                kNumberOfMethodsInRefProfile));
+}
+
+TEST_F(ProfileAssistantTest, DoNotdviseCompilationClassPercentage) {
+  const uint16_t kNumberOfClassesInRefProfile = 6000;
+  const uint16_t kNumberOfClassesInCurProfile = 6110;  // Threshold is 2%.
+  // We should not advise compilation.
+  ASSERT_EQ(ProfileAssistant::kSkipCompilation,
+            CheckCompilationClassPercentChange(kNumberOfClassesInCurProfile,
+                                               kNumberOfClassesInRefProfile));
+}
+
+TEST_F(ProfileAssistantTest, ShouldAdviseCompilationClassPercentage) {
+  const uint16_t kNumberOfClassesInRefProfile = 6000;
+  const uint16_t kNumberOfClassesInCurProfile = 6120;  // Threshold is 2%.
+  // We should advise compilation.
+  ASSERT_EQ(ProfileAssistant::kCompile,
+            CheckCompilationClassPercentChange(kNumberOfClassesInCurProfile,
+                                               kNumberOfClassesInRefProfile));
+}
+
 TEST_F(ProfileAssistantTest, FailProcessingBecauseOfProfiles) {
   ScratchFile profile1;
   ScratchFile profile2;
diff --git a/runtime/Android.bp b/runtime/Android.bp
index db9707f..711bc65 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -356,10 +356,9 @@
                 "thread_android.cc",
             ],
             shared_libs: [
-                "libdl",
                 // For android::FileMap used by libziparchive.
                 "libutils",
-                "libtombstoned_client"
+                "libtombstoned_client",
             ],
             static_libs: [
                 // ZipArchive support, the order matters here to get all symbols.
@@ -388,7 +387,7 @@
             ],
             shared_libs: [
                 "libziparchive",
-                "libz-host",
+                "libz",
             ],
         },
     },
@@ -398,7 +397,6 @@
     generated_headers: ["cpp-define-generator-asm-support"],
     // export our headers so the libart-gtest targets can use it as well.
     export_generated_headers: ["cpp-define-generator-asm-support"],
-    clang: true,
     include_dirs: [
         "art/sigchainlib",
         "art",
@@ -493,8 +491,8 @@
 art_cc_library {
     name: "libartd",
     defaults: [
-       "art_debug_defaults",
-       "libart_defaults",
+        "art_debug_defaults",
+        "libart_defaults",
     ],
 }
 
@@ -503,12 +501,12 @@
     defaults: ["libart-gtest-defaults"],
     srcs: [
         "common_runtime_test.cc",
-        "dexopt_test.cc"
+        "dexopt_test.cc",
     ],
     shared_libs: [
         "libartd",
         "libbase",
-        "libbacktrace"
+        "libbacktrace",
     ],
 }
 
@@ -555,7 +553,6 @@
         "dex_file_test.cc",
         "dex_file_verifier_test.cc",
         "dex_instruction_test.cc",
-        "dex_method_iterator_test.cc",
         "entrypoints/math_entrypoints_test.cc",
         "entrypoints/quick/quick_trampoline_entrypoints_test.cc",
         "entrypoints_order_test.cc",
@@ -614,7 +611,7 @@
         "libbacktrace",
     ],
     header_libs: [
-        "art_cmdlineparser_headers",  // For parsed_options_test.
+        "art_cmdlineparser_headers", // For parsed_options_test.
     ],
 }
 
@@ -636,7 +633,7 @@
 }
 
 cc_library_headers {
-  name: "libart_runtime_headers",
-  host_supported: true,
-  export_include_dirs: ["."],
+    name: "libart_runtime_headers",
+    host_supported: true,
+    export_include_dirs: ["."],
 }
diff --git a/runtime/base/unix_file/fd_file.cc b/runtime/base/unix_file/fd_file.cc
index eb8ced0..6d1de00 100644
--- a/runtime/base/unix_file/fd_file.cc
+++ b/runtime/base/unix_file/fd_file.cc
@@ -70,7 +70,7 @@
     if (guard_state_ < GuardState::kClosed) {
       LOG(ERROR) << "File " << file_path_ << " wasn't explicitly closed before destruction.";
     }
-    CHECK_GE(guard_state_, GuardState::kClosed);
+    DCHECK_GE(guard_state_, GuardState::kClosed);
   }
   if (auto_close_ && fd_ != -1) {
     if (Close() != 0) {
@@ -135,7 +135,7 @@
 
 bool FdFile::Open(const std::string& path, int flags, mode_t mode) {
   static_assert(O_RDONLY == 0, "Readonly flag has unexpected value.");
-  CHECK_EQ(fd_, -1) << path;
+  DCHECK_EQ(fd_, -1) << path;
   read_only_mode_ = ((flags & O_ACCMODE) == O_RDONLY);
   fd_ = TEMP_FAILURE_RETRY(open(path.c_str(), flags, mode));
   if (fd_ == -1) {
@@ -158,7 +158,7 @@
 
   // Test here, so the file is closed and not leaked.
   if (kCheckSafeUsage) {
-    CHECK_GE(guard_state_, GuardState::kFlushed) << "File " << file_path_
+    DCHECK_GE(guard_state_, GuardState::kFlushed) << "File " << file_path_
         << " has not been flushed before closing.";
     moveUp(GuardState::kClosed, nullptr);
   }
diff --git a/runtime/class_loader_context.cc b/runtime/class_loader_context.cc
index 3bd4596..2282da0 100644
--- a/runtime/class_loader_context.cc
+++ b/runtime/class_loader_context.cc
@@ -220,7 +220,7 @@
         // If we can't get the realpath of the location there might be something wrong with the
         // classpath (maybe the file was deleted).
         // Do not continue in this case and return false.
-        PLOG(ERROR) << "Could not get the realpath of dex location " << raw_location;
+        PLOG(WARNING) << "Could not get the realpath of dex location " << raw_location;
         return false;
       }
 
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index 6daec72..b021ff1 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -324,6 +324,7 @@
 bool Dbg::gDebuggerActive = false;
 bool Dbg::gDisposed = false;
 ObjectRegistry* Dbg::gRegistry = nullptr;
+DebuggerActiveMethodInspectionCallback Dbg::gDebugActiveCallback;
 
 // Deoptimization support.
 std::vector<DeoptimizationRequest> Dbg::deoptimization_requests_;
@@ -341,6 +342,10 @@
 Dbg::DbgThreadLifecycleCallback Dbg::thread_lifecycle_callback_;
 Dbg::DbgClassLoadCallback Dbg::class_load_callback_;
 
+bool DebuggerActiveMethodInspectionCallback::IsMethodBeingInspected(ArtMethod* m ATTRIBUTE_UNUSED) {
+  return Dbg::IsDebuggerActive();
+}
+
 // Breakpoints.
 static std::vector<Breakpoint> gBreakpoints GUARDED_BY(Locks::breakpoint_lock_);
 
@@ -652,6 +657,7 @@
   }
   instrumentation_events_ = 0;
   gDebuggerActive = true;
+  Runtime::Current()->GetRuntimeCallbacks()->AddMethodInspectionCallback(&gDebugActiveCallback);
   LOG(INFO) << "Debugger is active";
 }
 
@@ -689,6 +695,8 @@
         runtime->GetInstrumentation()->DisableDeoptimization(kDbgInstrumentationKey);
       }
       gDebuggerActive = false;
+      Runtime::Current()->GetRuntimeCallbacks()->RemoveMethodInspectionCallback(
+          &gDebugActiveCallback);
     }
   }
 
diff --git a/runtime/debugger.h b/runtime/debugger.h
index 0be46d6..18126b1 100644
--- a/runtime/debugger.h
+++ b/runtime/debugger.h
@@ -34,6 +34,7 @@
 #include "jni.h"
 #include "jvalue.h"
 #include "obj_ptr.h"
+#include "runtime_callbacks.h"
 #include "thread.h"
 #include "thread_state.h"
 
@@ -51,6 +52,12 @@
 class StackVisitor;
 class Thread;
 
+struct DebuggerActiveMethodInspectionCallback : public MethodInspectionCallback {
+  bool IsMethodBeingInspected(ArtMethod* m ATTRIBUTE_UNUSED)
+      OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+};
+
+
 /*
  * Invoke-during-breakpoint support.
  */
@@ -773,6 +780,8 @@
   // Indicates whether the debugger is making requests.
   static bool gDebuggerActive;
 
+  static DebuggerActiveMethodInspectionCallback gDebugActiveCallback;
+
   // Indicates whether we should drop the JDWP connection because the runtime stops or the
   // debugger called VirtualMachine.Dispose.
   static bool gDisposed;
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index 4807427..ac91d52 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -21,9 +21,11 @@
 #include <string>
 #include <vector>
 
+#include "base/iteration_range.h"
 #include "base/logging.h"
 #include "base/value_object.h"
 #include "dex_file_types.h"
+#include "dex_instruction_iterator.h"
 #include "globals.h"
 #include "jni.h"
 #include "modifiers.h"
@@ -293,6 +295,15 @@
 
   // Raw code_item.
   struct CodeItem {
+    IterationRange<DexInstructionIterator> Instructions() const {
+      return { DexInstructionIterator(insns_),
+               DexInstructionIterator(insns_ + insns_size_in_code_units_)};
+    }
+
+    const Instruction& InstructionAt(uint32_t dex_pc) const {
+      return *Instruction::At(insns_ + dex_pc);
+    }
+
     uint16_t registers_size_;            // the number of registers used by this code
                                          //   (locals + parameters)
     uint16_t ins_size_;                  // the number of words of incoming arguments to the method
diff --git a/runtime/dex_instruction_iterator.h b/runtime/dex_instruction_iterator.h
new file mode 100644
index 0000000..280746e
--- /dev/null
+++ b/runtime/dex_instruction_iterator.h
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_DEX_INSTRUCTION_ITERATOR_H_
+#define ART_RUNTIME_DEX_INSTRUCTION_ITERATOR_H_
+
+#include <iterator>
+
+#include "dex_instruction.h"
+#include "base/logging.h"
+
+namespace art {
+
+class DexInstructionIterator : public std::iterator<std::forward_iterator_tag, Instruction> {
+ public:
+  using value_type = std::iterator<std::forward_iterator_tag, Instruction>::value_type;
+  using difference_type = std::iterator<std::forward_iterator_tag, value_type>::difference_type;
+
+  DexInstructionIterator() = default;
+  DexInstructionIterator(const DexInstructionIterator&) = default;
+  DexInstructionIterator(DexInstructionIterator&&) = default;
+  DexInstructionIterator& operator=(const DexInstructionIterator&) = default;
+  DexInstructionIterator& operator=(DexInstructionIterator&&) = default;
+
+  explicit DexInstructionIterator(const value_type* inst) : inst_(inst) {}
+  explicit DexInstructionIterator(const uint16_t* inst) : inst_(value_type::At(inst)) {}
+
+  // Value after modification.
+  DexInstructionIterator& operator++() {
+    inst_ = inst_->Next();
+    return *this;
+  }
+
+  // Value before modification.
+  DexInstructionIterator operator++(int) {
+    DexInstructionIterator temp = *this;
+    ++*this;
+    return temp;
+  }
+
+  const value_type& operator*() const {
+    return *inst_;
+  }
+
+  const value_type* operator->() const {
+    return &**this;
+  }
+
+  // Return the dex pc for an iterator compared to the code item begin.
+  uint32_t GetDexPC(const DexInstructionIterator& code_item_begin) {
+    return reinterpret_cast<const uint16_t*>(inst_) -
+        reinterpret_cast<const uint16_t*>(code_item_begin.inst_);
+  }
+
+  const value_type* Inst() const {
+    return inst_;
+  }
+
+ private:
+  const value_type* inst_ = nullptr;
+};
+
+static ALWAYS_INLINE inline bool operator==(const DexInstructionIterator& lhs,
+                                            const DexInstructionIterator& rhs) {
+  return lhs.Inst() == rhs.Inst();
+}
+
+static inline bool operator!=(const DexInstructionIterator& lhs,
+                              const DexInstructionIterator& rhs) {
+  return !(lhs == rhs);
+}
+
+static inline bool operator<(const DexInstructionIterator& lhs,
+                             const DexInstructionIterator& rhs) {
+  return lhs.Inst() < rhs.Inst();
+}
+
+static inline bool operator>(const DexInstructionIterator& lhs,
+                             const DexInstructionIterator& rhs) {
+  return rhs < lhs;
+}
+
+static inline bool operator<=(const DexInstructionIterator& lhs,
+                              const DexInstructionIterator& rhs) {
+  return !(rhs < lhs);
+}
+
+static inline bool operator>=(const DexInstructionIterator& lhs,
+                              const DexInstructionIterator& rhs) {
+  return !(lhs < rhs);
+}
+
+}  // namespace art
+
+#endif  // ART_RUNTIME_DEX_INSTRUCTION_ITERATOR_H_
diff --git a/runtime/dex_instruction_test.cc b/runtime/dex_instruction_test.cc
index 3f7ac57..48ed027 100644
--- a/runtime/dex_instruction_test.cc
+++ b/runtime/dex_instruction_test.cc
@@ -15,6 +15,7 @@
  */
 
 #include "dex_instruction-inl.h"
+#include "dex_instruction_iterator.h"
 #include "gtest/gtest.h"
 
 namespace art {
@@ -73,7 +74,7 @@
   Build45cc(4u /* num_vregs */, 16u /* method_idx */, 32u /* proto_idx */,
             0xcafe /* arg_regs */, instruction);
 
-  const Instruction* ins = Instruction::At(instruction);
+  DexInstructionIterator ins(instruction);
   ASSERT_EQ(4u, ins->SizeInCodeUnits());
 
   ASSERT_TRUE(ins->HasVRegA());
@@ -108,7 +109,7 @@
   Build4rcc(4u /* num_vregs */, 16u /* method_idx */, 32u /* proto_idx */,
             0xcafe /* arg_regs */, instruction);
 
-  const Instruction* ins = Instruction::At(instruction);
+  DexInstructionIterator ins(instruction);
   ASSERT_EQ(4u, ins->SizeInCodeUnits());
 
   ASSERT_TRUE(ins->HasVRegA());
@@ -154,7 +155,7 @@
                                std::vector<uint16_t> args) {
   uint16_t inst[6] = {};
   Build35c(inst, code, method_idx, args);
-  return Instruction::At(inst)->DumpString(nullptr);
+  return DexInstructionIterator(inst)->DumpString(nullptr);
 }
 
 TEST(Instruction, DumpString) {
diff --git a/runtime/dex_method_iterator.h b/runtime/dex_method_iterator.h
deleted file mode 100644
index a44bc16..0000000
--- a/runtime/dex_method_iterator.h
+++ /dev/null
@@ -1,143 +0,0 @@
-/*
- * Copyright (C) 2011 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#ifndef ART_RUNTIME_DEX_METHOD_ITERATOR_H_
-#define ART_RUNTIME_DEX_METHOD_ITERATOR_H_
-
-#include <vector>
-
-#include "dex_file-inl.h"
-
-namespace art {
-
-class DexMethodIterator {
- public:
-  explicit DexMethodIterator(const std::vector<const DexFile*>& dex_files)
-      : dex_files_(dex_files),
-        found_next_(false),
-        dex_file_index_(0),
-        class_def_index_(0),
-        class_def_(nullptr),
-        class_data_(nullptr),
-        direct_method_(false) {
-    CHECK_NE(0U, dex_files_.size());
-  }
-
-  bool HasNext() {
-    if (found_next_) {
-      return true;
-    }
-    while (true) {
-      // End of DexFiles, we are done.
-      if (dex_file_index_ == dex_files_.size()) {
-        return false;
-      }
-      if (class_def_index_ == GetDexFileInternal().NumClassDefs()) {
-        // End of this DexFile, advance and retry.
-        class_def_index_ = 0;
-        dex_file_index_++;
-        continue;
-      }
-      if (class_def_ == nullptr) {
-        class_def_ = &GetDexFileInternal().GetClassDef(class_def_index_);
-      }
-      if (class_data_ == nullptr) {
-        class_data_ = GetDexFileInternal().GetClassData(*class_def_);
-        if (class_data_ == nullptr) {
-          // empty class, such as a marker interface
-          // End of this class, advance and retry.
-          class_def_ = nullptr;
-          class_def_index_++;
-          continue;
-        }
-      }
-      if (it_.get() == nullptr) {
-        it_.reset(new ClassDataItemIterator(GetDexFileInternal(), class_data_));
-        GetIterator().SkipAllFields();
-        direct_method_ = true;
-      }
-      if (direct_method_ && GetIterator().HasNextDirectMethod()) {
-        // Found method
-        found_next_ = true;
-        return true;
-      }
-      direct_method_ = false;
-      if (GetIterator().HasNextVirtualMethod()) {
-        // Found method
-        found_next_ = true;
-        return true;
-      }
-      // End of this class, advance and retry.
-      DCHECK(!GetIterator().HasNext());
-      it_.reset(nullptr);
-      class_data_ = nullptr;
-      class_def_ = nullptr;
-      class_def_index_++;
-    }
-  }
-
-  void Next() {
-    found_next_ = false;
-    if (it_.get() != nullptr) {
-      // Advance to next method if we currently are looking at a class.
-      GetIterator().Next();
-    }
-  }
-
-  const DexFile& GetDexFile() {
-    CHECK(HasNext());
-    return GetDexFileInternal();
-  }
-
-  uint32_t GetMemberIndex() {
-    CHECK(HasNext());
-    return GetIterator().GetMemberIndex();
-  }
-
-  InvokeType GetInvokeType() {
-    CHECK(HasNext());
-    CHECK(class_def_ != nullptr);
-    return GetIterator().GetMethodInvokeType(*class_def_);
-  }
-
- private:
-  ClassDataItemIterator& GetIterator() const {
-    CHECK(it_.get() != nullptr);
-    return *it_.get();
-  }
-
-  const DexFile& GetDexFileInternal() const {
-    CHECK_LT(dex_file_index_, dex_files_.size());
-    const DexFile* dex_file = dex_files_[dex_file_index_];
-    CHECK(dex_file != nullptr);
-    return *dex_file;
-  }
-
-  const std::vector<const DexFile*>& dex_files_;
-
-  bool found_next_;
-
-  uint32_t dex_file_index_;
-  uint32_t class_def_index_;
-  const DexFile::ClassDef* class_def_;
-  const uint8_t* class_data_;
-  std::unique_ptr<ClassDataItemIterator> it_;
-  bool direct_method_;
-};
-
-}  // namespace art
-
-#endif  // ART_RUNTIME_DEX_METHOD_ITERATOR_H_
diff --git a/runtime/dex_method_iterator_test.cc b/runtime/dex_method_iterator_test.cc
deleted file mode 100644
index e83829b..0000000
--- a/runtime/dex_method_iterator_test.cc
+++ /dev/null
@@ -1,49 +0,0 @@
-/*
- * Copyright (C) 2011 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- *      http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include "dex_method_iterator.h"
-
-#include "base/stl_util.h"
-#include "common_runtime_test.h"
-#include "oat_file.h"
-#include "scoped_thread_state_change-inl.h"
-#include "thread-current-inl.h"
-
-namespace art {
-
-class DexMethodIteratorTest : public CommonRuntimeTest {
-};
-
-TEST_F(DexMethodIteratorTest, Basic) {
-  ScopedObjectAccess soa(Thread::Current());
-  std::vector<const DexFile*> dex_files;
-  CHECK_NE(boot_class_path_.size(), 0U);
-  for (size_t i = 0; i < boot_class_path_.size(); ++i) {
-    dex_files.push_back(boot_class_path_[i]);
-  }
-  DexMethodIterator it(dex_files);
-  while (it.HasNext()) {
-    const DexFile& dex_file = it.GetDexFile();
-    InvokeType invoke_type = it.GetInvokeType();
-    uint32_t method_idx = it.GetMemberIndex();
-    if ((false)) {
-      LOG(INFO) << invoke_type << " " << dex_file.PrettyMethod(method_idx);
-    }
-    it.Next();
-  }
-}
-
-}  // namespace art
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index 211381c..813a264 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -1119,8 +1119,8 @@
       const DexFile::CodeItem* code;
       code = caller->GetCodeItem();
       CHECK_LT(dex_pc, code->insns_size_in_code_units_);
-      const Instruction* instr = Instruction::At(&code->insns_[dex_pc]);
-      Instruction::Code instr_code = instr->Opcode();
+      const Instruction& instr = code->InstructionAt(dex_pc);
+      Instruction::Code instr_code = instr.Opcode();
       bool is_range;
       switch (instr_code) {
         case Instruction::INVOKE_DIRECT:
@@ -1164,10 +1164,10 @@
           is_range = true;
           break;
         default:
-          LOG(FATAL) << "Unexpected call into trampoline: " << instr->DumpString(nullptr);
+          LOG(FATAL) << "Unexpected call into trampoline: " << instr.DumpString(nullptr);
           UNREACHABLE();
       }
-      called_method.index = (is_range) ? instr->VRegB_3rc() : instr->VRegB_35c();
+      called_method.index = (is_range) ? instr.VRegB_3rc() : instr.VRegB_35c();
       // Check that the invoke matches what we expected, note that this path only happens for debug
       // builds.
       if (found_stack_map) {
@@ -2484,16 +2484,16 @@
     uint32_t dex_pc = QuickArgumentVisitor::GetCallingDexPc(sp);
     const DexFile::CodeItem* code_item = caller_method->GetCodeItem();
     DCHECK_LT(dex_pc, code_item->insns_size_in_code_units_);
-    const Instruction* instr = Instruction::At(&code_item->insns_[dex_pc]);
-    Instruction::Code instr_code = instr->Opcode();
+    const Instruction& instr = code_item->InstructionAt(dex_pc);
+    Instruction::Code instr_code = instr.Opcode();
     DCHECK(instr_code == Instruction::INVOKE_INTERFACE ||
            instr_code == Instruction::INVOKE_INTERFACE_RANGE)
-        << "Unexpected call into interface trampoline: " << instr->DumpString(nullptr);
+        << "Unexpected call into interface trampoline: " << instr.DumpString(nullptr);
     if (instr_code == Instruction::INVOKE_INTERFACE) {
-      dex_method_idx = instr->VRegB_35c();
+      dex_method_idx = instr.VRegB_35c();
     } else {
       DCHECK_EQ(instr_code, Instruction::INVOKE_INTERFACE_RANGE);
-      dex_method_idx = instr->VRegB_3rc();
+      dex_method_idx = instr.VRegB_3rc();
     }
 
     const DexFile& dex_file = caller_method->GetDeclaringClass()->GetDexFile();
@@ -2600,11 +2600,11 @@
   ArtMethod* caller_method = QuickArgumentVisitor::GetCallingMethod(sp);
   uint32_t dex_pc = QuickArgumentVisitor::GetCallingDexPc(sp);
   const DexFile::CodeItem* code = caller_method->GetCodeItem();
-  const Instruction* inst = Instruction::At(&code->insns_[dex_pc]);
-  DCHECK(inst->Opcode() == Instruction::INVOKE_POLYMORPHIC ||
-         inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+  const Instruction& inst = code->InstructionAt(dex_pc);
+  DCHECK(inst.Opcode() == Instruction::INVOKE_POLYMORPHIC ||
+         inst.Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
   const DexFile* dex_file = caller_method->GetDexFile();
-  const uint32_t proto_idx = inst->VRegH();
+  const uint32_t proto_idx = inst.VRegH();
   const char* shorty = dex_file->GetShorty(proto_idx);
   const size_t shorty_length = strlen(shorty);
   static const bool kMethodIsStatic = false;  // invoke() and invokeExact() are not static.
@@ -2621,7 +2621,7 @@
   // Resolve method - it's either MethodHandle.invoke() or MethodHandle.invokeExact().
   ClassLinker* linker = Runtime::Current()->GetClassLinker();
   ArtMethod* resolved_method = linker->ResolveMethod<ClassLinker::ResolveMode::kCheckICCEAndIAE>(
-      self, inst->VRegB(), caller_method, kVirtual);
+      self, inst.VRegB(), caller_method, kVirtual);
   DCHECK((resolved_method ==
           jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invokeExact)) ||
          (resolved_method ==
@@ -2642,15 +2642,15 @@
     return static_cast<uintptr_t>('V');
   }
 
-  DCHECK_EQ(ArtMethod::NumArgRegisters(shorty) + 1u, (uint32_t)inst->VRegA());
+  DCHECK_EQ(ArtMethod::NumArgRegisters(shorty) + 1u, (uint32_t)inst.VRegA());
   DCHECK_EQ(resolved_method->IsStatic(), kMethodIsStatic);
 
   // Fix references before constructing the shadow frame.
   gc_visitor.FixupReferences();
 
   // Construct shadow frame placing arguments consecutively from |first_arg|.
-  const bool is_range = (inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
-  const size_t num_vregs = is_range ? inst->VRegA_4rcc() : inst->VRegA_45cc();
+  const bool is_range = (inst.Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+  const size_t num_vregs = is_range ? inst.VRegA_4rcc() : inst.VRegA_45cc();
   const size_t first_arg = 0;
   ShadowFrameAllocaUniquePtr shadow_frame_unique_ptr =
       CREATE_SHADOW_FRAME(num_vregs, /* link */ nullptr, resolved_method, dex_pc);
diff --git a/runtime/indirect_reference_table.cc b/runtime/indirect_reference_table.cc
index cff3ea7..2dd4db3 100644
--- a/runtime/indirect_reference_table.cc
+++ b/runtime/indirect_reference_table.cc
@@ -237,7 +237,8 @@
 }
 
 IndirectRef IndirectReferenceTable::Add(IRTSegmentState previous_state,
-                                        ObjPtr<mirror::Object> obj) {
+                                        ObjPtr<mirror::Object> obj,
+                                        std::string* error_msg) {
   if (kDebugIRT) {
     LOG(INFO) << "+++ Add: previous_state=" << previous_state.top_index
               << " top_index=" << segment_state_.top_index
@@ -253,28 +254,34 @@
 
   if (top_index == max_entries_) {
     if (resizable_ == ResizableCapacity::kNo) {
-      LOG(FATAL) << "JNI ERROR (app bug): " << kind_ << " table overflow "
-                 << "(max=" << max_entries_ << ")\n"
-                 << MutatorLockedDumpable<IndirectReferenceTable>(*this);
-      UNREACHABLE();
+      std::ostringstream oss;
+      oss << "JNI ERROR (app bug): " << kind_ << " table overflow "
+          << "(max=" << max_entries_ << ")"
+          << MutatorLockedDumpable<IndirectReferenceTable>(*this);
+      *error_msg = oss.str();
+      return nullptr;
     }
 
     // Try to double space.
     if (std::numeric_limits<size_t>::max() / 2 < max_entries_) {
-      LOG(FATAL) << "JNI ERROR (app bug): " << kind_ << " table overflow "
-                 << "(max=" << max_entries_ << ")" << std::endl
-                 << MutatorLockedDumpable<IndirectReferenceTable>(*this)
-                << " Resizing failed: exceeds size_t";
-      UNREACHABLE();
+      std::ostringstream oss;
+      oss << "JNI ERROR (app bug): " << kind_ << " table overflow "
+          << "(max=" << max_entries_ << ")" << std::endl
+          << MutatorLockedDumpable<IndirectReferenceTable>(*this)
+          << " Resizing failed: exceeds size_t";
+      *error_msg = oss.str();
+      return nullptr;
     }
 
-    std::string error_msg;
-    if (!Resize(max_entries_ * 2, &error_msg)) {
-      LOG(FATAL) << "JNI ERROR (app bug): " << kind_ << " table overflow "
-                 << "(max=" << max_entries_ << ")" << std::endl
-                 << MutatorLockedDumpable<IndirectReferenceTable>(*this)
-                 << " Resizing failed: " << error_msg;
-      UNREACHABLE();
+    std::string inner_error_msg;
+    if (!Resize(max_entries_ * 2, &inner_error_msg)) {
+      std::ostringstream oss;
+      oss << "JNI ERROR (app bug): " << kind_ << " table overflow "
+          << "(max=" << max_entries_ << ")" << std::endl
+          << MutatorLockedDumpable<IndirectReferenceTable>(*this)
+          << " Resizing failed: " << inner_error_msg;
+      *error_msg = oss.str();
+      return nullptr;
     }
   }
 
diff --git a/runtime/indirect_reference_table.h b/runtime/indirect_reference_table.h
index 6d52d95..bf287b1 100644
--- a/runtime/indirect_reference_table.h
+++ b/runtime/indirect_reference_table.h
@@ -244,8 +244,10 @@
   bool IsValid() const;
 
   // Add a new entry. "obj" must be a valid non-null object reference. This function will
-  // abort if the table is full (max entries reached, or expansion failed).
-  IndirectRef Add(IRTSegmentState previous_state, ObjPtr<mirror::Object> obj)
+  // return null if an error happened (with an appropriate error message set).
+  IndirectRef Add(IRTSegmentState previous_state,
+                  ObjPtr<mirror::Object> obj,
+                  std::string* error_msg)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
   // Given an IndirectRef in the table, return the Object it refers to.
diff --git a/runtime/indirect_reference_table_test.cc b/runtime/indirect_reference_table_test.cc
index 6aefe23..9278509 100644
--- a/runtime/indirect_reference_table_test.cc
+++ b/runtime/indirect_reference_table_test.cc
@@ -80,13 +80,13 @@
   EXPECT_FALSE(irt.Remove(cookie, iref0)) << "unexpectedly successful removal";
 
   // Add three, check, remove in the order in which they were added.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
   CheckDump(&irt, 1, 1);
-  IndirectRef iref1 = irt.Add(cookie, obj1.Get());
+  IndirectRef iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
   CheckDump(&irt, 2, 2);
-  IndirectRef iref2 = irt.Add(cookie, obj2.Get());
+  IndirectRef iref2 = irt.Add(cookie, obj2.Get(), &error_msg);
   EXPECT_TRUE(iref2 != nullptr);
   CheckDump(&irt, 3, 3);
 
@@ -108,11 +108,11 @@
   EXPECT_TRUE(irt.Get(iref0) == nullptr);
 
   // Add three, remove in the opposite order.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
-  iref1 = irt.Add(cookie, obj1.Get());
+  iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
-  iref2 = irt.Add(cookie, obj2.Get());
+  iref2 = irt.Add(cookie, obj2.Get(), &error_msg);
   EXPECT_TRUE(iref2 != nullptr);
   CheckDump(&irt, 3, 3);
 
@@ -128,11 +128,11 @@
 
   // Add three, remove middle / middle / bottom / top.  (Second attempt
   // to remove middle should fail.)
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
-  iref1 = irt.Add(cookie, obj1.Get());
+  iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
-  iref2 = irt.Add(cookie, obj2.Get());
+  iref2 = irt.Add(cookie, obj2.Get(), &error_msg);
   EXPECT_TRUE(iref2 != nullptr);
   CheckDump(&irt, 3, 3);
 
@@ -157,20 +157,20 @@
   // Add four entries.  Remove #1, add new entry, verify that table size
   // is still 4 (i.e. holes are getting filled).  Remove #1 and #3, verify
   // that we delete one and don't hole-compact the other.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
-  iref1 = irt.Add(cookie, obj1.Get());
+  iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
-  iref2 = irt.Add(cookie, obj2.Get());
+  iref2 = irt.Add(cookie, obj2.Get(), &error_msg);
   EXPECT_TRUE(iref2 != nullptr);
-  IndirectRef iref3 = irt.Add(cookie, obj3.Get());
+  IndirectRef iref3 = irt.Add(cookie, obj3.Get(), &error_msg);
   EXPECT_TRUE(iref3 != nullptr);
   CheckDump(&irt, 4, 4);
 
   ASSERT_TRUE(irt.Remove(cookie, iref1));
   CheckDump(&irt, 3, 3);
 
-  iref1 = irt.Add(cookie, obj1.Get());
+  iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
 
   ASSERT_EQ(4U, irt.Capacity()) << "hole not filled";
@@ -193,12 +193,12 @@
   // Add an entry, remove it, add a new entry, and try to use the original
   // iref.  They have the same slot number but are for different objects.
   // With the extended checks in place, this should fail.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
   CheckDump(&irt, 1, 1);
   ASSERT_TRUE(irt.Remove(cookie, iref0));
   CheckDump(&irt, 0, 0);
-  iref1 = irt.Add(cookie, obj1.Get());
+  iref1 = irt.Add(cookie, obj1.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
   CheckDump(&irt, 1, 1);
   ASSERT_FALSE(irt.Remove(cookie, iref0)) << "mismatched del succeeded";
@@ -209,12 +209,12 @@
 
   // Same as above, but with the same object.  A more rigorous checker
   // (e.g. with slot serialization) will catch this.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
   CheckDump(&irt, 1, 1);
   ASSERT_TRUE(irt.Remove(cookie, iref0));
   CheckDump(&irt, 0, 0);
-  iref1 = irt.Add(cookie, obj0.Get());
+  iref1 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref1 != nullptr);
   CheckDump(&irt, 1, 1);
   if (iref0 != iref1) {
@@ -229,7 +229,7 @@
   ASSERT_TRUE(irt.Get(nullptr) == nullptr);
 
   // Stale lookup.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   EXPECT_TRUE(iref0 != nullptr);
   CheckDump(&irt, 1, 1);
   ASSERT_TRUE(irt.Remove(cookie, iref0));
@@ -241,12 +241,12 @@
   static const size_t kTableInitial = kTableMax / 2;
   IndirectRef manyRefs[kTableInitial];
   for (size_t i = 0; i < kTableInitial; i++) {
-    manyRefs[i] = irt.Add(cookie, obj0.Get());
+    manyRefs[i] = irt.Add(cookie, obj0.Get(), &error_msg);
     ASSERT_TRUE(manyRefs[i] != nullptr) << "Failed adding " << i;
     CheckDump(&irt, i + 1, 1);
   }
   // ...this one causes overflow.
-  iref0 = irt.Add(cookie, obj0.Get());
+  iref0 = irt.Add(cookie, obj0.Get(), &error_msg);
   ASSERT_TRUE(iref0 != nullptr);
   ASSERT_EQ(kTableInitial + 1, irt.Capacity());
   CheckDump(&irt, kTableInitial + 1, 1);
@@ -306,16 +306,16 @@
 
     CheckDump(&irt, 0, 0);
 
-    IndirectRef iref0 = irt.Add(cookie0, obj0.Get());
-    IndirectRef iref1 = irt.Add(cookie0, obj1.Get());
-    IndirectRef iref2 = irt.Add(cookie0, obj2.Get());
+    IndirectRef iref0 = irt.Add(cookie0, obj0.Get(), &error_msg);
+    IndirectRef iref1 = irt.Add(cookie0, obj1.Get(), &error_msg);
+    IndirectRef iref2 = irt.Add(cookie0, obj2.Get(), &error_msg);
 
     EXPECT_TRUE(irt.Remove(cookie0, iref1));
 
     // New segment.
     const IRTSegmentState cookie1 = irt.GetSegmentState();
 
-    IndirectRef iref3 = irt.Add(cookie1, obj3.Get());
+    IndirectRef iref3 = irt.Add(cookie1, obj3.Get(), &error_msg);
 
     // Must not have filled the previous hole.
     EXPECT_EQ(irt.Capacity(), 4u);
@@ -337,21 +337,21 @@
 
     CheckDump(&irt, 0, 0);
 
-    IndirectRef iref0 = irt.Add(cookie0, obj0.Get());
+    IndirectRef iref0 = irt.Add(cookie0, obj0.Get(), &error_msg);
 
     // New segment.
     const IRTSegmentState cookie1 = irt.GetSegmentState();
 
-    IndirectRef iref1 = irt.Add(cookie1, obj1.Get());
-    IndirectRef iref2 = irt.Add(cookie1, obj2.Get());
-    IndirectRef iref3 = irt.Add(cookie1, obj3.Get());
+    IndirectRef iref1 = irt.Add(cookie1, obj1.Get(), &error_msg);
+    IndirectRef iref2 = irt.Add(cookie1, obj2.Get(), &error_msg);
+    IndirectRef iref3 = irt.Add(cookie1, obj3.Get(), &error_msg);
 
     EXPECT_TRUE(irt.Remove(cookie1, iref2));
 
     // Pop segment.
     irt.SetSegmentState(cookie1);
 
-    IndirectRef iref4 = irt.Add(cookie1, obj4.Get());
+    IndirectRef iref4 = irt.Add(cookie1, obj4.Get(), &error_msg);
 
     EXPECT_EQ(irt.Capacity(), 2u);
     EXPECT_TRUE(irt.Get(iref2) == nullptr);
@@ -373,25 +373,25 @@
 
     CheckDump(&irt, 0, 0);
 
-    IndirectRef iref0 = irt.Add(cookie0, obj0.Get());
+    IndirectRef iref0 = irt.Add(cookie0, obj0.Get(), &error_msg);
 
     // New segment.
     const IRTSegmentState cookie1 = irt.GetSegmentState();
 
-    IndirectRef iref1 = irt.Add(cookie1, obj1.Get());
-    IndirectRef iref2 = irt.Add(cookie1, obj2.Get());
+    IndirectRef iref1 = irt.Add(cookie1, obj1.Get(), &error_msg);
+    IndirectRef iref2 = irt.Add(cookie1, obj2.Get(), &error_msg);
 
     EXPECT_TRUE(irt.Remove(cookie1, iref1));
 
     // New segment.
     const IRTSegmentState cookie2 = irt.GetSegmentState();
 
-    IndirectRef iref3 = irt.Add(cookie2, obj3.Get());
+    IndirectRef iref3 = irt.Add(cookie2, obj3.Get(), &error_msg);
 
     // Pop segment.
     irt.SetSegmentState(cookie2);
 
-    IndirectRef iref4 = irt.Add(cookie1, obj4.Get());
+    IndirectRef iref4 = irt.Add(cookie1, obj4.Get(), &error_msg);
 
     EXPECT_EQ(irt.Capacity(), 3u);
     EXPECT_TRUE(irt.Get(iref1) == nullptr);
@@ -412,20 +412,20 @@
 
     CheckDump(&irt, 0, 0);
 
-    IndirectRef iref0 = irt.Add(cookie0, obj0.Get());
+    IndirectRef iref0 = irt.Add(cookie0, obj0.Get(), &error_msg);
 
     // New segment.
     const IRTSegmentState cookie1 = irt.GetSegmentState();
 
-    IndirectRef iref1 = irt.Add(cookie1, obj1.Get());
+    IndirectRef iref1 = irt.Add(cookie1, obj1.Get(), &error_msg);
     EXPECT_TRUE(irt.Remove(cookie1, iref1));
 
     // Emptied segment, push new one.
     const IRTSegmentState cookie2 = irt.GetSegmentState();
 
-    IndirectRef iref2 = irt.Add(cookie1, obj1.Get());
-    IndirectRef iref3 = irt.Add(cookie1, obj2.Get());
-    IndirectRef iref4 = irt.Add(cookie1, obj3.Get());
+    IndirectRef iref2 = irt.Add(cookie1, obj1.Get(), &error_msg);
+    IndirectRef iref3 = irt.Add(cookie1, obj2.Get(), &error_msg);
+    IndirectRef iref4 = irt.Add(cookie1, obj3.Get(), &error_msg);
 
     EXPECT_TRUE(irt.Remove(cookie1, iref3));
 
@@ -433,7 +433,7 @@
     UNUSED(cookie2);
     irt.SetSegmentState(cookie1);
 
-    IndirectRef iref5 = irt.Add(cookie1, obj4.Get());
+    IndirectRef iref5 = irt.Add(cookie1, obj4.Get(), &error_msg);
 
     EXPECT_EQ(irt.Capacity(), 2u);
     EXPECT_TRUE(irt.Get(iref3) == nullptr);
@@ -455,14 +455,14 @@
 
     CheckDump(&irt, 0, 0);
 
-    IndirectRef iref0 = irt.Add(cookie0, obj0.Get());
+    IndirectRef iref0 = irt.Add(cookie0, obj0.Get(), &error_msg);
 
     // New segment.
     const IRTSegmentState cookie1 = irt.GetSegmentState();
 
-    IndirectRef iref1 = irt.Add(cookie1, obj1.Get());
-    IndirectRef iref2 = irt.Add(cookie1, obj1.Get());
-    IndirectRef iref3 = irt.Add(cookie1, obj2.Get());
+    IndirectRef iref1 = irt.Add(cookie1, obj1.Get(), &error_msg);
+    IndirectRef iref2 = irt.Add(cookie1, obj1.Get(), &error_msg);
+    IndirectRef iref3 = irt.Add(cookie1, obj2.Get(), &error_msg);
 
     EXPECT_TRUE(irt.Remove(cookie1, iref2));
 
@@ -473,7 +473,7 @@
     const IRTSegmentState cookie1_second = irt.GetSegmentState();
     UNUSED(cookie1_second);
 
-    IndirectRef iref4 = irt.Add(cookie1, obj3.Get());
+    IndirectRef iref4 = irt.Add(cookie1, obj3.Get(), &error_msg);
 
     EXPECT_EQ(irt.Capacity(), 2u);
     EXPECT_TRUE(irt.Get(iref3) == nullptr);
@@ -504,7 +504,7 @@
   const IRTSegmentState cookie = kIRTFirstSegment;
 
   for (size_t i = 0; i != kTableMax + 1; ++i) {
-    irt.Add(cookie, obj0.Get());
+    irt.Add(cookie, obj0.Get(), &error_msg);
   }
 
   EXPECT_EQ(irt.Capacity(), kTableMax + 1);
diff --git a/runtime/interpreter/unstarted_runtime_test.cc b/runtime/interpreter/unstarted_runtime_test.cc
index 71ab01e..fb37825 100644
--- a/runtime/interpreter/unstarted_runtime_test.cc
+++ b/runtime/interpreter/unstarted_runtime_test.cc
@@ -393,7 +393,7 @@
 
   // create instruction data for invoke-direct {v0, v1} of method with fake index
   uint16_t inst_data[3] = { 0x2070, 0x0000, 0x0010 };
-  const Instruction* inst = Instruction::At(inst_data);
+  DexInstructionIterator inst(inst_data);
 
   JValue result;
   ShadowFrame* shadow_frame = ShadowFrame::CreateDeoptimizedFrame(10, nullptr, method, 0);
@@ -403,7 +403,7 @@
   shadow_frame->SetVRegReference(0, reference_empty_string);
   shadow_frame->SetVRegReference(1, string_arg);
 
-  interpreter::DoCall<false, false>(method, self, *shadow_frame, inst, inst_data[0], &result);
+  interpreter::DoCall<false, false>(method, self, *shadow_frame, &*inst, inst_data[0], &result);
   mirror::String* string_result = reinterpret_cast<mirror::String*>(result.GetL());
   EXPECT_EQ(string_arg->GetLength(), string_result->GetLength());
 
@@ -1027,12 +1027,12 @@
 
   // create instruction data for invoke-direct {v0, v1} of method with fake index
   uint16_t inst_data[3] = { 0x2070, 0x0000, 0x0010 };
-  const Instruction* inst = Instruction::At(inst_data);
+  DexInstructionIterator inst(inst_data);
 
   JValue result;
   ShadowFrame* shadow_frame = ShadowFrame::CreateDeoptimizedFrame(10, nullptr, method, 0);
   shadow_frame->SetVRegDouble(0, 1.23);
-  interpreter::DoCall<false, false>(method, self, *shadow_frame, inst, inst_data[0], &result);
+  interpreter::DoCall<false, false>(method, self, *shadow_frame, &*inst, inst_data[0], &result);
   ObjPtr<mirror::String> string_result = reinterpret_cast<mirror::String*>(result.GetL());
   ASSERT_TRUE(string_result != nullptr);
 
@@ -1187,12 +1187,12 @@
 
       // create instruction data for invoke-direct {v0} of method with fake index
       uint16_t inst_data[3] = { 0x1070, 0x0000, 0x0010 };
-      const Instruction* inst = Instruction::At(inst_data);
+      DexInstructionIterator inst(inst_data);
 
       interpreter::DoCall<false, false>(boot_cp_init,
                                         self,
                                         *shadow_frame,
-                                        inst,
+                                        &*inst,
                                         inst_data[0],
                                         &result);
       CHECK(!self->IsExceptionPending());
diff --git a/runtime/java_vm_ext.cc b/runtime/java_vm_ext.cc
index c0d1861..5a16053 100644
--- a/runtime/java_vm_ext.cc
+++ b/runtime/java_vm_ext.cc
@@ -589,7 +589,12 @@
     return nullptr;
   }
   WriterMutexLock mu(self, *Locks::jni_globals_lock_);
-  IndirectRef ref = globals_.Add(kIRTFirstSegment, obj);
+  std::string error_msg;
+  IndirectRef ref = globals_.Add(kIRTFirstSegment, obj, &error_msg);
+  if (UNLIKELY(ref == nullptr)) {
+    LOG(FATAL) << error_msg;
+    UNREACHABLE();
+  }
   return reinterpret_cast<jobject>(ref);
 }
 
@@ -607,7 +612,12 @@
     self->CheckEmptyCheckpointFromWeakRefAccess(Locks::jni_weak_globals_lock_);
     weak_globals_add_condition_.WaitHoldingLocks(self);
   }
-  IndirectRef ref = weak_globals_.Add(kIRTFirstSegment, obj);
+  std::string error_msg;
+  IndirectRef ref = weak_globals_.Add(kIRTFirstSegment, obj, &error_msg);
+  if (UNLIKELY(ref == nullptr)) {
+    LOG(FATAL) << error_msg;
+    UNREACHABLE();
+  }
   return reinterpret_cast<jweak>(ref);
 }
 
diff --git a/runtime/jit/jit.cc b/runtime/jit/jit.cc
index 8c27bfe..97a3b71 100644
--- a/runtime/jit/jit.cc
+++ b/runtime/jit/jit.cc
@@ -490,10 +490,10 @@
       return false;
     }
 
-    // Before allowing the jump, make sure the debugger is not active to avoid jumping from
-    // interpreter to OSR while e.g. single stepping. Note that we could selectively disable
-    // OSR when single stepping, but that's currently hard to know at this point.
-    if (Dbg::IsDebuggerActive()) {
+    // Before allowing the jump, make sure no code is actively inspecting the method to avoid
+    // jumping from interpreter to OSR while e.g. single stepping. Note that we could selectively
+    // disable OSR when single stepping, but that's currently hard to know at this point.
+    if (Runtime::Current()->GetRuntimeCallbacks()->IsMethodBeingInspected(method)) {
       return false;
     }
 
diff --git a/runtime/jit/profiling_info.cc b/runtime/jit/profiling_info.cc
index 1bd095a..ad01324 100644
--- a/runtime/jit/profiling_info.cc
+++ b/runtime/jit/profiling_info.cc
@@ -43,15 +43,12 @@
   // instructions we are interested in profiling.
   DCHECK(!method->IsNative());
 
-  const DexFile::CodeItem& code_item = *method->GetCodeItem();
-  const uint16_t* code_ptr = code_item.insns_;
-  const uint16_t* code_end = code_item.insns_ + code_item.insns_size_in_code_units_;
-
-  uint32_t dex_pc = 0;
   std::vector<uint32_t> entries;
-  while (code_ptr < code_end) {
-    const Instruction& instruction = *Instruction::At(code_ptr);
-    switch (instruction.Opcode()) {
+
+  IterationRange<DexInstructionIterator> instructions = method->GetCodeItem()->Instructions();
+  for (auto inst = instructions.begin(); inst != instructions.end(); ++inst) {
+    const uint32_t dex_pc = inst.GetDexPC(instructions.begin());
+    switch (inst->Opcode()) {
       case Instruction::INVOKE_VIRTUAL:
       case Instruction::INVOKE_VIRTUAL_RANGE:
       case Instruction::INVOKE_VIRTUAL_QUICK:
@@ -64,8 +61,6 @@
       default:
         break;
     }
-    dex_pc += instruction.SizeInCodeUnits();
-    code_ptr += instruction.SizeInCodeUnits();
   }
 
   // We always create a `ProfilingInfo` object, even if there is no instruction we are
diff --git a/runtime/jni_env_ext-inl.h b/runtime/jni_env_ext-inl.h
index 25893b7..d66df08 100644
--- a/runtime/jni_env_ext-inl.h
+++ b/runtime/jni_env_ext-inl.h
@@ -25,7 +25,13 @@
 
 template<typename T>
 inline T JNIEnvExt::AddLocalReference(ObjPtr<mirror::Object> obj) {
-  IndirectRef ref = locals.Add(local_ref_cookie, obj);
+  std::string error_msg;
+  IndirectRef ref = locals.Add(local_ref_cookie, obj, &error_msg);
+  if (UNLIKELY(ref == nullptr)) {
+    // This is really unexpected if we allow resizing local IRTs...
+    LOG(FATAL) << error_msg;
+    UNREACHABLE();
+  }
 
   // TODO: fix this to understand PushLocalFrame, so we can turn it on.
   if (false) {
diff --git a/runtime/jni_env_ext.cc b/runtime/jni_env_ext.cc
index 3ff94f9..8352657 100644
--- a/runtime/jni_env_ext.cc
+++ b/runtime/jni_env_ext.cc
@@ -99,7 +99,14 @@
   if (obj == nullptr) {
     return nullptr;
   }
-  return reinterpret_cast<jobject>(locals.Add(local_ref_cookie, obj));
+  std::string error_msg;
+  jobject ref = reinterpret_cast<jobject>(locals.Add(local_ref_cookie, obj, &error_msg));
+  if (UNLIKELY(ref == nullptr)) {
+    // This is really unexpected if we allow resizing local IRTs...
+    LOG(FATAL) << error_msg;
+    UNREACHABLE();
+  }
+  return ref;
 }
 
 void JNIEnvExt::DeleteLocalRef(jobject obj) {
diff --git a/runtime/mirror/class-inl.h b/runtime/mirror/class-inl.h
index 77a5b55..78f6b25 100644
--- a/runtime/mirror/class-inl.h
+++ b/runtime/mirror/class-inl.h
@@ -128,7 +128,8 @@
 }
 
 inline ArraySlice<ArtMethod> Class::GetDirectMethodsSliceUnchecked(PointerSize pointer_size) {
-  return GetMethodsSliceRangeUnchecked(pointer_size,
+  return GetMethodsSliceRangeUnchecked(GetMethodsPtr(),
+                                       pointer_size,
                                        GetDirectMethodsStartOffset(),
                                        GetVirtualMethodsStartOffset());
 }
@@ -140,7 +141,8 @@
 }
 
 inline ArraySlice<ArtMethod> Class::GetDeclaredMethodsSliceUnchecked(PointerSize pointer_size) {
-  return GetMethodsSliceRangeUnchecked(pointer_size,
+  return GetMethodsSliceRangeUnchecked(GetMethodsPtr(),
+                                       pointer_size,
                                        GetDirectMethodsStartOffset(),
                                        GetCopiedMethodsStartOffset());
 }
@@ -152,7 +154,8 @@
 
 inline ArraySlice<ArtMethod> Class::GetDeclaredVirtualMethodsSliceUnchecked(
     PointerSize pointer_size) {
-  return GetMethodsSliceRangeUnchecked(pointer_size,
+  return GetMethodsSliceRangeUnchecked(GetMethodsPtr(),
+                                       pointer_size,
                                        GetVirtualMethodsStartOffset(),
                                        GetCopiedMethodsStartOffset());
 }
@@ -164,9 +167,11 @@
 }
 
 inline ArraySlice<ArtMethod> Class::GetVirtualMethodsSliceUnchecked(PointerSize pointer_size) {
-  return GetMethodsSliceRangeUnchecked(pointer_size,
+  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
+  return GetMethodsSliceRangeUnchecked(methods,
+                                       pointer_size,
                                        GetVirtualMethodsStartOffset(),
-                                       NumMethods());
+                                       NumMethods(methods));
 }
 
 template<VerifyObjectFlags kVerifyFlags>
@@ -176,7 +181,11 @@
 }
 
 inline ArraySlice<ArtMethod> Class::GetCopiedMethodsSliceUnchecked(PointerSize pointer_size) {
-  return GetMethodsSliceRangeUnchecked(pointer_size, GetCopiedMethodsStartOffset(), NumMethods());
+  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
+  return GetMethodsSliceRangeUnchecked(methods,
+                                       pointer_size,
+                                       GetCopiedMethodsStartOffset(),
+                                       NumMethods(methods));
 }
 
 inline LengthPrefixedArray<ArtMethod>* Class::GetMethodsPtr() {
@@ -187,19 +196,21 @@
 template<VerifyObjectFlags kVerifyFlags>
 inline ArraySlice<ArtMethod> Class::GetMethodsSlice(PointerSize pointer_size) {
   DCHECK(IsLoaded() || IsErroneous());
-  return GetMethodsSliceRangeUnchecked(pointer_size, 0, NumMethods());
+  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
+  return GetMethodsSliceRangeUnchecked(methods, pointer_size, 0, NumMethods(methods));
 }
 
-inline ArraySlice<ArtMethod> Class::GetMethodsSliceRangeUnchecked(PointerSize pointer_size,
-                                                                  uint32_t start_offset,
-                                                                  uint32_t end_offset) {
+inline ArraySlice<ArtMethod> Class::GetMethodsSliceRangeUnchecked(
+    LengthPrefixedArray<ArtMethod>* methods,
+    PointerSize pointer_size,
+    uint32_t start_offset,
+    uint32_t end_offset) {
   DCHECK_LE(start_offset, end_offset);
-  DCHECK_LE(end_offset, NumMethods());
+  DCHECK_LE(end_offset, NumMethods(methods));
   uint32_t size = end_offset - start_offset;
   if (size == 0u) {
     return ArraySlice<ArtMethod>();
   }
-  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
   DCHECK(methods != nullptr);
   DCHECK_LE(end_offset, methods->size());
   size_t method_size = ArtMethod::Size(pointer_size);
@@ -211,7 +222,10 @@
 }
 
 inline uint32_t Class::NumMethods() {
-  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
+  return NumMethods(GetMethodsPtr());
+}
+
+inline uint32_t Class::NumMethods(LengthPrefixedArray<ArtMethod>* methods) {
   return (methods == nullptr) ? 0 : methods->size();
 }
 
@@ -969,7 +983,8 @@
 
 inline ArraySlice<ArtMethod> Class::GetMethods(PointerSize pointer_size) {
   CheckPointerSize(pointer_size);
-  return GetMethodsSliceRangeUnchecked(pointer_size, 0u, NumMethods());
+  LengthPrefixedArray<ArtMethod>* methods = GetMethodsPtr();
+  return GetMethodsSliceRangeUnchecked(methods, pointer_size, 0u, NumMethods(methods));
 }
 
 inline IterationRange<StrideIterator<ArtField>> Class::GetIFields() {
diff --git a/runtime/mirror/class.h b/runtime/mirror/class.h
index c44b616..148273b 100644
--- a/runtime/mirror/class.h
+++ b/runtime/mirror/class.h
@@ -773,6 +773,8 @@
   ALWAYS_INLINE uint32_t NumDeclaredVirtualMethods() REQUIRES_SHARED(Locks::mutator_lock_);
 
   ALWAYS_INLINE uint32_t NumMethods() REQUIRES_SHARED(Locks::mutator_lock_);
+  static ALWAYS_INLINE uint32_t NumMethods(LengthPrefixedArray<ArtMethod>* methods)
+      REQUIRES_SHARED(Locks::mutator_lock_);
 
   template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
   ArtMethod* GetVirtualMethod(size_t i, PointerSize pointer_size)
@@ -1294,9 +1296,11 @@
   ALWAYS_INLINE void SetMethodsPtrInternal(LengthPrefixedArray<ArtMethod>* new_methods)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
-  ALWAYS_INLINE ArraySlice<ArtMethod> GetMethodsSliceRangeUnchecked(PointerSize pointer_size,
-                                                                    uint32_t start_offset,
-                                                                    uint32_t end_offset)
+  ALWAYS_INLINE static ArraySlice<ArtMethod> GetMethodsSliceRangeUnchecked(
+      LengthPrefixedArray<ArtMethod>* methods,
+      PointerSize pointer_size,
+      uint32_t start_offset,
+      uint32_t end_offset)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
   template <bool throw_on_failure>
diff --git a/runtime/oat_file_manager.cc b/runtime/oat_file_manager.cc
index 05b63d2..7cabae5 100644
--- a/runtime/oat_file_manager.cc
+++ b/runtime/oat_file_manager.cc
@@ -54,7 +54,8 @@
 
 static bool OatFileIsOnSystem(const std::unique_ptr<const OatFile>& oat_file) {
   UniqueCPtr<const char[]> path(realpath(oat_file->GetLocation().c_str(), nullptr));
-  return path != nullptr && android::base::StartsWith(oat_file->GetLocation(), GetAndroidRoot());
+  return path != nullptr && android::base::StartsWith(oat_file->GetLocation(),
+                                                      GetAndroidRoot().c_str());
 }
 
 const OatFile* OatFileManager::RegisterOatFile(std::unique_ptr<const OatFile> oat_file) {
diff --git a/runtime/primitive.cc b/runtime/primitive.cc
index 1ec345a..6f3571c 100644
--- a/runtime/primitive.cc
+++ b/runtime/primitive.cc
@@ -60,9 +60,9 @@
   return kBoxedDescriptors[type];
 }
 
-std::ostream& operator<<(std::ostream& os, const Primitive::Type& type) {
-  int32_t int_type = static_cast<int32_t>(type);
-  if (type >= Primitive::kPrimNot && type <= Primitive::kPrimVoid) {
+std::ostream& operator<<(std::ostream& os, Primitive::Type type) {
+  uint32_t int_type = static_cast<uint32_t>(type);
+  if (type <= Primitive::kPrimLast) {
     os << kTypeNames[int_type];
   } else {
     os << "Type[" << int_type << "]";
diff --git a/runtime/primitive.h b/runtime/primitive.h
index a0edaee..a429914 100644
--- a/runtime/primitive.h
+++ b/runtime/primitive.h
@@ -49,7 +49,7 @@
     kPrimLast = kPrimVoid
   };
 
-  static Type GetType(char type) {
+  static constexpr Type GetType(char type) {
     switch (type) {
       case 'B':
         return kPrimByte;
@@ -74,7 +74,7 @@
     }
   }
 
-  static size_t ComponentSizeShift(Type type) {
+  static constexpr size_t ComponentSizeShift(Type type) {
     switch (type) {
       case kPrimVoid:
       case kPrimBoolean:
@@ -86,13 +86,12 @@
       case kPrimLong:
       case kPrimDouble:  return 3;
       case kPrimNot:     return ComponentSizeShiftWidth(kObjectReferenceSize);
-      default:
-        LOG(FATAL) << "Invalid type " << static_cast<int>(type);
-        return 0;
     }
+    LOG(FATAL) << "Invalid type " << static_cast<int>(type);
+    UNREACHABLE();
   }
 
-  static size_t ComponentSize(Type type) {
+  static constexpr size_t ComponentSize(Type type) {
     switch (type) {
       case kPrimVoid:    return 0;
       case kPrimBoolean:
@@ -104,10 +103,9 @@
       case kPrimLong:
       case kPrimDouble:  return 8;
       case kPrimNot:     return kObjectReferenceSize;
-      default:
-        LOG(FATAL) << "Invalid type " << static_cast<int>(type);
-        return 0;
     }
+    LOG(FATAL) << "Invalid type " << static_cast<int>(type);
+    UNREACHABLE();
   }
 
   static const char* Descriptor(Type type) {
@@ -141,26 +139,6 @@
   // Returns the descriptor corresponding to the boxed type of |type|.
   static const char* BoxedDescriptor(Type type);
 
-  static bool IsFloatingPointType(Type type) {
-    return type == kPrimFloat || type == kPrimDouble;
-  }
-
-  static bool IsIntegralType(Type type) {
-    // The Java language does not allow treating boolean as an integral type but
-    // our bit representation makes it safe.
-    switch (type) {
-      case kPrimBoolean:
-      case kPrimByte:
-      case kPrimChar:
-      case kPrimShort:
-      case kPrimInt:
-      case kPrimLong:
-        return true;
-      default:
-        return false;
-    }
-  }
-
   // Return true if |type| is an numeric type.
   static constexpr bool IsNumericType(Type type) {
     switch (type) {
@@ -175,6 +153,8 @@
       case Primitive::Type::kPrimDouble: return true;
       case Primitive::Type::kPrimVoid: return false;
     }
+    LOG(FATAL) << "Invalid type " << static_cast<int>(type);
+    UNREACHABLE();
   }
 
   // Returns true if it is possible to widen type |from| to type |to|. Both |from| and
@@ -190,73 +170,15 @@
     return IsNumericType(from) && IsNumericType(to) && from <= to;
   }
 
-  static bool IsIntOrLongType(Type type) {
-    return type == kPrimInt || type == kPrimLong;
-  }
-
   static bool Is64BitType(Type type) {
     return type == kPrimLong || type == kPrimDouble;
   }
 
-  // Return the general kind of `type`, fusing integer-like types as kPrimInt.
-  static Type PrimitiveKind(Type type) {
-    switch (type) {
-      case kPrimBoolean:
-      case kPrimByte:
-      case kPrimShort:
-      case kPrimChar:
-      case kPrimInt:
-        return kPrimInt;
-      default:
-        return type;
-    }
-  }
-
-  static int64_t MinValueOfIntegralType(Type type) {
-    switch (type) {
-      case kPrimBoolean:
-        return std::numeric_limits<bool>::min();
-      case kPrimByte:
-        return std::numeric_limits<int8_t>::min();
-      case kPrimChar:
-        return std::numeric_limits<uint16_t>::min();
-      case kPrimShort:
-        return std::numeric_limits<int16_t>::min();
-      case kPrimInt:
-        return std::numeric_limits<int32_t>::min();
-      case kPrimLong:
-        return std::numeric_limits<int64_t>::min();
-      default:
-        LOG(FATAL) << "non integral type";
-    }
-    return 0;
-  }
-
-  static int64_t MaxValueOfIntegralType(Type type) {
-    switch (type) {
-      case kPrimBoolean:
-        return std::numeric_limits<bool>::max();
-      case kPrimByte:
-        return std::numeric_limits<int8_t>::max();
-      case kPrimChar:
-        return std::numeric_limits<uint16_t>::max();
-      case kPrimShort:
-        return std::numeric_limits<int16_t>::max();
-      case kPrimInt:
-        return std::numeric_limits<int32_t>::max();
-      case kPrimLong:
-        return std::numeric_limits<int64_t>::max();
-      default:
-        LOG(FATAL) << "non integral type";
-    }
-    return 0;
-  }
-
  private:
   DISALLOW_IMPLICIT_CONSTRUCTORS(Primitive);
 };
 
-std::ostream& operator<<(std::ostream& os, const Primitive::Type& state);
+std::ostream& operator<<(std::ostream& os, Primitive::Type state);
 
 }  // namespace art
 
diff --git a/runtime/runtime_callbacks.cc b/runtime/runtime_callbacks.cc
index 88d3f28..f164f7c 100644
--- a/runtime/runtime_callbacks.cc
+++ b/runtime/runtime_callbacks.cc
@@ -26,10 +26,6 @@
 
 namespace art {
 
-void RuntimeCallbacks::AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
-  thread_callbacks_.push_back(cb);
-}
-
 template <typename T>
 ALWAYS_INLINE
 static inline void Remove(T* cb, std::vector<T*>* data) {
@@ -39,6 +35,27 @@
   }
 }
 
+void RuntimeCallbacks::AddMethodInspectionCallback(MethodInspectionCallback* cb) {
+  method_inspection_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveMethodInspectionCallback(MethodInspectionCallback* cb) {
+  Remove(cb, &method_inspection_callbacks_);
+}
+
+bool RuntimeCallbacks::IsMethodBeingInspected(ArtMethod* m) {
+  for (MethodInspectionCallback* cb : method_inspection_callbacks_) {
+    if (cb->IsMethodBeingInspected(m)) {
+      return true;
+    }
+  }
+  return false;
+}
+
+void RuntimeCallbacks::AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+  thread_callbacks_.push_back(cb);
+}
+
 void RuntimeCallbacks::MonitorContendedLocking(Monitor* m) {
   for (MonitorCallback* cb : monitor_callbacks_) {
     cb->MonitorContendedLocking(m);
diff --git a/runtime/runtime_callbacks.h b/runtime/runtime_callbacks.h
index fa686d3..c936049 100644
--- a/runtime/runtime_callbacks.h
+++ b/runtime/runtime_callbacks.h
@@ -94,6 +94,18 @@
   virtual ~MonitorCallback() {}
 };
 
+// A callback to let parts of the runtime note that they are currently relying on a particular
+// method remaining in it's current state. Users should not rely on always being called. If multiple
+// callbacks are added the runtime will short-circuit when the first one returns 'true'.
+class MethodInspectionCallback {
+ public:
+  virtual ~MethodInspectionCallback() {}
+
+  // Returns true if the method is being inspected currently and the runtime should not modify it in
+  // potentially dangerous ways (i.e. replace with compiled version, JIT it, etc).
+  virtual bool IsMethodBeingInspected(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
 class RuntimeCallbacks {
  public:
   void AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
@@ -151,6 +163,15 @@
   void AddMonitorCallback(MonitorCallback* cb) REQUIRES_SHARED(Locks::mutator_lock_);
   void RemoveMonitorCallback(MonitorCallback* cb) REQUIRES_SHARED(Locks::mutator_lock_);
 
+  // Returns true if some MethodInspectionCallback indicates the method is being inspected/depended
+  // on by some code.
+  bool IsMethodBeingInspected(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddMethodInspectionCallback(MethodInspectionCallback* cb)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+  void RemoveMethodInspectionCallback(MethodInspectionCallback* cb)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
  private:
   std::vector<ThreadLifecycleCallback*> thread_callbacks_
       GUARDED_BY(Locks::mutator_lock_);
@@ -164,6 +185,8 @@
       GUARDED_BY(Locks::mutator_lock_);
   std::vector<MonitorCallback*> monitor_callbacks_
       GUARDED_BY(Locks::mutator_lock_);
+  std::vector<MethodInspectionCallback*> method_inspection_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
 };
 
 }  // namespace art
diff --git a/runtime/utils.cc b/runtime/utils.cc
index fc1c91a..b72dec6 100644
--- a/runtime/utils.cc
+++ b/runtime/utils.cc
@@ -25,6 +25,21 @@
 #include <sys/wait.h>
 #include <unistd.h>
 
+// We need dladdr.
+#ifndef __APPLE__
+#ifndef _GNU_SOURCE
+#define _GNU_SOURCE
+#define DEFINED_GNU_SOURCE
+#endif
+#include <dlfcn.h>
+#include <libgen.h>
+#ifdef DEFINED_GNU_SOURCE
+#undef _GNU_SOURCE
+#undef DEFINED_GNU_SOURCE
+#endif
+#endif
+
+
 #include <memory>
 
 #include "android-base/stringprintf.h"
@@ -702,6 +717,54 @@
   *task_cpu = strtoull(fields[36].c_str(), nullptr, 10);
 }
 
+std::string GetAndroidRootSafe(std::string* error_msg) {
+  // Prefer ANDROID_ROOT if it's set.
+  const char* android_dir = getenv("ANDROID_ROOT");
+  if (android_dir != nullptr) {
+    if (!OS::DirectoryExists(android_dir)) {
+      *error_msg = StringPrintf("Failed to find ANDROID_ROOT directory %s", android_dir);
+      return "";
+    }
+    return android_dir;
+  }
+
+  // Check where libart is from, and derive from there. Only do this for non-Mac.
+#ifndef __APPLE__
+  {
+    Dl_info info;
+    if (dladdr(reinterpret_cast<const void*>(&GetAndroidRootSafe), /* out */ &info) != 0) {
+      // Make a duplicate of the fname so dirname can modify it.
+      UniqueCPtr<char> fname(strdup(info.dli_fname));
+
+      char* dir1 = dirname(fname.get());  // This is the lib directory.
+      char* dir2 = dirname(dir1);         // This is the "system" directory.
+      if (OS::DirectoryExists(dir2)) {
+        std::string tmp = dir2;  // Make a copy here so that fname can be released.
+        return tmp;
+      }
+    }
+  }
+#endif
+
+  // Try "/system".
+  if (!OS::DirectoryExists("/system")) {
+    *error_msg = "Failed to find ANDROID_ROOT directory /system";
+    return "";
+  }
+  return "/system";
+}
+
+std::string GetAndroidRoot() {
+  std::string error_msg;
+  std::string ret = GetAndroidRootSafe(&error_msg);
+  if (ret.empty()) {
+    LOG(FATAL) << error_msg;
+    UNREACHABLE();
+  }
+  return ret;
+}
+
+
 static const char* GetAndroidDirSafe(const char* env_var,
                                      const char* default_dir,
                                      std::string* error_msg) {
@@ -721,7 +784,7 @@
   return android_dir;
 }
 
-const char* GetAndroidDir(const char* env_var, const char* default_dir) {
+static const char* GetAndroidDir(const char* env_var, const char* default_dir) {
   std::string error_msg;
   const char* dir = GetAndroidDirSafe(env_var, default_dir, &error_msg);
   if (dir != nullptr) {
@@ -732,14 +795,6 @@
   }
 }
 
-const char* GetAndroidRoot() {
-  return GetAndroidDir("ANDROID_ROOT", "/system");
-}
-
-const char* GetAndroidRootSafe(std::string* error_msg) {
-  return GetAndroidDirSafe("ANDROID_ROOT", "/system", error_msg);
-}
-
 const char* GetAndroidData() {
   return GetAndroidDir("ANDROID_DATA", "/data");
 }
@@ -749,11 +804,11 @@
 }
 
 std::string GetDefaultBootImageLocation(std::string* error_msg) {
-  const char* android_root = GetAndroidRootSafe(error_msg);
-  if (android_root == nullptr) {
+  std::string android_root = GetAndroidRootSafe(error_msg);
+  if (android_root.empty()) {
     return "";
   }
-  return StringPrintf("%s/framework/boot.art", android_root);
+  return StringPrintf("%s/framework/boot.art", android_root.c_str());
 }
 
 void GetDalvikCache(const char* subdir, const bool create_if_absent, std::string* dalvik_cache,
diff --git a/runtime/utils.h b/runtime/utils.h
index 9945298..4cb06c1 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -139,9 +139,9 @@
 void SetThreadName(const char* thread_name);
 
 // Find $ANDROID_ROOT, /system, or abort.
-const char* GetAndroidRoot();
-// Find $ANDROID_ROOT, /system, or return null.
-const char* GetAndroidRootSafe(std::string* error_msg);
+std::string GetAndroidRoot();
+// Find $ANDROID_ROOT, /system, or return an empty string.
+std::string GetAndroidRootSafe(std::string* error_msg);
 
 // Find $ANDROID_DATA, /data, or abort.
 const char* GetAndroidData();
diff --git a/runtime/utils_test.cc b/runtime/utils_test.cc
index decb243..e846c98 100644
--- a/runtime/utils_test.cc
+++ b/runtime/utils_test.cc
@@ -16,9 +16,11 @@
 
 #include "utils.h"
 
+#include <libgen.h>
 #include <stdlib.h>
 
 #include "base/enums.h"
+#include "base/stl_util.h"
 #include "class_linker-inl.h"
 #include "common_runtime_test.h"
 #include "exec_utils.h"
@@ -413,4 +415,40 @@
   EXPECT_EQ(BoundsCheckedCast<const uint64_t*>(buffer + 57, buffer, buffer_end), nullptr);
 }
 
+TEST_F(UtilsTest, GetAndroidRootSafe) {
+  std::string error_msg;
+
+  // We don't expect null returns for most cases, so don't check and let std::string crash.
+
+  // CommonRuntimeTest sets ANDROID_ROOT, so expect this to be the same.
+  std::string android_root = GetAndroidRootSafe(&error_msg);
+  std::string android_root_env = getenv("ANDROID_ROOT");
+  EXPECT_EQ(android_root, android_root_env);
+
+  // Set ANDROID_ROOT to something else (but the directory must exist). So use dirname.
+  char* root_dup = strdup(android_root_env.c_str());
+  char* dir = dirname(root_dup);
+  ASSERT_EQ(0, setenv("ANDROID_ROOT", dir, 1 /* overwrite */));
+  std::string android_root2 = GetAndroidRootSafe(&error_msg);
+  EXPECT_STREQ(dir, android_root2.c_str());
+  free(root_dup);
+
+  // Set a bogus value for ANDROID_ROOT. This should be an error.
+  ASSERT_EQ(0, setenv("ANDROID_ROOT", "/this/is/obviously/bogus", 1 /* overwrite */));
+  EXPECT_TRUE(GetAndroidRootSafe(&error_msg) == nullptr);
+
+  // Unset ANDROID_ROOT and see that it still returns something (as libart code is running).
+  ASSERT_EQ(0, unsetenv("ANDROID_ROOT"));
+  std::string android_root3 = GetAndroidRootSafe(&error_msg);
+  // This should be the same as the other root (modulo realpath), otherwise the test setup is
+  // broken.
+  UniqueCPtr<char> real_root(realpath(android_root.c_str(), nullptr));
+  UniqueCPtr<char> real_root3(realpath(android_root3.c_str(), nullptr));
+  EXPECT_STREQ(real_root.get(), real_root3.get());
+
+
+  // Reset ANDROID_ROOT, as other things may depend on it.
+  ASSERT_EQ(0, setenv("ANDROID_ROOT", android_root_env.c_str(), 1 /* overwrite */));
+}
+
 }  // namespace art
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index e4ad55d..cfdf20d 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -616,18 +616,11 @@
 }
 
 static bool HasMonitorEnterInstructions(const DexFile::CodeItem* const code_item) {
-  const Instruction* inst = Instruction::At(code_item->insns_);
-
-  uint32_t insns_size = code_item->insns_size_in_code_units_;
-  for (uint32_t dex_pc = 0; dex_pc < insns_size;) {
-    if (inst->Opcode() == Instruction::MONITOR_ENTER) {
+  for (const Instruction& inst : code_item->Instructions()) {
+    if (inst.Opcode() == Instruction::MONITOR_ENTER) {
       return true;
     }
-
-    dex_pc += inst->SizeInCodeUnits();
-    inst = inst->Next();
   }
-
   return false;
 }
 
@@ -683,7 +676,7 @@
   if (register_line == nullptr) {
     return nullptr;
   }
-  const Instruction* inst = Instruction::At(code_item_->insns_ + dex_pc);
+  const Instruction* inst = &code_item_->InstructionAt(dex_pc);
   return GetQuickFieldAccess(inst, register_line);
 }
 
@@ -723,7 +716,7 @@
   if (register_line == nullptr) {
     return nullptr;
   }
-  const Instruction* inst = Instruction::At(code_item_->insns_ + dex_pc);
+  const Instruction* inst = &code_item_->InstructionAt(dex_pc);
   const bool is_range = (inst->Opcode() == Instruction::INVOKE_VIRTUAL_RANGE_QUICK);
   return GetQuickInvokedMethod(inst, register_line, is_range, false);
 }
@@ -929,9 +922,8 @@
         // Note: this can fail before we touch any instruction, for the signature of a method. So
         //       add a check.
         if (work_insn_idx_ < dex::kDexNoIndex) {
-          const uint16_t* insns = code_item_->insns_ + work_insn_idx_;
-          const Instruction* inst = Instruction::At(insns);
-          int opcode_flags = Instruction::FlagsOf(inst->Opcode());
+          const Instruction& inst = code_item_->InstructionAt(work_insn_idx_);
+          int opcode_flags = Instruction::FlagsOf(inst.Opcode());
 
           if ((opcode_flags & Instruction::kThrow) == 0 && CurrentInsnFlags()->IsInTry()) {
             saved_line_->CopyFromLine(work_line_.get());
@@ -990,14 +982,12 @@
 }
 
 bool MethodVerifier::ComputeWidthsAndCountOps() {
-  const uint16_t* insns = code_item_->insns_;
-  size_t insns_size = code_item_->insns_size_in_code_units_;
-  const Instruction* inst = Instruction::At(insns);
   size_t new_instance_count = 0;
   size_t monitor_enter_count = 0;
-  size_t dex_pc = 0;
 
-  while (dex_pc < insns_size) {
+  IterationRange<DexInstructionIterator> instructions = code_item_->Instructions();
+  DexInstructionIterator inst = instructions.begin();
+  for ( ; inst < instructions.end(); ++inst) {
     Instruction::Code opcode = inst->Opcode();
     switch (opcode) {
       case Instruction::APUT_OBJECT:
@@ -1019,15 +1009,14 @@
       default:
         break;
     }
-    size_t inst_size = inst->SizeInCodeUnits();
-    GetInstructionFlags(dex_pc).SetIsOpcode();
-    dex_pc += inst_size;
-    inst = inst->RelativeAt(inst_size);
+    GetInstructionFlags(inst.GetDexPC(instructions.begin())).SetIsOpcode();
   }
 
-  if (dex_pc != insns_size) {
+  if (inst != instructions.end()) {
+    const size_t insns_size = code_item_->insns_size_in_code_units_;
     Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "code did not end where expected ("
-                                      << dex_pc << " vs. " << insns_size << ")";
+                                      << inst.GetDexPC(instructions.begin()) << " vs. "
+                                      << insns_size << ")";
     return false;
   }
 
@@ -1105,15 +1094,13 @@
 
 template <bool kAllowRuntimeOnlyInstructions>
 bool MethodVerifier::VerifyInstructions() {
-  const Instruction* inst = Instruction::At(code_item_->insns_);
-
   /* Flag the start of the method as a branch target, and a GC point due to stack overflow errors */
   GetInstructionFlags(0).SetBranchTarget();
   GetInstructionFlags(0).SetCompileTimeInfoPoint();
-
-  uint32_t insns_size = code_item_->insns_size_in_code_units_;
-  for (uint32_t dex_pc = 0; dex_pc < insns_size;) {
-    if (!VerifyInstruction<kAllowRuntimeOnlyInstructions>(inst, dex_pc)) {
+  IterationRange<DexInstructionIterator> instructions = code_item_->Instructions();
+  for (auto inst = instructions.begin(); inst != instructions.end(); ++inst) {
+    const uint32_t dex_pc = inst.GetDexPC(instructions.begin());
+    if (!VerifyInstruction<kAllowRuntimeOnlyInstructions>(&*inst, dex_pc)) {
       DCHECK_NE(failures_.size(), 0U);
       return false;
     }
@@ -1134,8 +1121,6 @@
     } else if (inst->IsReturn()) {
       GetInstructionFlags(dex_pc).SetCompileTimeInfoPointAndReturn();
     }
-    dex_pc += inst->SizeInCodeUnits();
-    inst = inst->Next();
   }
   return true;
 }
@@ -1671,9 +1656,10 @@
   }
   vios->Stream() << "Dumping instructions and register lines:\n";
   ScopedIndentation indent1(vios);
-  const Instruction* inst = Instruction::At(code_item_->insns_);
-  for (size_t dex_pc = 0; dex_pc < code_item_->insns_size_in_code_units_;
-      dex_pc += inst->SizeInCodeUnits(), inst = inst->Next()) {
+
+  IterationRange<DexInstructionIterator> instructions = code_item_->Instructions();
+  for (auto inst = instructions.begin(); inst != instructions.end(); ++inst) {
+    const size_t dex_pc = inst.GetDexPC(instructions.begin());
     RegisterLine* reg_line = reg_table_.GetLine(dex_pc);
     if (reg_line != nullptr) {
       vios->Stream() << reg_line->Dump(this) << "\n";
@@ -1938,9 +1924,10 @@
      * we are almost certainly going to have some dead code.
      */
     int dead_start = -1;
-    uint32_t insn_idx = 0;
-    for (; insn_idx < insns_size;
-         insn_idx += Instruction::At(code_item_->insns_ + insn_idx)->SizeInCodeUnits()) {
+
+    IterationRange<DexInstructionIterator> instructions = code_item_->Instructions();
+    for (auto inst = instructions.begin(); inst != instructions.end(); ++inst) {
+      const uint32_t insn_idx = inst.GetDexPC(instructions.begin());
       /*
        * Switch-statement data doesn't get "visited" by scanner. It
        * may or may not be preceded by a padding NOP (for alignment).
@@ -1956,8 +1943,9 @@
       }
 
       if (!GetInstructionFlags(insn_idx).IsVisited()) {
-        if (dead_start < 0)
+        if (dead_start < 0) {
           dead_start = insn_idx;
+        }
       } else if (dead_start >= 0) {
         LogVerifyInfo() << "dead code " << reinterpret_cast<void*>(dead_start)
                         << "-" << reinterpret_cast<void*>(insn_idx - 1);
@@ -1965,8 +1953,9 @@
       }
     }
     if (dead_start >= 0) {
-      LogVerifyInfo() << "dead code " << reinterpret_cast<void*>(dead_start)
-                      << "-" << reinterpret_cast<void*>(insn_idx - 1);
+      LogVerifyInfo()
+          << "dead code " << reinterpret_cast<void*>(dead_start)
+          << "-" << reinterpret_cast<void*>(instructions.end().GetDexPC(instructions.begin()) - 1);
     }
     // To dump the state of the verify after a method, do something like:
     // if (dex_file_->PrettyMethod(dex_method_idx_) ==
@@ -2340,17 +2329,17 @@
         while (0 != prev_idx && !GetInstructionFlags(prev_idx).IsOpcode()) {
           prev_idx--;
         }
-        const Instruction* prev_inst = Instruction::At(code_item_->insns_ + prev_idx);
-        switch (prev_inst->Opcode()) {
+        const Instruction& prev_inst = code_item_->InstructionAt(prev_idx);
+        switch (prev_inst.Opcode()) {
           case Instruction::MOVE_OBJECT:
           case Instruction::MOVE_OBJECT_16:
           case Instruction::MOVE_OBJECT_FROM16:
-            if (prev_inst->VRegB() == inst->VRegA_11x()) {
+            if (prev_inst.VRegB() == inst->VRegA_11x()) {
               // Redo the copy. This won't change the register types, but update the lock status
               // for the aliased register.
               work_line_->CopyRegister1(this,
-                                        prev_inst->VRegA(),
-                                        prev_inst->VRegB(),
+                                        prev_inst.VRegA(),
+                                        prev_inst.VRegB(),
                                         kTypeCategoryRef);
             }
             break;
@@ -2648,7 +2637,7 @@
         break;
       }
 
-      const Instruction* instance_of_inst = Instruction::At(code_item_->insns_ + instance_of_idx);
+      const Instruction& instance_of_inst = code_item_->InstructionAt(instance_of_idx);
 
       /* Check for peep-hole pattern of:
        *    ...;
@@ -2663,9 +2652,9 @@
        *  - when vX == vY.
        */
       if (!CurrentInsnFlags()->IsBranchTarget() &&
-          (Instruction::INSTANCE_OF == instance_of_inst->Opcode()) &&
-          (inst->VRegA_21t() == instance_of_inst->VRegA_22c()) &&
-          (instance_of_inst->VRegA_22c() != instance_of_inst->VRegB_22c())) {
+          (Instruction::INSTANCE_OF == instance_of_inst.Opcode()) &&
+          (inst->VRegA_21t() == instance_of_inst.VRegA_22c()) &&
+          (instance_of_inst.VRegA_22c() != instance_of_inst.VRegB_22c())) {
         // Check the type of the instance-of is different than that of registers type, as if they
         // are the same there is no work to be done here. Check that the conversion is not to or
         // from an unresolved type as type information is imprecise. If the instance-of is to an
@@ -2676,9 +2665,9 @@
         // type is assignable to the original then allow optimization. This check is performed to
         // ensure that subsequent merges don't lose type information - such as becoming an
         // interface from a class that would lose information relevant to field checks.
-        const RegType& orig_type = work_line_->GetRegisterType(this, instance_of_inst->VRegB_22c());
+        const RegType& orig_type = work_line_->GetRegisterType(this, instance_of_inst.VRegB_22c());
         const RegType& cast_type = ResolveClass<CheckAccess::kYes>(
-            dex::TypeIndex(instance_of_inst->VRegC_22c()));
+            dex::TypeIndex(instance_of_inst.VRegC_22c()));
 
         if (!orig_type.Equals(cast_type) &&
             !cast_type.IsUnresolvedTypes() && !orig_type.IsUnresolvedTypes() &&
@@ -2695,7 +2684,7 @@
           }
           update_line->CopyFromLine(work_line_.get());
           update_line->SetRegisterType<LockOp::kKeep>(this,
-                                                      instance_of_inst->VRegB_22c(),
+                                                      instance_of_inst.VRegB_22c(),
                                                       cast_type);
           if (!GetInstructionFlags(instance_of_idx).IsBranchTarget() && 0 != instance_of_idx) {
             // See if instance-of was preceded by a move-object operation, common due to the small
@@ -2710,26 +2699,26 @@
                             work_insn_idx_)) {
               break;
             }
-            const Instruction* move_inst = Instruction::At(code_item_->insns_ + move_idx);
-            switch (move_inst->Opcode()) {
+            const Instruction& move_inst = code_item_->InstructionAt(move_idx);
+            switch (move_inst.Opcode()) {
               case Instruction::MOVE_OBJECT:
-                if (move_inst->VRegA_12x() == instance_of_inst->VRegB_22c()) {
+                if (move_inst.VRegA_12x() == instance_of_inst.VRegB_22c()) {
                   update_line->SetRegisterType<LockOp::kKeep>(this,
-                                                              move_inst->VRegB_12x(),
+                                                              move_inst.VRegB_12x(),
                                                               cast_type);
                 }
                 break;
               case Instruction::MOVE_OBJECT_FROM16:
-                if (move_inst->VRegA_22x() == instance_of_inst->VRegB_22c()) {
+                if (move_inst.VRegA_22x() == instance_of_inst.VRegB_22c()) {
                   update_line->SetRegisterType<LockOp::kKeep>(this,
-                                                              move_inst->VRegB_22x(),
+                                                              move_inst.VRegB_22x(),
                                                               cast_type);
                 }
                 break;
               case Instruction::MOVE_OBJECT_16:
-                if (move_inst->VRegA_32x() == instance_of_inst->VRegB_22c()) {
+                if (move_inst.VRegA_32x() == instance_of_inst.VRegB_22c()) {
                   update_line->SetRegisterType<LockOp::kKeep>(this,
-                                                              move_inst->VRegB_32x(),
+                                                              move_inst.VRegB_32x(),
                                                               cast_type);
                 }
                 break;
@@ -3648,7 +3637,7 @@
    *        and this change should not be used in those cases.
    */
   if ((opcode_flags & Instruction::kContinue) != 0) {
-    DCHECK_EQ(Instruction::At(code_item_->insns_ + work_insn_idx_), inst);
+    DCHECK_EQ(&code_item_->InstructionAt(work_insn_idx_), inst);
     uint32_t next_insn_idx = work_insn_idx_ + inst->SizeInCodeUnits();
     if (next_insn_idx >= code_item_->insns_size_in_code_units_) {
       Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Execution can walk off end of code area";
diff --git a/sigchainlib/Android.bp b/sigchainlib/Android.bp
index 0c64b7d..7aab726 100644
--- a/sigchainlib/Android.bp
+++ b/sigchainlib/Android.bp
@@ -25,9 +25,6 @@
         srcs: ["sigchain.cc"],
     },
     target: {
-        host: {
-            host_ldlibs: ["-ldl"],
-        },
         android: {
             shared_libs: ["liblog"],
         },
@@ -49,9 +46,6 @@
     defaults: ["art_defaults"],
     srcs: ["sigchain_dummy.cc"],
     target: {
-        host: {
-            host_ldlibs: ["-ldl"],
-        },
         android: {
             shared_libs: ["liblog"],
         },
diff --git a/simulator/Android.bp b/simulator/Android.bp
index a399289..74b5a90 100644
--- a/simulator/Android.bp
+++ b/simulator/Android.bp
@@ -73,7 +73,7 @@
     ],
 
     header_libs: ["libart_simulator_headers"],
-    export_include_dirs: ["."],  // TODO: Consider a proper separation.
+    export_include_dirs: ["."], // TODO: Consider a proper separation.
 }
 
 art_cc_library {
diff --git a/test/063-process-manager/src/Main.java b/test/063-process-manager/src/Main.java
index 1005b77..2cfc0d7 100644
--- a/test/063-process-manager/src/Main.java
+++ b/test/063-process-manager/src/Main.java
@@ -10,7 +10,7 @@
             ProcessBuilder pb = new ProcessBuilder("sleep", "0");
             Process proc = pb.start();
             proc.waitFor();
-            Thread.sleep(500);  // Consider checking for (and waiting on) the reaper state here.
+            waitForReaperTimedWaiting(true /* reaperMustExist */);
         }
 
         for (int i = 1; i <= 2; i++) {
@@ -32,6 +32,11 @@
         System.out.println("child died");
     }
 
+    private static boolean isReaperThread(Thread t) {
+        String name = t.getName();
+        return name.indexOf("process reaper") >= 0;
+    }
+
     static private void checkManager() {
         Map<Thread, StackTraceElement[]> traces = Thread.getAllStackTraces();
         boolean found = false;
@@ -39,8 +44,7 @@
         for (Map.Entry<Thread, StackTraceElement[]> entry :
                  traces.entrySet()) {
             Thread t = entry.getKey();
-            String name = t.getName();
-            if (name.indexOf("process reaper") >= 0) {
+            if (isReaperThread(t)) {
                 Thread.State state = t.getState();
                 System.out.println("process manager: " + state);
                 if (state != Thread.State.RUNNABLE && state != Thread.State.TIMED_WAITING) {
@@ -56,4 +60,34 @@
             System.out.println("process manager: nonexistent");
         }
     }
+
+    private static void waitForReaperTimedWaiting(boolean reaperMustExist) {
+        for (;;) {
+            Map<Thread, StackTraceElement[]> traces = Thread.getAllStackTraces();
+
+            boolean ok = true;
+            boolean found = false;
+
+            for (Thread t : traces.keySet()) {
+                if (isReaperThread(t)) {
+                    found = true;
+                    Thread.State state = t.getState();
+                    if (state != Thread.State.TIMED_WAITING) {
+                        ok = false;
+                        break;
+                    }
+                }
+            }
+
+            if (ok && (!reaperMustExist || found)) {
+                return;
+            }
+
+            try {
+                Thread.sleep(100);
+            } catch (Exception e) {
+                // Ignore.
+            }
+        }
+    }
 }
diff --git a/test/088-monitor-verification/src/Main.java b/test/088-monitor-verification/src/Main.java
index f5cbc2a..3f7bb56 100644
--- a/test/088-monitor-verification/src/Main.java
+++ b/test/088-monitor-verification/src/Main.java
@@ -25,7 +25,7 @@
     /**
      * Drives tests.
      */
-    public static void main(String[] args) {
+    public static void main(String[] args) throws Exception {
         System.loadLibrary(args[0]);
         if (!hasOatFile() || runtimeIsSoftFail() || isInterpreted()) {
             // Some tests ensure that the verifier was able to guarantee balanced locking by
@@ -40,6 +40,7 @@
         ensureJitCompiled(Main.class, "notExcessiveNesting");
         ensureJitCompiled(Main.class, "notNested");
         ensureJitCompiled(TwoPath.class, "twoPath");
+        ensureJitCompiled(Class.forName("OK"), "runBalancedJoin");
 
         Main m = new Main();
 
diff --git a/test/1930-monitor-info/src/art/Monitors.java b/test/1930-monitor-info/src/art/Monitors.java
index b28a3ee..7fe2b60 100644
--- a/test/1930-monitor-info/src/art/Monitors.java
+++ b/test/1930-monitor-info/src/art/Monitors.java
@@ -36,12 +36,40 @@
 
   public static class NamedLock {
     public final String name;
+    private volatile int calledNotify;
     public NamedLock(String name) {
       this.name = name;
+      calledNotify = 0;
     }
+
     public String toString() {
       return String.format("NamedLock[%s]", name);
     }
+
+    public final void DoWait() throws Exception {
+      final int v = calledNotify;
+      while (v == calledNotify) {
+        wait();
+      }
+    }
+
+    public final void DoWait(long t) throws Exception {
+      final int v = calledNotify;
+      final long target = System.currentTimeMillis() + (t / 2);
+      while (v == calledNotify && (t < 0 || System.currentTimeMillis() < target)) {
+        wait(t);
+      }
+    }
+
+    public final void DoNotifyAll() throws Exception {
+      calledNotify++;
+      notifyAll();
+    }
+
+    public final void DoNotify() throws Exception {
+      calledNotify++;
+      notify();
+    }
   }
 
   public static final class MonitorUsage {
@@ -91,7 +119,7 @@
   public static class LockController {
     private static enum Action { HOLD, RELEASE, NOTIFY, NOTIFY_ALL, WAIT, TIMED_WAIT }
 
-    public final Object lock;
+    public final NamedLock lock;
     public final long timeout;
     private final AtomicStampedReference<Action> action;
     private volatile Thread runner = null;
@@ -100,10 +128,10 @@
     private static final AtomicInteger cnt = new AtomicInteger(0);
     private volatile Throwable exe;
 
-    public LockController(Object lock) {
+    public LockController(NamedLock lock) {
       this(lock, 10 * 1000);
     }
-    public LockController(Object lock, long timeout) {
+    public LockController(NamedLock lock, long timeout) {
       this.lock = lock;
       this.timeout = timeout;
       this.action = new AtomicStampedReference(Action.HOLD, 0);
@@ -177,16 +205,16 @@
                       Thread.yield();
                       break;
                     case NOTIFY:
-                      lock.notify();
+                      lock.DoNotify();
                       break;
                     case NOTIFY_ALL:
-                      lock.notifyAll();
+                      lock.DoNotifyAll();
                       break;
                     case TIMED_WAIT:
-                      lock.wait(timeout);
+                      lock.DoWait(timeout);
                       break;
                     case WAIT:
-                      lock.wait();
+                      lock.DoWait();
                       break;
                     default:
                       throw new Error("Unknown action " + action);
diff --git a/test/1930-monitor-info/src/art/Test1930.java b/test/1930-monitor-info/src/art/Test1930.java
index a7fa1c7..ee03d73 100644
--- a/test/1930-monitor-info/src/art/Test1930.java
+++ b/test/1930-monitor-info/src/art/Test1930.java
@@ -96,7 +96,7 @@
         printMonitorUsage(lk);
         sem.release();
         try {
-          lk.wait();
+          lk.DoWait();
         } catch (Exception e) {
           throw new Error("Error waiting!", e);
         }
@@ -107,7 +107,7 @@
     sem.acquire();
     synchronized (lk) {
       printMonitorUsage(lk);
-      lk.notifyAll();
+      lk.DoNotifyAll();
     }
     t.join();
     printMonitorUsage(lk);
diff --git a/test/1931-monitor-events/src/art/Monitors.java b/test/1931-monitor-events/src/art/Monitors.java
index b28a3ee..7fe2b60 100644
--- a/test/1931-monitor-events/src/art/Monitors.java
+++ b/test/1931-monitor-events/src/art/Monitors.java
@@ -36,12 +36,40 @@
 
   public static class NamedLock {
     public final String name;
+    private volatile int calledNotify;
     public NamedLock(String name) {
       this.name = name;
+      calledNotify = 0;
     }
+
     public String toString() {
       return String.format("NamedLock[%s]", name);
     }
+
+    public final void DoWait() throws Exception {
+      final int v = calledNotify;
+      while (v == calledNotify) {
+        wait();
+      }
+    }
+
+    public final void DoWait(long t) throws Exception {
+      final int v = calledNotify;
+      final long target = System.currentTimeMillis() + (t / 2);
+      while (v == calledNotify && (t < 0 || System.currentTimeMillis() < target)) {
+        wait(t);
+      }
+    }
+
+    public final void DoNotifyAll() throws Exception {
+      calledNotify++;
+      notifyAll();
+    }
+
+    public final void DoNotify() throws Exception {
+      calledNotify++;
+      notify();
+    }
   }
 
   public static final class MonitorUsage {
@@ -91,7 +119,7 @@
   public static class LockController {
     private static enum Action { HOLD, RELEASE, NOTIFY, NOTIFY_ALL, WAIT, TIMED_WAIT }
 
-    public final Object lock;
+    public final NamedLock lock;
     public final long timeout;
     private final AtomicStampedReference<Action> action;
     private volatile Thread runner = null;
@@ -100,10 +128,10 @@
     private static final AtomicInteger cnt = new AtomicInteger(0);
     private volatile Throwable exe;
 
-    public LockController(Object lock) {
+    public LockController(NamedLock lock) {
       this(lock, 10 * 1000);
     }
-    public LockController(Object lock, long timeout) {
+    public LockController(NamedLock lock, long timeout) {
       this.lock = lock;
       this.timeout = timeout;
       this.action = new AtomicStampedReference(Action.HOLD, 0);
@@ -177,16 +205,16 @@
                       Thread.yield();
                       break;
                     case NOTIFY:
-                      lock.notify();
+                      lock.DoNotify();
                       break;
                     case NOTIFY_ALL:
-                      lock.notifyAll();
+                      lock.DoNotifyAll();
                       break;
                     case TIMED_WAIT:
-                      lock.wait(timeout);
+                      lock.DoWait(timeout);
                       break;
                     case WAIT:
-                      lock.wait();
+                      lock.DoWait();
                       break;
                     default:
                       throw new Error("Unknown action " + action);
diff --git a/test/1932-monitor-events-misc/src/art/Monitors.java b/test/1932-monitor-events-misc/src/art/Monitors.java
index b28a3ee..7fe2b60 100644
--- a/test/1932-monitor-events-misc/src/art/Monitors.java
+++ b/test/1932-monitor-events-misc/src/art/Monitors.java
@@ -36,12 +36,40 @@
 
   public static class NamedLock {
     public final String name;
+    private volatile int calledNotify;
     public NamedLock(String name) {
       this.name = name;
+      calledNotify = 0;
     }
+
     public String toString() {
       return String.format("NamedLock[%s]", name);
     }
+
+    public final void DoWait() throws Exception {
+      final int v = calledNotify;
+      while (v == calledNotify) {
+        wait();
+      }
+    }
+
+    public final void DoWait(long t) throws Exception {
+      final int v = calledNotify;
+      final long target = System.currentTimeMillis() + (t / 2);
+      while (v == calledNotify && (t < 0 || System.currentTimeMillis() < target)) {
+        wait(t);
+      }
+    }
+
+    public final void DoNotifyAll() throws Exception {
+      calledNotify++;
+      notifyAll();
+    }
+
+    public final void DoNotify() throws Exception {
+      calledNotify++;
+      notify();
+    }
   }
 
   public static final class MonitorUsage {
@@ -91,7 +119,7 @@
   public static class LockController {
     private static enum Action { HOLD, RELEASE, NOTIFY, NOTIFY_ALL, WAIT, TIMED_WAIT }
 
-    public final Object lock;
+    public final NamedLock lock;
     public final long timeout;
     private final AtomicStampedReference<Action> action;
     private volatile Thread runner = null;
@@ -100,10 +128,10 @@
     private static final AtomicInteger cnt = new AtomicInteger(0);
     private volatile Throwable exe;
 
-    public LockController(Object lock) {
+    public LockController(NamedLock lock) {
       this(lock, 10 * 1000);
     }
-    public LockController(Object lock, long timeout) {
+    public LockController(NamedLock lock, long timeout) {
       this.lock = lock;
       this.timeout = timeout;
       this.action = new AtomicStampedReference(Action.HOLD, 0);
@@ -177,16 +205,16 @@
                       Thread.yield();
                       break;
                     case NOTIFY:
-                      lock.notify();
+                      lock.DoNotify();
                       break;
                     case NOTIFY_ALL:
-                      lock.notifyAll();
+                      lock.DoNotifyAll();
                       break;
                     case TIMED_WAIT:
-                      lock.wait(timeout);
+                      lock.DoWait(timeout);
                       break;
                     case WAIT:
-                      lock.wait();
+                      lock.DoWait();
                       break;
                     default:
                       throw new Error("Unknown action " + action);
diff --git a/test/1933-monitor-current-contended/src/art/Monitors.java b/test/1933-monitor-current-contended/src/art/Monitors.java
index b28a3ee..7fe2b60 100644
--- a/test/1933-monitor-current-contended/src/art/Monitors.java
+++ b/test/1933-monitor-current-contended/src/art/Monitors.java
@@ -36,12 +36,40 @@
 
   public static class NamedLock {
     public final String name;
+    private volatile int calledNotify;
     public NamedLock(String name) {
       this.name = name;
+      calledNotify = 0;
     }
+
     public String toString() {
       return String.format("NamedLock[%s]", name);
     }
+
+    public final void DoWait() throws Exception {
+      final int v = calledNotify;
+      while (v == calledNotify) {
+        wait();
+      }
+    }
+
+    public final void DoWait(long t) throws Exception {
+      final int v = calledNotify;
+      final long target = System.currentTimeMillis() + (t / 2);
+      while (v == calledNotify && (t < 0 || System.currentTimeMillis() < target)) {
+        wait(t);
+      }
+    }
+
+    public final void DoNotifyAll() throws Exception {
+      calledNotify++;
+      notifyAll();
+    }
+
+    public final void DoNotify() throws Exception {
+      calledNotify++;
+      notify();
+    }
   }
 
   public static final class MonitorUsage {
@@ -91,7 +119,7 @@
   public static class LockController {
     private static enum Action { HOLD, RELEASE, NOTIFY, NOTIFY_ALL, WAIT, TIMED_WAIT }
 
-    public final Object lock;
+    public final NamedLock lock;
     public final long timeout;
     private final AtomicStampedReference<Action> action;
     private volatile Thread runner = null;
@@ -100,10 +128,10 @@
     private static final AtomicInteger cnt = new AtomicInteger(0);
     private volatile Throwable exe;
 
-    public LockController(Object lock) {
+    public LockController(NamedLock lock) {
       this(lock, 10 * 1000);
     }
-    public LockController(Object lock, long timeout) {
+    public LockController(NamedLock lock, long timeout) {
       this.lock = lock;
       this.timeout = timeout;
       this.action = new AtomicStampedReference(Action.HOLD, 0);
@@ -177,16 +205,16 @@
                       Thread.yield();
                       break;
                     case NOTIFY:
-                      lock.notify();
+                      lock.DoNotify();
                       break;
                     case NOTIFY_ALL:
-                      lock.notifyAll();
+                      lock.DoNotifyAll();
                       break;
                     case TIMED_WAIT:
-                      lock.wait(timeout);
+                      lock.DoWait(timeout);
                       break;
                     case WAIT:
-                      lock.wait();
+                      lock.DoWait();
                       break;
                     default:
                       throw new Error("Unknown action " + action);
diff --git a/test/1933-monitor-current-contended/src/art/Test1933.java b/test/1933-monitor-current-contended/src/art/Test1933.java
index e21c395..194a043 100644
--- a/test/1933-monitor-current-contended/src/art/Test1933.java
+++ b/test/1933-monitor-current-contended/src/art/Test1933.java
@@ -34,9 +34,13 @@
      controller1.waitForLockToBeHeld();
      controller1.DoWait();
      controller1.waitForNotifySleep();
-     System.out.println("c1 is contending for monitor: " + controller1.getWorkerContendedMonitor());
+     // Spurious wakeups can hurt us here. Just retry until we get the result we expect. The test
+     // will timeout eventually.
+     Object mon = controller1.getWorkerContendedMonitor();
+     for (; mon == null; mon = controller1.getWorkerContendedMonitor()) { Thread.yield(); }
+     System.out.println("c1 is contending for monitor: " + mon);
      synchronized (lk) {
-       lk.notifyAll();
+       lk.DoNotifyAll();
      }
      controller1.DoUnlock();
   }
diff --git a/test/1935-get-set-current-frame-jit/expected.txt b/test/1935-get-set-current-frame-jit/expected.txt
new file mode 100644
index 0000000..fed993c
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/expected.txt
@@ -0,0 +1,7 @@
+JNI_OnLoad called
+From GetLocalInt(), value is 42
+isInterpreted? true
+	Value is '42'
+Setting TARGET to 1337
+isInterpreted? true
+	Value is '1337'
diff --git a/test/1935-get-set-current-frame-jit/info.txt b/test/1935-get-set-current-frame-jit/info.txt
new file mode 100644
index 0000000..7342af7
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/info.txt
@@ -0,0 +1,2 @@
+Tests for jvmti get/set Local variable in the currently executing method frame.
+
diff --git a/test/1935-get-set-current-frame-jit/run b/test/1935-get-set-current-frame-jit/run
new file mode 100755
index 0000000..51875a7
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Ask for stack traces to be dumped to a file rather than to stdout.
+./default-run "$@" --jvmti
diff --git a/test/1935-get-set-current-frame-jit/src/Main.java b/test/1935-get-set-current-frame-jit/src/Main.java
new file mode 100644
index 0000000..eb0a637
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/src/Main.java
@@ -0,0 +1,162 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import art.Locals;
+import art.StackTrace;
+import art.Suspension;
+import java.lang.reflect.Constructor;
+import java.lang.reflect.Executable;
+import java.lang.reflect.Method;
+import java.nio.ByteBuffer;
+import java.util.concurrent.Semaphore;
+import java.util.Arrays;
+import java.util.Collection;
+import java.util.List;
+import java.util.Set;
+import java.util.function.Function;
+import java.util.function.Predicate;
+import java.util.function.Supplier;
+import java.util.function.Consumer;
+
+public class Main {
+  public static final int SET_VALUE = 1337;
+  public static final String TARGET_VAR = "TARGET";
+
+  public static void main(String[] args) throws Exception {
+    System.loadLibrary(args[0]);
+    Locals.EnableLocalVariableAccess();
+    runGet();
+    runSet();
+  }
+
+  public static void reportValue(Object val) {
+    System.out.println("\tValue is '" + val + "'");
+  }
+
+  public static class IntRunner implements Runnable {
+    private volatile boolean continueBusyLoop;
+    private volatile boolean inBusyLoop;
+    public IntRunner() {
+      this.continueBusyLoop = true;
+      this.inBusyLoop = false;
+    }
+    public void run() {
+      int TARGET = 42;
+      // We will suspend the thread during this loop.
+      while (continueBusyLoop) {
+        inBusyLoop = true;
+      }
+      int i = 0;
+      while (Main.isInterpreted() && i < 10000) {
+        Main.ensureJitCompiled(IntRunner.class, "run");
+        i++;
+      }
+      // We shouldn't be doing OSR since we are using JVMTI and the get/set local will push us to
+      // interpreter.
+      System.out.println("isInterpreted? " + Main.isInterpreted());
+      reportValue(TARGET);
+    }
+    public void waitForBusyLoopStart() { while (!inBusyLoop) {} }
+    public void finish() {
+      continueBusyLoop = false;
+    }
+  }
+
+  public static void runGet() throws Exception {
+    Method target = IntRunner.class.getDeclaredMethod("run");
+    // Get Int
+    IntRunner int_runner = new IntRunner();
+    Thread target_get = new Thread(int_runner, "GetLocalInt - Target");
+    target_get.start();
+    int_runner.waitForBusyLoopStart();
+    try {
+      Suspension.suspend(target_get);
+    } catch (Exception e) {
+      System.out.println("FAIL: got " + e);
+      e.printStackTrace();
+      int_runner.finish();
+      target_get.join();
+      return;
+    }
+    try {
+      StackTrace.StackFrameData frame = FindStackFrame(target_get, target);
+      int depth = frame.depth;
+      if (depth != 0) { throw new Error("Expected depth 0 but got " + depth); }
+      int slot = FindSlot(frame);
+      int value = Locals.GetLocalVariableInt(target_get, depth, slot);
+      System.out.println("From GetLocalInt(), value is " + value);
+    } finally {
+      Suspension.resume(target_get);
+      int_runner.finish();
+      target_get.join();
+    }
+  }
+
+  public static void runSet() throws Exception {
+    Method target = IntRunner.class.getDeclaredMethod("run");
+    // Set Int
+    IntRunner int_runner = new IntRunner();
+    Thread target_set = new Thread(int_runner, "SetLocalInt - Target");
+    target_set.start();
+    int_runner.waitForBusyLoopStart();
+    try {
+      Suspension.suspend(target_set);
+    } catch (Exception e) {
+      System.out.println("FAIL: got " + e);
+      e.printStackTrace();
+      int_runner.finish();
+      target_set.join();
+      return;
+    }
+    try {
+      StackTrace.StackFrameData frame = FindStackFrame(target_set, target);
+      int depth = frame.depth;
+      if (depth != 0) { throw new Error("Expected depth 0 but got " + depth); }
+      int slot = FindSlot(frame);
+      System.out.println("Setting TARGET to " + SET_VALUE);
+      Locals.SetLocalVariableInt(target_set, depth, slot, SET_VALUE);
+    } finally {
+      Suspension.resume(target_set);
+      int_runner.finish();
+      target_set.join();
+    }
+  }
+
+  public static int FindSlot(StackTrace.StackFrameData frame) throws Exception {
+    long loc = frame.current_location;
+    for (Locals.VariableDescription var : Locals.GetLocalVariableTable(frame.method)) {
+      if (var.start_location <= loc &&
+          var.length + var.start_location > loc &&
+          var.name.equals(TARGET_VAR)) {
+        return var.slot;
+      }
+    }
+    throw new Error(
+        "Unable to find variable " + TARGET_VAR + " in " + frame.method + " at loc " + loc);
+  }
+
+  private static StackTrace.StackFrameData FindStackFrame(Thread thr, Method target) {
+    for (StackTrace.StackFrameData frame : StackTrace.GetStackTrace(thr)) {
+      if (frame.method.equals(target)) {
+        return frame;
+      }
+    }
+    throw new Error("Unable to find stack frame in method " + target + " on thread " + thr);
+  }
+
+  public static native void ensureJitCompiled(Class k, String f);
+  public static native boolean isInterpreted();
+}
diff --git a/test/1935-get-set-current-frame-jit/src/art/Breakpoint.java b/test/1935-get-set-current-frame-jit/src/art/Breakpoint.java
new file mode 100644
index 0000000..bbb89f7
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/src/art/Breakpoint.java
@@ -0,0 +1,202 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Executable;
+import java.util.HashSet;
+import java.util.Set;
+import java.util.Objects;
+
+public class Breakpoint {
+  public static class Manager {
+    public static class BP {
+      public final Executable method;
+      public final long location;
+
+      public BP(Executable method) {
+        this(method, getStartLocation(method));
+      }
+
+      public BP(Executable method, long location) {
+        this.method = method;
+        this.location = location;
+      }
+
+      @Override
+      public boolean equals(Object other) {
+        return (other instanceof BP) &&
+            method.equals(((BP)other).method) &&
+            location == ((BP)other).location;
+      }
+
+      @Override
+      public String toString() {
+        return method.toString() + " @ " + getLine();
+      }
+
+      @Override
+      public int hashCode() {
+        return Objects.hash(method, location);
+      }
+
+      public int getLine() {
+        try {
+          LineNumber[] lines = getLineNumberTable(method);
+          int best = -1;
+          for (LineNumber l : lines) {
+            if (l.location > location) {
+              break;
+            } else {
+              best = l.line;
+            }
+          }
+          return best;
+        } catch (Exception e) {
+          return -1;
+        }
+      }
+    }
+
+    private Set<BP> breaks = new HashSet<>();
+
+    public void setBreakpoints(BP... bs) {
+      for (BP b : bs) {
+        if (breaks.add(b)) {
+          Breakpoint.setBreakpoint(b.method, b.location);
+        }
+      }
+    }
+    public void setBreakpoint(Executable method, long location) {
+      setBreakpoints(new BP(method, location));
+    }
+
+    public void clearBreakpoints(BP... bs) {
+      for (BP b : bs) {
+        if (breaks.remove(b)) {
+          Breakpoint.clearBreakpoint(b.method, b.location);
+        }
+      }
+    }
+    public void clearBreakpoint(Executable method, long location) {
+      clearBreakpoints(new BP(method, location));
+    }
+
+    public void clearAllBreakpoints() {
+      clearBreakpoints(breaks.toArray(new BP[0]));
+    }
+  }
+
+  public static void startBreakpointWatch(Class<?> methodClass,
+                                          Executable breakpointReached,
+                                          Thread thr) {
+    startBreakpointWatch(methodClass, breakpointReached, false, thr);
+  }
+
+  /**
+   * Enables the trapping of breakpoint events.
+   *
+   * If allowRecursive == true then breakpoints will be sent even if one is currently being handled.
+   */
+  public static native void startBreakpointWatch(Class<?> methodClass,
+                                                 Executable breakpointReached,
+                                                 boolean allowRecursive,
+                                                 Thread thr);
+  public static native void stopBreakpointWatch(Thread thr);
+
+  public static final class LineNumber implements Comparable<LineNumber> {
+    public final long location;
+    public final int line;
+
+    private LineNumber(long loc, int line) {
+      this.location = loc;
+      this.line = line;
+    }
+
+    public boolean equals(Object other) {
+      return other instanceof LineNumber && ((LineNumber)other).line == line &&
+          ((LineNumber)other).location == location;
+    }
+
+    public int compareTo(LineNumber other) {
+      int v = Integer.valueOf(line).compareTo(Integer.valueOf(other.line));
+      if (v != 0) {
+        return v;
+      } else {
+        return Long.valueOf(location).compareTo(Long.valueOf(other.location));
+      }
+    }
+  }
+
+  public static native void setBreakpoint(Executable m, long loc);
+  public static void setBreakpoint(Executable m, LineNumber l) {
+    setBreakpoint(m, l.location);
+  }
+
+  public static native void clearBreakpoint(Executable m, long loc);
+  public static void clearBreakpoint(Executable m, LineNumber l) {
+    clearBreakpoint(m, l.location);
+  }
+
+  private static native Object[] getLineNumberTableNative(Executable m);
+  public static LineNumber[] getLineNumberTable(Executable m) {
+    Object[] nativeTable = getLineNumberTableNative(m);
+    long[] location = (long[])(nativeTable[0]);
+    int[] lines = (int[])(nativeTable[1]);
+    if (lines.length != location.length) {
+      throw new Error("Lines and locations have different lengths!");
+    }
+    LineNumber[] out = new LineNumber[lines.length];
+    for (int i = 0; i < lines.length; i++) {
+      out[i] = new LineNumber(location[i], lines[i]);
+    }
+    return out;
+  }
+
+  public static native long getStartLocation(Executable m);
+
+  public static int locationToLine(Executable m, long location) {
+    try {
+      Breakpoint.LineNumber[] lines = Breakpoint.getLineNumberTable(m);
+      int best = -1;
+      for (Breakpoint.LineNumber l : lines) {
+        if (l.location > location) {
+          break;
+        } else {
+          best = l.line;
+        }
+      }
+      return best;
+    } catch (Exception e) {
+      return -1;
+    }
+  }
+
+  public static long lineToLocation(Executable m, int line) throws Exception {
+    try {
+      Breakpoint.LineNumber[] lines = Breakpoint.getLineNumberTable(m);
+      for (Breakpoint.LineNumber l : lines) {
+        if (l.line == line) {
+          return l.location;
+        }
+      }
+      throw new Exception("Unable to find line " + line + " in " + m);
+    } catch (Exception e) {
+      throw new Exception("Unable to get line number info for " + m, e);
+    }
+  }
+}
+
diff --git a/test/1935-get-set-current-frame-jit/src/art/Locals.java b/test/1935-get-set-current-frame-jit/src/art/Locals.java
new file mode 100644
index 0000000..22e21be
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/src/art/Locals.java
@@ -0,0 +1,121 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Executable;
+import java.util.Objects;
+
+public class Locals {
+  public static native void EnableLocalVariableAccess();
+
+  public static class VariableDescription {
+    public final long start_location;
+    public final int length;
+    public final String name;
+    public final String signature;
+    public final String generic_signature;
+    public final int slot;
+
+    public VariableDescription(
+        long start, int length, String name, String sig, String gen_sig, int slot) {
+      this.start_location = start;
+      this.length = length;
+      this.name = name;
+      this.signature = sig;
+      this.generic_signature = gen_sig;
+      this.slot = slot;
+    }
+
+    @Override
+    public String toString() {
+      return String.format(
+          "VariableDescription { " +
+            "Sig: '%s', Name: '%s', Gen_sig: '%s', slot: %d, start: %d, len: %d" +
+          "}",
+          this.signature,
+          this.name,
+          this.generic_signature,
+          this.slot,
+          this.start_location,
+          this.length);
+    }
+    public boolean equals(Object other) {
+      if (!(other instanceof VariableDescription)) {
+        return false;
+      } else {
+        VariableDescription v = (VariableDescription)other;
+        return Objects.equals(v.signature, signature) &&
+            Objects.equals(v.name, name) &&
+            Objects.equals(v.generic_signature, generic_signature) &&
+            v.slot == slot &&
+            v.start_location == start_location &&
+            v.length == length;
+      }
+    }
+    public int hashCode() {
+      return Objects.hash(this.signature, this.name, this.generic_signature, this.slot,
+          this.start_location, this.length);
+    }
+  }
+
+  public static native VariableDescription[] GetLocalVariableTable(Executable e);
+
+  public static VariableDescription GetVariableAtLine(
+      Executable e, String name, String sig, int line) throws Exception {
+    return GetVariableAtLocation(e, name, sig, Breakpoint.lineToLocation(e, line));
+  }
+
+  public static VariableDescription GetVariableAtLocation(
+      Executable e, String name, String sig, long loc) {
+    VariableDescription[] vars = GetLocalVariableTable(e);
+    for (VariableDescription var : vars) {
+      if (var.start_location <= loc &&
+          var.length + var.start_location > loc &&
+          var.name.equals(name) &&
+          var.signature.equals(sig)) {
+        return var;
+      }
+    }
+    throw new Error(
+        "Unable to find variable " + name + " (sig: " + sig + ") in " + e + " at loc " + loc);
+  }
+
+  public static native int GetLocalVariableInt(Thread thr, int depth, int slot);
+  public static native long GetLocalVariableLong(Thread thr, int depth, int slot);
+  public static native float GetLocalVariableFloat(Thread thr, int depth, int slot);
+  public static native double GetLocalVariableDouble(Thread thr, int depth, int slot);
+  public static native Object GetLocalVariableObject(Thread thr, int depth, int slot);
+  public static native Object GetLocalInstance(Thread thr, int depth);
+
+  public static void SetLocalVariableInt(Thread thr, int depth, int slot, Object val) {
+    SetLocalVariableInt(thr, depth, slot, ((Number)val).intValue());
+  }
+  public static void SetLocalVariableLong(Thread thr, int depth, int slot, Object val) {
+    SetLocalVariableLong(thr, depth, slot, ((Number)val).longValue());
+  }
+  public static void SetLocalVariableFloat(Thread thr, int depth, int slot, Object val) {
+    SetLocalVariableFloat(thr, depth, slot, ((Number)val).floatValue());
+  }
+  public static void SetLocalVariableDouble(Thread thr, int depth, int slot, Object val) {
+    SetLocalVariableDouble(thr, depth, slot, ((Number)val).doubleValue());
+  }
+  public static native void SetLocalVariableInt(Thread thr, int depth, int slot, int val);
+  public static native void SetLocalVariableLong(Thread thr, int depth, int slot, long val);
+  public static native void SetLocalVariableFloat(Thread thr, int depth, int slot, float val);
+  public static native void SetLocalVariableDouble(Thread thr, int depth, int slot, double val);
+  public static native void SetLocalVariableObject(Thread thr, int depth, int slot, Object val);
+}
diff --git a/test/1935-get-set-current-frame-jit/src/art/StackTrace.java b/test/1935-get-set-current-frame-jit/src/art/StackTrace.java
new file mode 100644
index 0000000..2ea2f20
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/src/art/StackTrace.java
@@ -0,0 +1,68 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+import java.lang.reflect.Field;
+import java.lang.reflect.Executable;
+
+public class StackTrace {
+  public static class StackFrameData {
+    public final Thread thr;
+    public final Executable method;
+    public final long current_location;
+    public final int depth;
+
+    public StackFrameData(Thread thr, Executable e, long loc, int depth) {
+      this.thr = thr;
+      this.method = e;
+      this.current_location = loc;
+      this.depth = depth;
+    }
+    @Override
+    public String toString() {
+      return String.format(
+          "StackFrameData { thr: '%s', method: '%s', loc: %d, depth: %d }",
+          this.thr,
+          this.method,
+          this.current_location,
+          this.depth);
+    }
+  }
+
+  public static native int GetStackDepth(Thread thr);
+
+  private static native StackFrameData[] nativeGetStackTrace(Thread thr);
+
+  public static StackFrameData[] GetStackTrace(Thread thr) {
+    // The RI seems to give inconsistent (and sometimes nonsensical) results if the thread is not
+    // suspended. The spec says that not being suspended is fine but since we want this to be
+    // consistent we will suspend for the RI.
+    boolean suspend_thread =
+        !System.getProperty("java.vm.name").equals("Dalvik") &&
+        !thr.equals(Thread.currentThread()) &&
+        !Suspension.isSuspended(thr);
+    if (suspend_thread) {
+      Suspension.suspend(thr);
+    }
+    StackFrameData[] out = nativeGetStackTrace(thr);
+    if (suspend_thread) {
+      Suspension.resume(thr);
+    }
+    return out;
+  }
+}
+
diff --git a/test/1935-get-set-current-frame-jit/src/art/Suspension.java b/test/1935-get-set-current-frame-jit/src/art/Suspension.java
new file mode 100644
index 0000000..16e62cc
--- /dev/null
+++ b/test/1935-get-set-current-frame-jit/src/art/Suspension.java
@@ -0,0 +1,30 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package art;
+
+public class Suspension {
+  // Suspends a thread using jvmti.
+  public native static void suspend(Thread thr);
+
+  // Resumes a thread using jvmti.
+  public native static void resume(Thread thr);
+
+  public native static boolean isSuspended(Thread thr);
+
+  public native static int[] suspendList(Thread... threads);
+  public native static int[] resumeList(Thread... threads);
+}
diff --git a/test/529-checker-unresolved/src/Main.java b/test/529-checker-unresolved/src/Main.java
index c2683ac..255ce78 100644
--- a/test/529-checker-unresolved/src/Main.java
+++ b/test/529-checker-unresolved/src/Main.java
@@ -45,21 +45,21 @@
   }
 
   /// CHECK-START: void Main.callUnresolvedStaticFieldAccess() register (before)
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimByte
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimChar
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimInt
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimLong
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimFloat
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimDouble
-  /// CHECK:        UnresolvedStaticFieldSet field_type:PrimNot
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Int8
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Uint16
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Int32
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Int64
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Float32
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Float64
+  /// CHECK:        UnresolvedStaticFieldSet field_type:Reference
 
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimByte
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimChar
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimInt
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimLong
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimFloat
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimDouble
-  /// CHECK:        UnresolvedStaticFieldGet field_type:PrimNot
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Int8
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Uint16
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Int32
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Int64
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Float32
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Float64
+  /// CHECK:        UnresolvedStaticFieldGet field_type:Reference
   static public void callUnresolvedStaticFieldAccess() {
     Object o = new Object();
     UnresolvedClass.staticByte = (byte)1;
@@ -90,21 +90,21 @@
   }
 
   /// CHECK-START: void Main.callUnresolvedInstanceFieldAccess(UnresolvedClass) register (before)
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimByte
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimChar
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimInt
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimLong
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimFloat
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimDouble
-  /// CHECK:        UnresolvedInstanceFieldSet field_type:PrimNot
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Int8
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Uint16
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Int32
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Int64
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Float32
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Float64
+  /// CHECK:        UnresolvedInstanceFieldSet field_type:Reference
 
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimByte
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimChar
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimInt
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimLong
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimFloat
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimDouble
-  /// CHECK:        UnresolvedInstanceFieldGet field_type:PrimNot
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Int8
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Uint16
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Int32
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Int64
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Float32
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Float64
+  /// CHECK:        UnresolvedInstanceFieldGet field_type:Reference
   static public void callUnresolvedInstanceFieldAccess(UnresolvedClass c) {
     Object o = new Object();
     c.instanceByte = (byte)1;
diff --git a/test/566-polymorphic-inlining/run b/test/566-polymorphic-inlining/run
new file mode 100644
index 0000000..2919f46
--- /dev/null
+++ b/test/566-polymorphic-inlining/run
@@ -0,0 +1,20 @@
+#!/bin/bash
+#
+# Copyright 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# -Xjitinitialsize:32M to prevent profiling info creation failure.
+exec ${RUN} \
+  --runtime-option -Xjitinitialsize:32M \
+  "${@}"
diff --git a/test/660-checker-simd-sad-char/src/Main.java b/test/660-checker-simd-sad-char/src/Main.java
index bb0c58f..2535d49 100644
--- a/test/660-checker-simd-sad-char/src/Main.java
+++ b/test/660-checker-simd-sad-char/src/Main.java
@@ -23,7 +23,7 @@
 
   // TODO: consider unsigned SAD too, b/64091002
 
-  private static char sadShort2Short(char[] s1, char[] s2) {
+  private static char sadChar2Char(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     char sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -32,7 +32,7 @@
     return sad;
   }
 
-  private static char sadShort2ShortAlt(char[] s1, char[] s2) {
+  private static char sadChar2CharAlt(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     char sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -43,7 +43,7 @@
     return sad;
   }
 
-  private static char sadShort2ShortAlt2(char[] s1, char[] s2) {
+  private static char sadChar2CharAlt2(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     char sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -56,7 +56,7 @@
     return sad;
   }
 
-  /// CHECK-START: int Main.sadShort2Int(char[], char[]) loop_optimization (before)
+  /// CHECK-START: int Main.sadChar2Int(char[], char[]) loop_optimization (before)
   /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
   /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
   /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
@@ -68,9 +68,9 @@
   /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
   /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
   //
-  /// CHECK-START-ARM64: int Main.sadShort2Int(char[], char[]) loop_optimization (after)
+  /// CHECK-START-ARM64: int Main.sadChar2Int(char[], char[]) loop_optimization (after)
   /// CHECK-NOT: VecSADAccumulate
-  private static int sadShort2Int(char[] s1, char[] s2) {
+  private static int sadChar2Int(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     int sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -79,7 +79,7 @@
     return sad;
   }
 
-  /// CHECK-START: int Main.sadShort2IntAlt(char[], char[]) loop_optimization (before)
+  /// CHECK-START: int Main.sadChar2IntAlt(char[], char[]) loop_optimization (before)
   /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
   /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
   /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
@@ -91,9 +91,9 @@
   /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
   /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
   //
-  /// CHECK-START-ARM64: int Main.sadShort2IntAlt(char[], char[]) loop_optimization (after)
+  /// CHECK-START-ARM64: int Main.sadChar2IntAlt(char[], char[]) loop_optimization (after)
   /// CHECK-NOT: VecSADAccumulate
-  private static int sadShort2IntAlt(char[] s1, char[] s2) {
+  private static int sadChar2IntAlt(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     int sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -104,7 +104,7 @@
     return sad;
   }
 
-  /// CHECK-START: int Main.sadShort2IntAlt2(char[], char[]) loop_optimization (before)
+  /// CHECK-START: int Main.sadChar2IntAlt2(char[], char[]) loop_optimization (before)
   /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
   /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
   /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
@@ -116,9 +116,9 @@
   /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
   /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
   //
-  /// CHECK-START-ARM64: int Main.sadShort2IntAlt2(char[], char[]) loop_optimization (after)
+  /// CHECK-START-ARM64: int Main.sadChar2IntAlt2(char[], char[]) loop_optimization (after)
   /// CHECK-NOT: VecSADAccumulate
-  private static int sadShort2IntAlt2(char[] s1, char[] s2) {
+  private static int sadChar2IntAlt2(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     int sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -131,7 +131,7 @@
     return sad;
   }
 
-  /// CHECK-START: long Main.sadShort2Long(char[], char[]) loop_optimization (before)
+  /// CHECK-START: long Main.sadChar2Long(char[], char[]) loop_optimization (before)
   /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
   /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
   /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 0                 loop:none
@@ -146,9 +146,9 @@
   /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
   /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
   //
-  /// CHECK-START-ARM64: long Main.sadShort2Long(char[], char[]) loop_optimization (after)
+  /// CHECK-START-ARM64: long Main.sadChar2Long(char[], char[]) loop_optimization (after)
   /// CHECK-NOT: VecSADAccumulate
-  private static long sadShort2Long(char[] s1, char[] s2) {
+  private static long sadChar2Long(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     long sad = 0;
     for (int i = 0; i < min_length; i++) {
@@ -159,7 +159,7 @@
     return sad;
   }
 
-  /// CHECK-START: long Main.sadShort2LongAt1(char[], char[]) loop_optimization (before)
+  /// CHECK-START: long Main.sadChar2LongAt1(char[], char[]) loop_optimization (before)
   /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
   /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
   /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 1                 loop:none
@@ -174,9 +174,9 @@
   /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
   /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
   //
-  /// CHECK-START-ARM64: long Main.sadShort2LongAt1(char[], char[]) loop_optimization (after)
+  /// CHECK-START-ARM64: long Main.sadChar2LongAt1(char[], char[]) loop_optimization (after)
   /// CHECK-NOT: VecSADAccumulate
-  private static long sadShort2LongAt1(char[] s1, char[] s2) {
+  private static long sadChar2LongAt1(char[] s1, char[] s2) {
     int min_length = Math.min(s1.length, s2.length);
     long sad = 1;  // starts at 1
     for (int i = 0; i < min_length; i++) {
@@ -191,22 +191,22 @@
     // Cross-test the two most extreme values individually.
     char[] s1 = { 0, 0x8000, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 };
     char[] s2 = { 0, 0x7fff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 };
-    expectEquals(1, sadShort2Short(s1, s2));
-    expectEquals(1, sadShort2Short(s2, s1));
-    expectEquals(1, sadShort2ShortAlt(s1, s2));
-    expectEquals(1, sadShort2ShortAlt(s2, s1));
-    expectEquals(1, sadShort2ShortAlt2(s1, s2));
-    expectEquals(1, sadShort2ShortAlt2(s2, s1));
-    expectEquals(1, sadShort2Int(s1, s2));
-    expectEquals(1, sadShort2Int(s2, s1));
-    expectEquals(1, sadShort2IntAlt(s1, s2));
-    expectEquals(1, sadShort2IntAlt(s2, s1));
-    expectEquals(1, sadShort2IntAlt2(s1, s2));
-    expectEquals(1, sadShort2IntAlt2(s2, s1));
-    expectEquals(1L, sadShort2Long(s1, s2));
-    expectEquals(1L, sadShort2Long(s2, s1));
-    expectEquals(2L, sadShort2LongAt1(s1, s2));
-    expectEquals(2L, sadShort2LongAt1(s2, s1));
+    expectEquals(1, sadChar2Char(s1, s2));
+    expectEquals(1, sadChar2Char(s2, s1));
+    expectEquals(1, sadChar2CharAlt(s1, s2));
+    expectEquals(1, sadChar2CharAlt(s2, s1));
+    expectEquals(1, sadChar2CharAlt2(s1, s2));
+    expectEquals(1, sadChar2CharAlt2(s2, s1));
+    expectEquals(1, sadChar2Int(s1, s2));
+    expectEquals(1, sadChar2Int(s2, s1));
+    expectEquals(1, sadChar2IntAlt(s1, s2));
+    expectEquals(1, sadChar2IntAlt(s2, s1));
+    expectEquals(1, sadChar2IntAlt2(s1, s2));
+    expectEquals(1, sadChar2IntAlt2(s2, s1));
+    expectEquals(1L, sadChar2Long(s1, s2));
+    expectEquals(1L, sadChar2Long(s2, s1));
+    expectEquals(2L, sadChar2LongAt1(s1, s2));
+    expectEquals(2L, sadChar2LongAt1(s2, s1));
 
     // Use cross-values to test all cases.
     char[] interesting = {
@@ -233,14 +233,14 @@
     }
     s1[k] = 10;
     s2[k] = 2;
-    expectEquals(56196, sadShort2Short(s1, s2));
-    expectEquals(56196, sadShort2ShortAlt(s1, s2));
-    expectEquals(56196, sadShort2ShortAlt2(s1, s2));
-    expectEquals(1497988, sadShort2Int(s1, s2));
-    expectEquals(1497988, sadShort2IntAlt(s1, s2));
-    expectEquals(1497988, sadShort2IntAlt2(s1, s2));
-    expectEquals(1497988L, sadShort2Long(s1, s2));
-    expectEquals(1497989L, sadShort2LongAt1(s1, s2));
+    expectEquals(56196, sadChar2Char(s1, s2));
+    expectEquals(56196, sadChar2CharAlt(s1, s2));
+    expectEquals(56196, sadChar2CharAlt2(s1, s2));
+    expectEquals(1497988, sadChar2Int(s1, s2));
+    expectEquals(1497988, sadChar2IntAlt(s1, s2));
+    expectEquals(1497988, sadChar2IntAlt2(s1, s2));
+    expectEquals(1497988L, sadChar2Long(s1, s2));
+    expectEquals(1497989L, sadChar2LongAt1(s1, s2));
 
     System.out.println("passed");
   }
diff --git a/test/660-checker-simd-sad-short2/expected.txt b/test/660-checker-simd-sad-short2/expected.txt
new file mode 100644
index 0000000..b0aad4d
--- /dev/null
+++ b/test/660-checker-simd-sad-short2/expected.txt
@@ -0,0 +1 @@
+passed
diff --git a/test/660-checker-simd-sad-short2/info.txt b/test/660-checker-simd-sad-short2/info.txt
new file mode 100644
index 0000000..b56c119
--- /dev/null
+++ b/test/660-checker-simd-sad-short2/info.txt
@@ -0,0 +1 @@
+Functional tests on SAD vectorization.
diff --git a/test/660-checker-simd-sad-short2/src/Main.java b/test/660-checker-simd-sad-short2/src/Main.java
new file mode 100644
index 0000000..7acc490
--- /dev/null
+++ b/test/660-checker-simd-sad-short2/src/Main.java
@@ -0,0 +1,311 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+/**
+ * Tests for SAD (sum of absolute differences).
+ *
+ * Special case, char array that is first casted to short, forcing sign extension.
+ */
+public class Main {
+
+  // TODO: lower precision still coming, b/64091002
+
+  private static short sadCastedChar2Short(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    short sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      sad += Math.abs(((short) s1[i]) - ((short) s2[i]));
+    }
+    return sad;
+  }
+
+  private static short sadCastedChar2ShortAlt(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    short sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      short s = (short) s1[i];
+      short p = (short) s2[i];
+      sad += s >= p ? s - p : p - s;
+    }
+    return sad;
+  }
+
+  private static short sadCastedChar2ShortAlt2(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    short sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      short s = (short) s1[i];
+      short p = (short) s2[i];
+      int x = s - p;
+      if (x < 0) x = -x;
+      sad += x;
+    }
+    return sad;
+  }
+
+  /// CHECK-START: int Main.sadCastedChar2Int(char[], char[]) loop_optimization (before)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get1:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get2:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv1:s\d+>>   TypeConversion [<<Get1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv2:s\d+>>   TypeConversion [<<Get2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Sub:i\d+>>    Sub [<<Cnv1>>,<<Cnv2>>]        loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Intrin:i\d+>> InvokeStaticOrDirect [<<Sub>>] intrinsic:MathAbsInt loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
+  //
+  /// CHECK-START-ARM64: int Main.sadCastedChar2Int(char[], char[]) loop_optimization (after)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons8:i\d+>>  IntConstant 8                  loop:none
+  /// CHECK-DAG: <<Set:d\d+>>    VecSetScalars [<<Cons0>>]      loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:d\d+>>   Phi [<<Set>>,{{d\d+}}]         loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load1:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load2:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<SAD:d\d+>>    VecSADAccumulate [<<Phi2>>,<<Load1>>,<<Load2>>] loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons8>>]       loop:<<Loop>>      outer_loop:none
+  private static int sadCastedChar2Int(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    int sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      sad += Math.abs(((short) s1[i]) - ((short) s2[i]));
+    }
+    return sad;
+  }
+
+  /// CHECK-START: int Main.sadCastedChar2IntAlt(char[], char[]) loop_optimization (before)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get1:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get2:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv1:s\d+>>   TypeConversion [<<Get1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv2:s\d+>>   TypeConversion [<<Get2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Sub:i\d+>>    Sub [<<Cnv2>>,<<Cnv1>>]        loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Intrin:i\d+>> InvokeStaticOrDirect [<<Sub>>] intrinsic:MathAbsInt loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
+  //
+  /// CHECK-START-ARM64: int Main.sadCastedChar2IntAlt(char[], char[]) loop_optimization (after)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons8:i\d+>>  IntConstant 8                  loop:none
+  /// CHECK-DAG: <<Set:d\d+>>    VecSetScalars [<<Cons0>>]      loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:d\d+>>   Phi [<<Set>>,{{d\d+}}]         loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load1:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load2:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<SAD:d\d+>>    VecSADAccumulate [<<Phi2>>,<<Load2>>,<<Load1>>] loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons8>>]       loop:<<Loop>>      outer_loop:none
+  private static int sadCastedChar2IntAlt(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    int sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      short s = (short) s1[i];
+      short p = (short) s2[i];
+      sad += s >= p ? s - p : p - s;
+    }
+    return sad;
+  }
+
+  /// CHECK-START: int Main.sadCastedChar2IntAlt2(char[], char[]) loop_optimization (before)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get1:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get2:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv1:s\d+>>   TypeConversion [<<Get1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv2:s\d+>>   TypeConversion [<<Get2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Sub:i\d+>>    Sub [<<Cnv1>>,<<Cnv2>>]        loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Intrin:i\d+>> InvokeStaticOrDirect [<<Sub>>] intrinsic:MathAbsInt loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
+  //
+  /// CHECK-START-ARM64: int Main.sadCastedChar2IntAlt2(char[], char[]) loop_optimization (after)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons8:i\d+>>  IntConstant 8                  loop:none
+  /// CHECK-DAG: <<Set:d\d+>>    VecSetScalars [<<Cons0>>]      loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:d\d+>>   Phi [<<Set>>,{{d\d+}}]         loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load1:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load2:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<SAD:d\d+>>    VecSADAccumulate [<<Phi2>>,<<Load1>>,<<Load2>>] loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons8>>]       loop:<<Loop>>      outer_loop:none
+  private static int sadCastedChar2IntAlt2(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    int sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      short s = (short) s1[i];
+      short p = (short) s2[i];
+      int x = s - p;
+      if (x < 0) x = -x;
+      sad += x;
+    }
+    return sad;
+  }
+
+  /// CHECK-START: long Main.sadCastedChar2Long(char[], char[]) loop_optimization (before)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
+  /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 0                 loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:j\d+>>   Phi [<<ConsL>>,{{j\d+}}]       loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get1:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get2:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv1:s\d+>>   TypeConversion [<<Get1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv2:s\d+>>   TypeConversion [<<Get2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv3:j\d+>>   TypeConversion [<<Cnv1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv4:j\d+>>   TypeConversion [<<Cnv2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Sub:j\d+>>    Sub [<<Cnv3>>,<<Cnv4>>]        loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Intrin:j\d+>> InvokeStaticOrDirect [<<Sub>>] intrinsic:MathAbsLong loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
+  //
+  /// CHECK-START-ARM64: long Main.sadCastedChar2Long(char[], char[]) loop_optimization (after)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons8:i\d+>>  IntConstant 8                  loop:none
+  /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 0                 loop:none
+  /// CHECK-DAG: <<Set:d\d+>>    VecSetScalars [<<ConsL>>]      loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:d\d+>>   Phi [<<Set>>,{{d\d+}}]         loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load1:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load2:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<SAD:d\d+>>    VecSADAccumulate [<<Phi2>>,<<Load1>>,<<Load2>>] loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons8>>]       loop:<<Loop>>      outer_loop:none
+  private static long sadCastedChar2Long(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    long sad = 0;
+    for (int i = 0; i < min_length; i++) {
+      long x = (short) s1[i];
+      long y = (short) s2[i];
+      sad += Math.abs(x - y);
+    }
+    return sad;
+  }
+
+  /// CHECK-START: long Main.sadCastedChar2LongAt1(char[], char[]) loop_optimization (before)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons1:i\d+>>  IntConstant 1                  loop:none
+  /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 1                 loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:j\d+>>   Phi [<<ConsL>>,{{j\d+}}]       loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get1:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Get2:c\d+>>   ArrayGet [{{l\d+}},<<Phi1>>]   loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv1:s\d+>>   TypeConversion [<<Get1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv2:s\d+>>   TypeConversion [<<Get2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv3:j\d+>>   TypeConversion [<<Cnv1>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Cnv4:j\d+>>   TypeConversion [<<Cnv2>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Sub:j\d+>>    Sub [<<Cnv3>>,<<Cnv4>>]        loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Intrin:j\d+>> InvokeStaticOrDirect [<<Sub>>] intrinsic:MathAbsLong loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi2>>,<<Intrin>>]      loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons1>>]       loop:<<Loop>>      outer_loop:none
+  //
+  /// CHECK-START-ARM64: long Main.sadCastedChar2LongAt1(char[], char[]) loop_optimization (after)
+  /// CHECK-DAG: <<Cons0:i\d+>>  IntConstant 0                  loop:none
+  /// CHECK-DAG: <<Cons8:i\d+>>  IntConstant 8                  loop:none
+  /// CHECK-DAG: <<ConsL:j\d+>>  LongConstant 1                 loop:none
+  /// CHECK-DAG: <<Set:d\d+>>    VecSetScalars [<<ConsL>>]      loop:none
+  /// CHECK-DAG: <<Phi1:i\d+>>   Phi [<<Cons0>>,{{i\d+}}]       loop:<<Loop:B\d+>> outer_loop:none
+  /// CHECK-DAG: <<Phi2:d\d+>>   Phi [<<Set>>,{{d\d+}}]         loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load1:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<Load2:d\d+>>  VecLoad [{{l\d+}},<<Phi1>>]    loop:<<Loop>>      outer_loop:none
+  /// CHECK-DAG: <<SAD:d\d+>>    VecSADAccumulate [<<Phi2>>,<<Load1>>,<<Load2>>] loop:<<Loop>> outer_loop:none
+  /// CHECK-DAG:                 Add [<<Phi1>>,<<Cons8>>]       loop:<<Loop>>      outer_loop:none
+  private static long sadCastedChar2LongAt1(char[] s1, char[] s2) {
+    int min_length = Math.min(s1.length, s2.length);
+    long sad = 1;  // starts at 1
+    for (int i = 0; i < min_length; i++) {
+      long x = (short) s1[i];
+      long y = (short) s2[i];
+      sad += Math.abs(x - y);
+    }
+    return sad;
+  }
+
+  public static void main(String[] args) {
+    // Cross-test the two most extreme values individually.
+    char[] s1 = { 0, 0x8000, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 };
+    char[] s2 = { 0, 0x7fff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 };
+    expectEquals(-1, sadCastedChar2Short(s1, s2));
+    expectEquals(-1, sadCastedChar2Short(s2, s1));
+    expectEquals(-1, sadCastedChar2ShortAlt(s1, s2));
+    expectEquals(-1, sadCastedChar2ShortAlt(s2, s1));
+    expectEquals(-1, sadCastedChar2ShortAlt2(s1, s2));
+    expectEquals(-1, sadCastedChar2ShortAlt2(s2, s1));
+    expectEquals(65535, sadCastedChar2Int(s1, s2));
+    expectEquals(65535, sadCastedChar2Int(s2, s1));
+    expectEquals(65535, sadCastedChar2IntAlt(s1, s2));
+    expectEquals(65535, sadCastedChar2IntAlt(s2, s1));
+    expectEquals(65535, sadCastedChar2IntAlt2(s1, s2));
+    expectEquals(65535, sadCastedChar2IntAlt2(s2, s1));
+    expectEquals(65535L, sadCastedChar2Long(s1, s2));
+    expectEquals(65535L, sadCastedChar2Long(s2, s1));
+    expectEquals(65536L, sadCastedChar2LongAt1(s1, s2));
+    expectEquals(65536L, sadCastedChar2LongAt1(s2, s1));
+
+    // Use cross-values to test all cases.
+    char[] interesting = {
+      (char) 0x0000,
+      (char) 0x0001,
+      (char) 0x0002,
+      (char) 0x1234,
+      (char) 0x8000,
+      (char) 0x8001,
+      (char) 0x7fff,
+      (char) 0xffff
+    };
+    int n = interesting.length;
+    int m = n * n + 1;
+    s1 = new char[m];
+    s2 = new char[m];
+    int k = 0;
+    for (int i = 0; i < n; i++) {
+      for (int j = 0; j < n; j++) {
+        s1[k] = interesting[i];
+        s2[k] = interesting[j];
+        k++;
+      }
+    }
+    s1[k] = 10;
+    s2[k] = 2;
+    expectEquals(-18932, sadCastedChar2Short(s1, s2));
+    expectEquals(-18932, sadCastedChar2ShortAlt(s1, s2));
+    expectEquals(-18932, sadCastedChar2ShortAlt2(s1, s2));
+    expectEquals(1291788, sadCastedChar2Int(s1, s2));
+    expectEquals(1291788, sadCastedChar2IntAlt(s1, s2));
+    expectEquals(1291788, sadCastedChar2IntAlt2(s1, s2));
+    expectEquals(1291788L, sadCastedChar2Long(s1, s2));
+    expectEquals(1291789L, sadCastedChar2LongAt1(s1, s2));
+
+    System.out.println("passed");
+  }
+
+  private static void expectEquals(int expected, int result) {
+    if (expected != result) {
+      throw new Error("Expected: " + expected + ", found: " + result);
+    }
+  }
+
+  private static void expectEquals(long expected, long result) {
+    if (expected != result) {
+      throw new Error("Expected: " + expected + ", found: " + result);
+    }
+  }
+}
diff --git a/test/661-oat-writer-layout/expected.no-compiled-code.txt b/test/661-oat-writer-layout/expected.no-compiled-code.txt
new file mode 100644
index 0000000..4ed7577
--- /dev/null
+++ b/test/661-oat-writer-layout/expected.no-compiled-code.txt
@@ -0,0 +1 @@
+No OAT class
diff --git a/test/661-oat-writer-layout/expected.txt b/test/661-oat-writer-layout/expected.txt
new file mode 100644
index 0000000..db28e4f
--- /dev/null
+++ b/test/661-oat-writer-layout/expected.txt
@@ -0,0 +1,73 @@
+JNI_OnLoad called
+A::m_a$$$
+A::m_b$$$
+A::m_c$$$
+B::m_a$$$
+B::m_b$$$
+B::m_c$$$
+C::m_a$$$
+C::m_b$$$
+C::m_c$$$
+A::m_a$Hot$$
+A::m_b$Hot$$
+A::m_c$Hot$$
+B::m_a$Hot$$
+B::m_b$Hot$$
+B::m_c$Hot$$
+C::m_a$Hot$$
+C::m_b$Hot$$
+C::m_c$Hot$$
+A::m_a$$Startup$
+A::m_b$$Startup$
+A::m_c$$Startup$
+B::m_a$$Startup$
+B::m_b$$Startup$
+B::m_c$$Startup$
+C::m_a$$Startup$
+C::m_b$$Startup$
+C::m_c$$Startup$
+A::m_a$Hot$Startup$
+A::m_b$Hot$Startup$
+A::m_c$Hot$Startup$
+B::m_a$Hot$Startup$
+B::m_b$Hot$Startup$
+B::m_c$Hot$Startup$
+C::m_a$Hot$Startup$
+C::m_b$Hot$Startup$
+C::m_c$Hot$Startup$
+A::m_a$$$Poststartup
+A::m_b$$$Poststartup
+A::m_c$$$Poststartup
+B::m_a$$$Poststartup
+B::m_b$$$Poststartup
+B::m_c$$$Poststartup
+C::m_a$$$Poststartup
+C::m_b$$$Poststartup
+C::m_c$$$Poststartup
+A::m_a$Hot$$Poststartup
+A::m_b$Hot$$Poststartup
+A::m_c$Hot$$Poststartup
+B::m_a$Hot$$Poststartup
+B::m_b$Hot$$Poststartup
+B::m_c$Hot$$Poststartup
+C::m_a$Hot$$Poststartup
+C::m_b$Hot$$Poststartup
+C::m_c$Hot$$Poststartup
+A::m_a$$Startup$Poststartup
+A::m_b$$Startup$Poststartup
+A::m_c$$Startup$Poststartup
+B::m_a$$Startup$Poststartup
+B::m_b$$Startup$Poststartup
+B::m_c$$Startup$Poststartup
+C::m_a$$Startup$Poststartup
+C::m_b$$Startup$Poststartup
+C::m_c$$Startup$Poststartup
+A::m_a$Hot$Startup$Poststartup
+A::m_b$Hot$Startup$Poststartup
+A::m_c$Hot$Startup$Poststartup
+B::m_a$Hot$Startup$Poststartup
+B::m_b$Hot$Startup$Poststartup
+B::m_c$Hot$Startup$Poststartup
+C::m_a$Hot$Startup$Poststartup
+C::m_b$Hot$Startup$Poststartup
+C::m_c$Hot$Startup$Poststartup
diff --git a/test/661-oat-writer-layout/info.txt b/test/661-oat-writer-layout/info.txt
new file mode 100644
index 0000000..897b85c
--- /dev/null
+++ b/test/661-oat-writer-layout/info.txt
@@ -0,0 +1,4 @@
+Tests Oat Writer is correctly changing the layout of OatMethod code addresses.
+
+Whenever we pass in a profile to dex2oat, we expect that it sorts the methods by the
+MethodHotness bitmask (and sub-sorts by class_def_idx, then method_id).
diff --git a/test/661-oat-writer-layout/oat_writer_layout.cc b/test/661-oat-writer-layout/oat_writer_layout.cc
new file mode 100644
index 0000000..61996b2
--- /dev/null
+++ b/test/661-oat-writer-layout/oat_writer_layout.cc
@@ -0,0 +1,82 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "jni.h"
+
+#include "art_method.h"
+#include "class_linker.h"
+#include "mirror/class-inl.h"
+#include "mirror/dex_cache.h"
+#include "mirror/executable.h"
+#include "mirror/object-inl.h"
+#include "obj_ptr.h"
+#include "oat_file.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread.h"
+
+namespace art {
+namespace {
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getOatMethodQuickCode(JNIEnv* env,
+                                                                   jclass,
+                                                                   jobject method) {
+  CHECK(method != nullptr);
+  ScopedObjectAccess soa(env);
+  ObjPtr<mirror::Executable> exec = soa.Decode<mirror::Executable>(method);
+  ArtMethod* art_method = exec->GetArtMethod();
+
+  const void* quick_code =
+    art_method->GetOatMethodQuickCode(Runtime::Current()->GetClassLinker()->GetImagePointerSize());
+
+  return static_cast<jlong>(reinterpret_cast<uintptr_t>(quick_code));
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasOatCompiledCode(JNIEnv* env,
+                                                                   jclass,
+                                                                   jclass kls) {
+  CHECK(kls != nullptr);
+  ScopedObjectAccess soa(env);
+  Thread* self = Thread::Current();
+
+  ObjPtr<mirror::Class> klass_ptr = self->DecodeJObject(kls)->AsClass();
+
+  bool found = false;
+  OatFile::OatClass oat_class = OatFile::FindOatClass(*klass_ptr->GetDexCache()->GetDexFile(),
+                                                      klass_ptr->GetDexClassDefIndex(),
+                                                      /* out */ &found);
+
+  if (!found) {
+    return false;
+  }
+
+  OatClassType type = oat_class.GetType();
+  switch (type) {
+    case kOatClassAllCompiled:
+    case kOatClassSomeCompiled:
+      return true;
+
+    case kOatClassNoneCompiled:
+    case kOatClassMax:
+      return false;
+  }
+
+  LOG(FATAL) << "unhandled switch statement";
+  UNREACHABLE();
+}
+
+}  // namespace
+}  // namespace art
diff --git a/test/661-oat-writer-layout/parse_oatdump_offsets.sh b/test/661-oat-writer-layout/parse_oatdump_offsets.sh
new file mode 100755
index 0000000..ab9b9a9
--- /dev/null
+++ b/test/661-oat-writer-layout/parse_oatdump_offsets.sh
@@ -0,0 +1,38 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+#
+# Quick and dirty helper tool to print the sorted oat code offsets from oatdump.
+#
+# Usage:
+#
+# oatdump --oat-file=661-oat-writer-layout.odex | $ANDROID_BUILD_TOP/art/test/661-oat-writer-layout/parse_oatdump_offsets.sh
+#
+
+found_method=""
+tmp_file="$(mktemp)"
+while read -r line; do
+
+  if [[ $line == *dex_method_idx=* ]]; then
+    found_method=$line
+  fi
+
+  if [[ $line == *"code_offset: "* ]]; then
+    echo $line $found_method >> "$tmp_file"
+  fi
+done
+
+sort "$tmp_file"
diff --git a/test/661-oat-writer-layout/profile b/test/661-oat-writer-layout/profile
new file mode 100644
index 0000000..5406484
--- /dev/null
+++ b/test/661-oat-writer-layout/profile
@@ -0,0 +1,63 @@
+HLA;->m_a$Hot$$()V
+SLA;->m_a$$Startup$()V
+HSLA;->m_a$Hot$Startup$()V
+PLA;->m_a$$$Poststartup()V
+HPLA;->m_a$Hot$$Poststartup()V
+SPLA;->m_a$$Startup$Poststartup()V
+HSPLA;->m_a$Hot$Startup$Poststartup()V
+HLA;->m_b$Hot$$()V
+SLA;->m_b$$Startup$()V
+HSLA;->m_b$Hot$Startup$()V
+PLA;->m_b$$$Poststartup()V
+HPLA;->m_b$Hot$$Poststartup()V
+SPLA;->m_b$$Startup$Poststartup()V
+HSPLA;->m_b$Hot$Startup$Poststartup()V
+HLA;->m_c$Hot$$()V
+SLA;->m_c$$Startup$()V
+HSLA;->m_c$Hot$Startup$()V
+PLA;->m_c$$$Poststartup()V
+HPLA;->m_c$Hot$$Poststartup()V
+SPLA;->m_c$$Startup$Poststartup()V
+HSPLA;->m_c$Hot$Startup$Poststartup()V
+HLB;->m_a$Hot$$()V
+SLB;->m_a$$Startup$()V
+HSLB;->m_a$Hot$Startup$()V
+PLB;->m_a$$$Poststartup()V
+HPLB;->m_a$Hot$$Poststartup()V
+SPLB;->m_a$$Startup$Poststartup()V
+HSPLB;->m_a$Hot$Startup$Poststartup()V
+HLB;->m_b$Hot$$()V
+SLB;->m_b$$Startup$()V
+HSLB;->m_b$Hot$Startup$()V
+PLB;->m_b$$$Poststartup()V
+HPLB;->m_b$Hot$$Poststartup()V
+SPLB;->m_b$$Startup$Poststartup()V
+HSPLB;->m_b$Hot$Startup$Poststartup()V
+HLB;->m_c$Hot$$()V
+SLB;->m_c$$Startup$()V
+HSLB;->m_c$Hot$Startup$()V
+PLB;->m_c$$$Poststartup()V
+HPLB;->m_c$Hot$$Poststartup()V
+SPLB;->m_c$$Startup$Poststartup()V
+HSPLB;->m_c$Hot$Startup$Poststartup()V
+HLC;->m_a$Hot$$()V
+SLC;->m_a$$Startup$()V
+HSLC;->m_a$Hot$Startup$()V
+PLC;->m_a$$$Poststartup()V
+HPLC;->m_a$Hot$$Poststartup()V
+SPLC;->m_a$$Startup$Poststartup()V
+HSPLC;->m_a$Hot$Startup$Poststartup()V
+HLC;->m_b$Hot$$()V
+SLC;->m_b$$Startup$()V
+HSLC;->m_b$Hot$Startup$()V
+PLC;->m_b$$$Poststartup()V
+HPLC;->m_b$Hot$$Poststartup()V
+SPLC;->m_b$$Startup$Poststartup()V
+HSPLC;->m_b$Hot$Startup$Poststartup()V
+HLC;->m_c$Hot$$()V
+SLC;->m_c$$Startup$()V
+HSLC;->m_c$Hot$Startup$()V
+PLC;->m_c$$$Poststartup()V
+HPLC;->m_c$Hot$$Poststartup()V
+SPLC;->m_c$$Startup$Poststartup()V
+HSPLC;->m_c$Hot$Startup$Poststartup()V
diff --git a/test/661-oat-writer-layout/run b/test/661-oat-writer-layout/run
new file mode 100644
index 0000000..f93d7b7
--- /dev/null
+++ b/test/661-oat-writer-layout/run
@@ -0,0 +1,20 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Always use the 'profile'.
+# Note that this test only works with --compiler-filter=speed
+# -- we accomplish this by blacklisting other compiler variants.
+"${RUN}" "$@" --profile
diff --git a/test/661-oat-writer-layout/src/Generated.java b/test/661-oat-writer-layout/src/Generated.java
new file mode 100644
index 0000000..09f4e88
--- /dev/null
+++ b/test/661-oat-writer-layout/src/Generated.java
@@ -0,0 +1,109 @@
+// Copyright (C) 2017 The Android Open Source Project
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//     http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+
+//
+// Lists several combinations of Classes X Methods X Hotness:
+//
+// Class A-C:
+//   - Ensure method hotness overrides sorting by class_def_idx
+//
+// Method m_a : m_c
+//   - Ensure method hotness overrides sorting by method_id
+//
+// Method m_a$Hot$Enum$Bits
+//   - $X$Y$Z is an encoding of MethodHotness flags ($[Hot]$[Startup]$[Poststartup])
+//   - The method name encoding matches the `profile` hotness.
+//   - Check all variations of the bits to make sure it sorts by hotness correctly.
+//
+
+class A {
+  // Note that every method has unique dex code (by using a unique string literal).
+  // This is to prevent dex/oat code deduping. Deduped methods do not get distinct bins.
+  void m_a$$$() { System.out.println("Don't dedupe me! A::m_a$$$"); }
+  void m_a$Hot$$() { System.out.println("Don't dedupe me! A::m_a$Hot$$"); }
+  void m_a$$Startup$() { System.out.println("Don't dedupe me! A::m_a$$Startup$"); }
+  void m_a$Hot$Startup$() { System.out.println("Don't dedupe me! A::m_a$Hot$Startup$"); }
+  void m_a$$$Poststartup() { System.out.println("Don't dedupe me! A::m_a$$$Poststartup"); }
+  void m_a$Hot$$Poststartup() { System.out.println("Don't dedupe me! A::m_a$Hot$$Poststartup"); }
+  void m_a$$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_a$$Startup$Poststartup"); }
+  void m_a$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_a$Hot$Startup$Poststartup"); }
+  void m_b$$$() { System.out.println("Don't dedupe me! A::m_b$$$"); }
+  void m_b$Hot$$() { System.out.println("Don't dedupe me! A::m_b$Hot$$"); }
+  void m_b$$Startup$() { System.out.println("Don't dedupe me! A::m_b$$Startup$"); }
+  void m_b$Hot$Startup$() { System.out.println("Don't dedupe me! A::m_b$Hot$Startup$"); }
+  void m_b$$$Poststartup() { System.out.println("Don't dedupe me! A::m_b$$$Poststartup"); }
+  void m_b$Hot$$Poststartup() { System.out.println("Don't dedupe me! A::m_b$Hot$$Poststartup"); }
+  void m_b$$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_b$$Startup$Poststartup"); }
+  void m_b$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_b$Hot$Startup$Poststartup"); }
+  void m_c$$$() { System.out.println("Don't dedupe me! A::m_c$$$"); }
+  void m_c$Hot$$() { System.out.println("Don't dedupe me! A::m_c$Hot$$"); }
+  void m_c$$Startup$() { System.out.println("Don't dedupe me! A::m_c$$Startup$"); }
+  void m_c$Hot$Startup$() { System.out.println("Don't dedupe me! A::m_c$Hot$Startup$"); }
+  void m_c$$$Poststartup() { System.out.println("Don't dedupe me! A::m_c$$$Poststartup"); }
+  void m_c$Hot$$Poststartup() { System.out.println("Don't dedupe me! A::m_c$Hot$$Poststartup"); }
+  void m_c$$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_c$$Startup$Poststartup"); }
+  void m_c$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! A::m_c$Hot$Startup$Poststartup"); }
+}
+class B {
+  void m_a$$$() { System.out.println("Don't dedupe me! B::m_a$$$"); }
+  void m_a$Hot$$() { System.out.println("Don't dedupe me! B::m_a$Hot$$"); }
+  void m_a$$Startup$() { System.out.println("Don't dedupe me! B::m_a$$Startup$"); }
+  void m_a$Hot$Startup$() { System.out.println("Don't dedupe me! B::m_a$Hot$Startup$"); }
+  void m_a$$$Poststartup() { System.out.println("Don't dedupe me! B::m_a$$$Poststartup"); }
+  void m_a$Hot$$Poststartup() { System.out.println("Don't dedupe me! B::m_a$Hot$$Poststartup"); }
+  void m_a$$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_a$$Startup$Poststartup"); }
+  void m_a$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_a$Hot$Startup$Poststartup"); }
+  void m_b$$$() { System.out.println("Don't dedupe me! B::m_b$$$"); }
+  void m_b$Hot$$() { System.out.println("Don't dedupe me! B::m_b$Hot$$"); }
+  void m_b$$Startup$() { System.out.println("Don't dedupe me! B::m_b$$Startup$"); }
+  void m_b$Hot$Startup$() { System.out.println("Don't dedupe me! B::m_b$Hot$Startup$"); }
+  void m_b$$$Poststartup() { System.out.println("Don't dedupe me! B::m_b$$$Poststartup"); }
+  void m_b$Hot$$Poststartup() { System.out.println("Don't dedupe me! B::m_b$Hot$$Poststartup"); }
+  void m_b$$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_b$$Startup$Poststartup"); }
+  void m_b$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_b$Hot$Startup$Poststartup"); }
+  void m_c$$$() { System.out.println("Don't dedupe me! B::m_c$$$"); }
+  void m_c$Hot$$() { System.out.println("Don't dedupe me! B::m_c$Hot$$"); }
+  void m_c$$Startup$() { System.out.println("Don't dedupe me! B::m_c$$Startup$"); }
+  void m_c$Hot$Startup$() { System.out.println("Don't dedupe me! B::m_c$Hot$Startup$"); }
+  void m_c$$$Poststartup() { System.out.println("Don't dedupe me! B::m_c$$$Poststartup"); }
+  void m_c$Hot$$Poststartup() { System.out.println("Don't dedupe me! B::m_c$Hot$$Poststartup"); }
+  void m_c$$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_c$$Startup$Poststartup"); }
+  void m_c$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! B::m_c$Hot$Startup$Poststartup"); }
+}
+class C {
+  void m_a$$$() { System.out.println("Don't dedupe me! C::m_a$$$"); }
+  void m_a$Hot$$() { System.out.println("Don't dedupe me! C::m_a$Hot$$"); }
+  void m_a$$Startup$() { System.out.println("Don't dedupe me! C::m_a$$Startup$"); }
+  void m_a$Hot$Startup$() { System.out.println("Don't dedupe me! C::m_a$Hot$Startup$"); }
+  void m_a$$$Poststartup() { System.out.println("Don't dedupe me! C::m_a$$$Poststartup"); }
+  void m_a$Hot$$Poststartup() { System.out.println("Don't dedupe me! C::m_a$Hot$$Poststartup"); }
+  void m_a$$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_a$$Startup$Poststartup"); }
+  void m_a$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_a$Hot$Startup$Poststartup"); }
+  void m_b$$$() { System.out.println("Don't dedupe me! C::m_b$$$"); }
+  void m_b$Hot$$() { System.out.println("Don't dedupe me! C::m_b$Hot$$"); }
+  void m_b$$Startup$() { System.out.println("Don't dedupe me! C::m_b$$Startup$"); }
+  void m_b$Hot$Startup$() { System.out.println("Don't dedupe me! C::m_b$Hot$Startup$"); }
+  void m_b$$$Poststartup() { System.out.println("Don't dedupe me! C::m_b$$$Poststartup"); }
+  void m_b$Hot$$Poststartup() { System.out.println("Don't dedupe me! C::m_b$Hot$$Poststartup"); }
+  void m_b$$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_b$$Startup$Poststartup"); }
+  void m_b$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_b$Hot$Startup$Poststartup"); }
+  void m_c$$$() { System.out.println("Don't dedupe me! C::m_c$$$"); }
+  void m_c$Hot$$() { System.out.println("Don't dedupe me! C::m_c$Hot$$"); }
+  void m_c$$Startup$() { System.out.println("Don't dedupe me! C::m_c$$Startup$"); }
+  void m_c$Hot$Startup$() { System.out.println("Don't dedupe me! C::m_c$Hot$Startup$"); }
+  void m_c$$$Poststartup() { System.out.println("Don't dedupe me! C::m_c$$$Poststartup"); }
+  void m_c$Hot$$Poststartup() { System.out.println("Don't dedupe me! C::m_c$Hot$$Poststartup"); }
+  void m_c$$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_c$$Startup$Poststartup"); }
+  void m_c$Hot$Startup$Poststartup() { System.out.println("Don't dedupe me! C::m_c$Hot$Startup$Poststartup"); }
+}
diff --git a/test/661-oat-writer-layout/src/Main.java b/test/661-oat-writer-layout/src/Main.java
new file mode 100644
index 0000000..940798d
--- /dev/null
+++ b/test/661-oat-writer-layout/src/Main.java
@@ -0,0 +1,80 @@
+// Copyright (C) 2017 The Android Open Source Project
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//     http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+import java.lang.reflect.Method;
+import java.util.ArrayList;
+import java.util.Collections;
+
+public class Main {
+
+  static class OatMethodAndOffset implements Comparable<OatMethodAndOffset> {
+    Method method;
+    long codeOffset;
+
+    public OatMethodAndOffset(Method method, long codeOffset) {
+      this.method = method;
+      this.codeOffset = codeOffset;
+    }
+
+    // e.g. "Foo::Bar()"
+    public String methodReferenceString() {
+      return method.getDeclaringClass().getName() + "::" + method.getName();
+    }
+
+    @Override
+    public int compareTo(OatMethodAndOffset other) {
+      return Long.compareUnsigned(codeOffset, other.codeOffset);
+    }
+  }
+
+  // Print the list of methods in Generated.class, sorted by their OAT code address.
+  public static void main(String[] args) {
+    System.loadLibrary(args[0]);
+
+    // Make sure to check "Test.class" because Main.class still has JNI which could be compiled
+    // even if the rest of the classes are not.
+    if (!hasOatCompiledCode(Test.class)) {
+      System.out.println("No OAT class");
+      return;
+    }
+
+    // We only care about explicitly defined methods from Generated.java.
+    Method[] interesting_methods;
+    try {
+      interesting_methods = Test.getTestMethods();
+    } catch (NoSuchMethodException e) {
+      e.printStackTrace();
+      return;
+    }
+
+    // Get the list of oat code methods for each Java method.
+    ArrayList<OatMethodAndOffset> offsets_list = new ArrayList<OatMethodAndOffset>();
+    for (Method m : interesting_methods) {
+      offsets_list.add(new OatMethodAndOffset(m, getOatMethodQuickCode(m)));
+    }
+
+    // Sort by the offset address.
+    Collections.sort(offsets_list);
+
+    // Print each method as a method reference string.
+    for (OatMethodAndOffset m : offsets_list) {
+      System.out.println(m.methodReferenceString());
+    }
+  }
+
+  // Does Main.class have an OatClass with actually compiled code?
+  private static native boolean hasOatCompiledCode(Class kls);
+  // Get the OatMethod's pointer to code. We get 'real' memory address, not relative offset,
+  // but it's still good since we never compare multiple OAT files here.
+  private static native long getOatMethodQuickCode(Method method);
+}
diff --git a/test/661-oat-writer-layout/src/Test.java b/test/661-oat-writer-layout/src/Test.java
new file mode 100644
index 0000000..db67b48
--- /dev/null
+++ b/test/661-oat-writer-layout/src/Test.java
@@ -0,0 +1,98 @@
+// Copyright (C) 2017 The Android Open Source Project
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//     http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+
+import java.lang.reflect.Method;
+
+public class Test {
+  // Returns list of all methods in Generated.java
+  // This is to avoid having to introspect classes with extra code
+  // (for example, we ignore <init> methods).
+  public static Method[] getTestMethods() throws NoSuchMethodException, SecurityException {
+    Method[] all_methods = new Method[72];
+    all_methods[0] = A.class.getDeclaredMethod("m_a$$$");
+    all_methods[1] = A.class.getDeclaredMethod("m_a$Hot$$");
+    all_methods[2] = A.class.getDeclaredMethod("m_a$$Startup$");
+    all_methods[3] = A.class.getDeclaredMethod("m_a$Hot$Startup$");
+    all_methods[4] = A.class.getDeclaredMethod("m_a$$$Poststartup");
+    all_methods[5] = A.class.getDeclaredMethod("m_a$Hot$$Poststartup");
+    all_methods[6] = A.class.getDeclaredMethod("m_a$$Startup$Poststartup");
+    all_methods[7] = A.class.getDeclaredMethod("m_a$Hot$Startup$Poststartup");
+    all_methods[8] = A.class.getDeclaredMethod("m_b$$$");
+    all_methods[9] = A.class.getDeclaredMethod("m_b$Hot$$");
+    all_methods[10] = A.class.getDeclaredMethod("m_b$$Startup$");
+    all_methods[11] = A.class.getDeclaredMethod("m_b$Hot$Startup$");
+    all_methods[12] = A.class.getDeclaredMethod("m_b$$$Poststartup");
+    all_methods[13] = A.class.getDeclaredMethod("m_b$Hot$$Poststartup");
+    all_methods[14] = A.class.getDeclaredMethod("m_b$$Startup$Poststartup");
+    all_methods[15] = A.class.getDeclaredMethod("m_b$Hot$Startup$Poststartup");
+    all_methods[16] = A.class.getDeclaredMethod("m_c$$$");
+    all_methods[17] = A.class.getDeclaredMethod("m_c$Hot$$");
+    all_methods[18] = A.class.getDeclaredMethod("m_c$$Startup$");
+    all_methods[19] = A.class.getDeclaredMethod("m_c$Hot$Startup$");
+    all_methods[20] = A.class.getDeclaredMethod("m_c$$$Poststartup");
+    all_methods[21] = A.class.getDeclaredMethod("m_c$Hot$$Poststartup");
+    all_methods[22] = A.class.getDeclaredMethod("m_c$$Startup$Poststartup");
+    all_methods[23] = A.class.getDeclaredMethod("m_c$Hot$Startup$Poststartup");
+    all_methods[24] = B.class.getDeclaredMethod("m_a$$$");
+    all_methods[25] = B.class.getDeclaredMethod("m_a$Hot$$");
+    all_methods[26] = B.class.getDeclaredMethod("m_a$$Startup$");
+    all_methods[27] = B.class.getDeclaredMethod("m_a$Hot$Startup$");
+    all_methods[28] = B.class.getDeclaredMethod("m_a$$$Poststartup");
+    all_methods[29] = B.class.getDeclaredMethod("m_a$Hot$$Poststartup");
+    all_methods[30] = B.class.getDeclaredMethod("m_a$$Startup$Poststartup");
+    all_methods[31] = B.class.getDeclaredMethod("m_a$Hot$Startup$Poststartup");
+    all_methods[32] = B.class.getDeclaredMethod("m_b$$$");
+    all_methods[33] = B.class.getDeclaredMethod("m_b$Hot$$");
+    all_methods[34] = B.class.getDeclaredMethod("m_b$$Startup$");
+    all_methods[35] = B.class.getDeclaredMethod("m_b$Hot$Startup$");
+    all_methods[36] = B.class.getDeclaredMethod("m_b$$$Poststartup");
+    all_methods[37] = B.class.getDeclaredMethod("m_b$Hot$$Poststartup");
+    all_methods[38] = B.class.getDeclaredMethod("m_b$$Startup$Poststartup");
+    all_methods[39] = B.class.getDeclaredMethod("m_b$Hot$Startup$Poststartup");
+    all_methods[40] = B.class.getDeclaredMethod("m_c$$$");
+    all_methods[41] = B.class.getDeclaredMethod("m_c$Hot$$");
+    all_methods[42] = B.class.getDeclaredMethod("m_c$$Startup$");
+    all_methods[43] = B.class.getDeclaredMethod("m_c$Hot$Startup$");
+    all_methods[44] = B.class.getDeclaredMethod("m_c$$$Poststartup");
+    all_methods[45] = B.class.getDeclaredMethod("m_c$Hot$$Poststartup");
+    all_methods[46] = B.class.getDeclaredMethod("m_c$$Startup$Poststartup");
+    all_methods[47] = B.class.getDeclaredMethod("m_c$Hot$Startup$Poststartup");
+    all_methods[48] = C.class.getDeclaredMethod("m_a$$$");
+    all_methods[49] = C.class.getDeclaredMethod("m_a$Hot$$");
+    all_methods[50] = C.class.getDeclaredMethod("m_a$$Startup$");
+    all_methods[51] = C.class.getDeclaredMethod("m_a$Hot$Startup$");
+    all_methods[52] = C.class.getDeclaredMethod("m_a$$$Poststartup");
+    all_methods[53] = C.class.getDeclaredMethod("m_a$Hot$$Poststartup");
+    all_methods[54] = C.class.getDeclaredMethod("m_a$$Startup$Poststartup");
+    all_methods[55] = C.class.getDeclaredMethod("m_a$Hot$Startup$Poststartup");
+    all_methods[56] = C.class.getDeclaredMethod("m_b$$$");
+    all_methods[57] = C.class.getDeclaredMethod("m_b$Hot$$");
+    all_methods[58] = C.class.getDeclaredMethod("m_b$$Startup$");
+    all_methods[59] = C.class.getDeclaredMethod("m_b$Hot$Startup$");
+    all_methods[60] = C.class.getDeclaredMethod("m_b$$$Poststartup");
+    all_methods[61] = C.class.getDeclaredMethod("m_b$Hot$$Poststartup");
+    all_methods[62] = C.class.getDeclaredMethod("m_b$$Startup$Poststartup");
+    all_methods[63] = C.class.getDeclaredMethod("m_b$Hot$Startup$Poststartup");
+    all_methods[64] = C.class.getDeclaredMethod("m_c$$$");
+    all_methods[65] = C.class.getDeclaredMethod("m_c$Hot$$");
+    all_methods[66] = C.class.getDeclaredMethod("m_c$$Startup$");
+    all_methods[67] = C.class.getDeclaredMethod("m_c$Hot$Startup$");
+    all_methods[68] = C.class.getDeclaredMethod("m_c$$$Poststartup");
+    all_methods[69] = C.class.getDeclaredMethod("m_c$Hot$$Poststartup");
+    all_methods[70] = C.class.getDeclaredMethod("m_c$$Startup$Poststartup");
+    all_methods[71] = C.class.getDeclaredMethod("m_c$Hot$Startup$Poststartup");
+    return all_methods;
+  }
+}
+
diff --git a/test/911-get-stack-trace/src/art/PrintThread.java b/test/911-get-stack-trace/src/art/PrintThread.java
index fee5ba0..d8b3cbc 100644
--- a/test/911-get-stack-trace/src/art/PrintThread.java
+++ b/test/911-get-stack-trace/src/art/PrintThread.java
@@ -42,7 +42,7 @@
   // may not exist depending on the environment.
   public final static String IGNORE_THREAD_NAME_REGEX =
       "Binder:|RenderThread|hwuiTask|Jit thread pool worker|Instr:|JDWP|Profile Saver|main|" +
-      "queued-work-looper";
+      "queued-work-looper|InstrumentationConnectionThread";
   public final static Matcher IGNORE_THREADS =
       Pattern.compile(IGNORE_THREAD_NAME_REGEX).matcher("");
 
diff --git a/test/912-classes/expected.txt b/test/912-classes/expected.txt
index 9dcc5f9..7ad5d60 100644
--- a/test/912-classes/expected.txt
+++ b/test/912-classes/expected.txt
@@ -56,7 +56,7 @@
 boot <- 1+2 (A,B)
 [class A, class B, class java.lang.Object]
 
-[37, 0]
+[35, 0]
 
 B, false
 Load: LB; on ClassEvents
diff --git a/test/912-classes/src-art/art/Test912.java b/test/912-classes/src-art/art/Test912.java
index 2e41c26..ddfadf3 100644
--- a/test/912-classes/src-art/art/Test912.java
+++ b/test/912-classes/src-art/art/Test912.java
@@ -19,8 +19,10 @@
 import java.lang.ref.Reference;
 import java.lang.reflect.Constructor;
 import java.lang.reflect.Proxy;
+import java.nio.ByteBuffer;
 import java.util.ArrayList;
 import java.util.Arrays;
+import java.util.Base64;
 import java.util.Comparator;
 
 public class Test912 {
@@ -214,8 +216,34 @@
     }
   }
 
-  private static void testClassVersion() {
-    System.out.println(Arrays.toString(getClassVersion(Main.class)));
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+  private static void testClassVersion() throws Exception {
+    Class<?> class_loader_class = Class.forName("dalvik.system.InMemoryDexClassLoader");
+    Constructor<?> ctor = class_loader_class.getConstructor(ByteBuffer.class, ClassLoader.class);
+    Class target = ((ClassLoader)ctor.newInstance(
+        ByteBuffer.wrap(DEX_BYTES), Test912.class.getClassLoader())).loadClass("Transform");
+    System.out.println(Arrays.toString(getClassVersion(target)));
   }
 
   private static void testClassEvents() throws Exception {
diff --git a/test/924-threads/expected.txt b/test/924-threads/expected.txt
index 1eb2e1b..e529559 100644
--- a/test/924-threads/expected.txt
+++ b/test/924-threads/expected.txt
@@ -26,6 +26,15 @@
 class dalvik.system.PathClassLoader
 5
 5
+Thread type is class java.lang.Thread
+0 = NEW
+191 = ALIVE|WAITING_INDEFINITELY|WAITING|IN_OBJECT_WAIT
+1a1 = ALIVE|WAITING_WITH_TIMEOUT|WAITING|IN_OBJECT_WAIT
+401 = ALIVE|BLOCKED_ON_MONITOR_ENTER
+e1 = ALIVE|WAITING_WITH_TIMEOUT|SLEEPING|WAITING
+5 = ALIVE|RUNNABLE
+2 = TERMINATED
+Thread type is class art.Test924$ExtThread
 0 = NEW
 191 = ALIVE|WAITING_INDEFINITELY|WAITING|IN_OBJECT_WAIT
 1a1 = ALIVE|WAITING_WITH_TIMEOUT|WAITING|IN_OBJECT_WAIT
diff --git a/test/924-threads/src/art/Test924.java b/test/924-threads/src/art/Test924.java
index b73eb30..1ff2c3f 100644
--- a/test/924-threads/src/art/Test924.java
+++ b/test/924-threads/src/art/Test924.java
@@ -21,6 +21,7 @@
 import java.util.Collections;
 import java.util.Comparator;
 import java.util.concurrent.CountDownLatch;
+import java.util.function.Function;
 import java.util.HashMap;
 import java.util.Iterator;
 import java.util.List;
@@ -76,7 +77,9 @@
     };
     printThreadInfo(t4);
 
-    doStateTests();
+    doCurrentThreadStateTests();
+    doStateTests(Thread::new);
+    doStateTests(ExtThread::new);
 
     doAllThreadsTests();
 
@@ -85,14 +88,20 @@
     doTestEvents();
   }
 
+  private static final class ExtThread extends Thread {
+    public ExtThread(Runnable r) { super(r); }
+  }
+
   private static class Holder {
     volatile boolean flag = false;
   }
 
-  private static void doStateTests() throws Exception {
+  private static void doCurrentThreadStateTests() throws Exception {
     System.out.println(Integer.toHexString(getThreadState(null)));
     System.out.println(Integer.toHexString(getThreadState(Thread.currentThread())));
+  }
 
+  private static void doStateTests(Function<Runnable, Thread> mkThread) throws Exception {
     final CountDownLatch cdl1 = new CountDownLatch(1);
     final CountDownLatch cdl2 = new CountDownLatch(1);
     final CountDownLatch cdl3_1 = new CountDownLatch(1);
@@ -133,7 +142,8 @@
       }
     };
 
-    Thread t = new Thread(r);
+    Thread t = mkThread.apply(r);
+    System.out.println("Thread type is " + t.getClass());
     printThreadState(t);
     t.start();
 
diff --git a/test/961-default-iface-resolution-gen/run b/test/961-default-iface-resolution-gen/run
new file mode 100755
index 0000000..fdcd2a8
--- /dev/null
+++ b/test/961-default-iface-resolution-gen/run
@@ -0,0 +1,18 @@
+#!/bin/bash
+#
+# Copyright (C) 2017 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Run with a 2 minute default dex2oat timeout and a 2.5 minute hard dex2oat timeout.
+./default-run "$@" --dex2oat-timeout 120 --dex2oat-rt-timeout 180
diff --git a/test/980-redefine-object/check b/test/980-redefine-object/check
index 07b21b3..6f1e709 100755
--- a/test/980-redefine-object/check
+++ b/test/980-redefine-object/check
@@ -17,4 +17,7 @@
 # The number of paused background threads (and therefore InterruptedExceptions)
 # can change so we will just delete their lines from the log.
 
-sed "/Object allocated of type 'java\.lang\.InterruptedException'/d" "$2" | diff --strip-trailing-cr -q "$1" - >/dev/null
+cat "$2" \
+  | sed "/Object allocated of type 'java\.lang\.InterruptedException'/d" \
+  | sed "/Object allocated of type 'java\.lang\.Long'/d" \
+  | diff --strip-trailing-cr -q "$1" - >/dev/null
diff --git a/test/Android.bp b/test/Android.bp
index d56c0b5..2af03e3 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -67,6 +67,7 @@
         "libicuuc",
         "libicui18n",
         "libnativehelper",
+        "libz",
     ],
     whole_static_libs: [
         "libsigchain",
@@ -84,11 +85,6 @@
             ],
             shared_libs: [
                 "libziparchive",
-                "libz-host",
-            ],
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
             ],
             cflags: [
                 // gtest issue
@@ -107,8 +103,6 @@
             ],
             shared_libs: [
                 "liblog",
-                "libdl",
-                "libz",
             ],
             cflags: [
                 // gtest issue
@@ -169,26 +163,15 @@
     whole_static_libs: [
         "libart-compiler-gtest",
         "libart-runtime-gtest",
-        "libgtest"
+        "libgtest",
     ],
     shared_libs: [
         "libartd",
         "libartd-compiler",
         "libbase",
-        "libbacktrace"
+        "libbacktrace",
     ],
     target: {
-        android: {
-            shared_libs: [
-                "libdl",
-            ],
-        },
-        host: {
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
-        },
         darwin: {
             enabled: false,
         },
@@ -206,17 +189,6 @@
         "libbase",
         "libnativehelper",
     ],
-    target: {
-        android: {
-            shared_libs: ["libdl"],
-        },
-        host: {
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
-        },
-    },
 }
 
 art_cc_test_library {
@@ -237,7 +209,7 @@
 }
 
 art_cc_defaults {
-   name: "libtiagent-base-defaults",
+    name: "libtiagent-base-defaults",
     defaults: ["libartagent-defaults"],
     srcs: [
         // These are the ART-independent parts.
@@ -302,7 +274,7 @@
         "1926-missed-frame-pop/frame_pop_missed.cc",
         "1927-exception-event/exception_event.cc",
         "1930-monitor-info/monitor.cc",
-        "1932-monitor-events-misc/monitor_misc.cc"
+        "1932-monitor-events-misc/monitor_misc.cc",
     ],
     shared_libs: [
         "libbase",
@@ -359,7 +331,7 @@
 
 art_cc_test_library {
     name: "libtistress",
-    defaults: [ "libtistress-defaults"],
+    defaults: ["libtistress-defaults"],
     shared_libs: ["libart"],
 }
 
@@ -420,25 +392,15 @@
         "642-fp-callees/fp_callees.cc",
         "647-jni-get-field-id/get_field_id.cc",
         "656-annotation-lookup-generic-jni/test.cc",
-	"664-aget-verifier/aget-verifier.cc",
-        "708-jit-cache-churn/jit.cc"
+        "661-oat-writer-layout/oat_writer_layout.cc",
+        "664-aget-verifier/aget-verifier.cc",
+        "708-jit-cache-churn/jit.cc",
     ],
     shared_libs: [
         "libbacktrace",
         "libbase",
         "libnativehelper",
     ],
-    target: {
-        android: {
-            shared_libs: ["libdl"],
-        },
-        host: {
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
-        },
-    },
 }
 
 art_cc_test_library {
@@ -466,18 +428,4 @@
     ],
     header_libs: ["libnativebridge-dummy-headers"],
     srcs: ["115-native-bridge/nativebridge.cc"],
-    target: {
-        android: {
-            shared_libs: ["libdl"],
-        },
-        host: {
-            host_ldlibs: [
-                "-ldl",
-                "-lpthread",
-            ],
-        },
-        linux: {
-            host_ldlibs: ["-lrt"],
-        },
-    },
 }
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index c16c487..d37e6bc 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -70,6 +70,10 @@
 VDEX_FILTER=""
 PROFILE="n"
 RANDOM_PROFILE="n"
+# The normal dex2oat timeout.
+DEX2OAT_TIMEOUT="60"
+# The *hard* timeout where we really start trying to kill the dex2oat.
+DEX2OAT_RT_TIMEOUT="90"
 
 # if "y", set -Xstacktracedir and inform the test of its location. When
 # this is set, stack trace dumps (from signal 3) will be written to a file
@@ -87,6 +91,22 @@
     if [ "x$1" = "x--quiet" ]; then
         QUIET="y"
         shift
+    elif [ "x$1" = "x--dex2oat-rt-timeout" ]; then
+        shift
+        if [ "x$1" = "x" ]; then
+            echo "$0 missing argument to --dex2oat-rt-timeout" 1>&2
+            exit 1
+        fi
+        DEX2OAT_RT_TIMEOUT="$1"
+        shift
+    elif [ "x$1" = "x--dex2oat-timeout" ]; then
+        shift
+        if [ "x$1" = "x" ]; then
+            echo "$0 missing argument to --dex2oat-timeout" 1>&2
+            exit 1
+        fi
+        DEX2OAT_TIMEOUT="$1"
+        shift
     elif [ "x$1" = "x--jvmti" ]; then
         IS_JVMTI_TEST="y"
         shift
@@ -646,10 +666,11 @@
   # Note: as we don't know how decent targets are (e.g., emulator), only do this on the host for
   #       now. We should try to improve this.
   #       The current value is rather arbitrary. run-tests should compile quickly.
+  # Watchdog timeout is in milliseconds so add 3 '0's to the dex2oat timeout.
   if [ "$HOST" != "n" ]; then
     # Use SIGRTMIN+2 to try to dump threads.
     # Use -k 1m to SIGKILL it a minute later if it hasn't ended.
-    dex2oat_cmdline="timeout -k 1m -s SIGRTMIN+2 90s ${dex2oat_cmdline} --watchdog-timeout=60000"
+    dex2oat_cmdline="timeout -k ${DEX2OAT_TIMEOUT}s -s SIGRTMIN+2 ${DEX2OAT_RT_TIMEOUT}s ${dex2oat_cmdline} --watchdog-timeout=${DEX2OAT_TIMEOUT}000"
   fi
   if [ "$PROFILE" = "y" ] || [ "$RANDOM_PROFILE" = "y" ]; then
     vdex_cmdline="${dex2oat_cmdline} ${VDEX_FILTER} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex --output-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
diff --git a/test/knownfailures.json b/test/knownfailures.json
index 252d13a..df24c7d 100644
--- a/test/knownfailures.json
+++ b/test/knownfailures.json
@@ -366,167 +366,20 @@
         "variant": "speed-profile"
     },
     {
-        "tests": [
-            "004-checker-UnsafeTest18",
-            "127-checker-secondarydex",
-            "441-checker-inliner",
-            "442-checker-constant-folding",
-            "444-checker-nce",
-            "445-checker-licm",
-            "446-checker-inliner2",
-            "447-checker-inliner3",
-            "449-checker-bce",
-            "450-checker-types",
-            "455-checker-gvn",
-            "458-checker-instruct-simplification",
-            "462-checker-inlining-dex-files",
-            "463-checker-boolean-simplifier",
-            "464-checker-inline-sharpen-calls",
-            "465-checker-clinit-gvn",
-            "468-checker-bool-simplif-regression",
-            "473-checker-inliner-constants",
-            "474-checker-boolean-input",
-            "476-checker-ctor-memory-barrier",
-            "477-checker-bound-type",
-            "478-checker-clinit-check-pruning",
-            "478-checker-inline-noreturn",
-            "478-checker-inliner-nested-loop",
-            "480-checker-dead-blocks",
-            "482-checker-loop-back-edge-use",
-            "484-checker-register-hints",
-            "485-checker-dce-loop-update",
-            "485-checker-dce-switch",
-            "486-checker-must-do-null-check",
-            "487-checker-inline-calls",
-            "488-checker-inline-recursive-calls",
-            "490-checker-inline",
-            "492-checker-inline-invoke-interface",
-            "493-checker-inline-invoke-interface",
-            "494-checker-instanceof-tests",
-            "495-checker-checkcast-tests",
-            "496-checker-inlining-class-loader",
-            "508-checker-disassembly",
-            "510-checker-try-catch",
-            "517-checker-builder-fallthrough",
-            "521-checker-array-set-null",
-            "522-checker-regression-monitor-exit",
-            "523-checker-can-throw-regression",
-            "525-checker-arrays-fields1",
-            "525-checker-arrays-fields2",
-            "526-checker-caller-callee-regs",
-            "527-checker-array-access-split",
-            "529-checker-unresolved",
-            "530-checker-loops1",
-            "530-checker-loops2",
-            "530-checker-loops3",
-            "530-checker-loops4",
-            "530-checker-loops5",
-            "530-checker-lse",
-            "530-checker-lse2",
-            "530-checker-regression-reftyp-final",
-            "532-checker-nonnull-arrayset",
-            "534-checker-bce-deoptimization",
-            "536-checker-intrinsic-optimization",
-            "536-checker-needs-access-check",
-            "537-checker-arraycopy",
-            "537-checker-debuggable",
-            "537-checker-inline-and-unverified",
-            "537-checker-jump-over-jump",
-            "538-checker-embed-constants",
-            "540-checker-rtp-bug",
-            "543-checker-dce-trycatch",
-            "548-checker-inlining-and-dce",
-            "549-checker-types-merge",
-            "550-checker-multiply-accumulate",
-            "550-checker-regression-wide-store",
-            "551-checker-clinit",
-            "551-checker-shifter-operand",
-            "552-checker-primitive-typeprop",
-            "552-checker-sharpening",
-            "554-checker-rtp-checkcast",
-            "557-checker-instruct-simplifier-ror",
-            "557-checker-ref-equivalent",
-            "559-checker-irreducible-loop",
-            "559-checker-rtp-ifnotnull",
-            "562-checker-no-intermediate",
-            "563-checker-fakestring",
-            "563-checker-invoke-super",
-            "564-checker-bitcount",
-            "564-checker-inline-loop",
-            "564-checker-irreducible-loop",
-            "564-checker-negbitwise",
-            "565-checker-condition-liveness",
-            "565-checker-doublenegbitwise",
-            "565-checker-irreducible-loop",
-            "565-checker-rotate",
-            "566-checker-codegen-select",
-            "566-checker-signum",
-            "567-checker-compare",
-            "568-checker-onebit",
-            "569-checker-pattern-replacement",
-            "570-checker-osr",
-            "570-checker-select",
-            "572-checker-array-get-regression",
-            "573-checker-checkcast-regression",
-            "575-checker-isnan",
-            "575-checker-string-init-alias",
-            "577-checker-fp2int",
-            "580-checker-round",
-            "580-checker-string-fact-intrinsics",
-            "582-checker-bce-length",
-            "583-checker-zero",
-            "584-checker-div-bool",
-            "586-checker-null-array-get",
-            "588-checker-irreducib-lifetime-hole",
-            "590-checker-arr-set-null-regression",
-            "591-checker-regression-dead-loop",
-            "592-checker-regression-bool-input",
-            "593-checker-boolean-2-integral-conv",
-            "593-checker-long-2-float-regression",
-            "593-checker-shift-and-simplifier",
-            "594-checker-array-alias",
-            "594-checker-irreducible-linorder",
-            "596-checker-dead-phi",
-            "598-checker-irreducible-dominance",
-            "599-checker-irreducible-loop",
-            "603-checker-instanceof",
-            "608-checker-unresolved-lse",
-            "609-checker-inline-interface",
-            "609-checker-x86-bounds-check",
-            "611-checker-simplify-if",
-            "614-checker-dump-constant-location",
-            "615-checker-arm64-store-zero",
-            "618-checker-induction",
-            "619-checker-current-method",
-            "620-checker-bce-intrinsics",
-            "622-checker-bce-regressions",
-            "623-checker-loop-regressions",
-            "624-checker-stringops",
-            "625-checker-licm-regressions",
-            "626-checker-arm64-scratch-register",
-            "627-checker-unroll",
-            "631-checker-fp-abs",
-            "631-checker-get-class",
-            "632-checker-char-at-bounds",
-            "633-checker-rtp-getclass",
-            "635-checker-arm64-volatile-load-cc",
-            "637-checker-throw-inline",
-            "638-checker-inline-caches",
-            "639-checker-code-sinking",
-            "640-checker-boolean-simd",
-            "640-checker-byte-simd",
-            "640-checker-char-simd",
-            "640-checker-double-simd",
-            "640-checker-float-simd",
-            "640-checker-integer-valueof",
-            "640-checker-int-simd",
-            "640-checker-long-simd",
-            "640-checker-short-simd",
-            "641-checker-arraycopy",
-            "643-checker-bogus-ic",
-            "645-checker-abs-simd",
-            "663-checker-select-generator",
-            "706-checker-scheduler"],
+        "test_patterns": ["616-cha.*"],
+        "description": ["cha tests rely on knowing more about the state of the JIT then is possible with jvmti-stress"],
+        "variant": "jvmti-stress & jit | redefine-stress & jit"
+    },
+    {
+        "tests": [ "663-odd-dex-size",
+                   "663-odd-dex-size2",
+                   "663-odd-dex-size3",
+                   "663-odd-dex-size4" ],
+        "description": ["All the odd-dex-size tests cause slicer to emit warnings."],
+        "variant": "jvmti-stress | redefine-stress"
+    },
+    {
+        "test_patterns": ["[0-9]*-checker-.*"],
         "description": ["Checker tests are not compatible with jvmti."],
         "variant": "jvmti-stress | redefine-stress | trace-stress | field-stress | step-stress"
     },
@@ -539,20 +392,34 @@
         "variant": "jvmti-stress | redefine-stress | trace-stress | step-stress"
     },
     {
+        "tests": ["082-inline-execute"],
+        "description": ["speed-profile seems to cause the agent to be given an invalid dex file" ],
+        "bug": "b/65452964",
+        "variant": "redefine-stress & speed-profile | jvmti-stress & speed-profile"
+    },
+    {
+        "tests": ["701-easy-div-rem",
+                  "303-verification-stress"],
+        "description": ["speed-profile leads to dex files that slicer emits warnings about"],
+        "variant": "redefine-stress & speed-profile | jvmti-stress & speed-profile"
+    },
+    {
         "tests": [
             "950-redefine-intrinsic",
             "951-threaded-obsolete",
             "952-invoke-custom",
+            "952-invoke-custom-kinds",
             "953-invoke-polymorphic-compiler",
             "954-invoke-polymorphic-verifier",
             "955-methodhandles-smali",
             "956-methodhandles",
             "957-methodhandle-transforms",
             "958-methodhandle-stackframe",
-            "959-invoke-polymorphic-accessors"
+            "959-invoke-polymorphic-accessors",
+            "990-method-handle-and-mr"
         ],
         "description": [
-            "Tests that use dex version 38 which is not yet supported by",
+            "Tests that use invoke-polymorphic/invoke-custom which is not yet supported by",
             "dexter/slicer."
         ],
         "bug": "b/37272822",
@@ -620,6 +487,13 @@
         "variant": "jvmti-stress | redefine-stress"
     },
     {
+        "tests": [ "1911-get-local-var-table" ],
+        "description": [
+            "Test that relies on knowing the exact layout of a dex file"
+        ],
+        "variant": "jvmti-stress | redefine-stress"
+    },
+    {
         "tests": [
             "536-checker-needs-access-check",
             "537-checker-inline-and-unverified",
@@ -729,9 +603,9 @@
     },
     {
         "tests": "660-clinit",
-        "variant": "no-image | no-dex2oat | no-prebuild",
-        "description": ["Tests <clinit> for app images, which --no-image, --no-prebuild and",
-                        "--no-dex2oat do not create"]
+        "variant": "no-image | no-dex2oat | no-prebuild | jvmti-stress | redefine-stress",
+        "description": ["Tests <clinit> for app images, which --no-image, --no-prebuild, ",
+                        "--no-dex2oat, and --redefine-stress do not create"]
     },
     {
         "tests": ["961-default-iface-resolution-gen",
@@ -744,5 +618,10 @@
         "tests": "664-aget-verifier",
         "description": ["Aget on potentially null array fails verification."],
         "bug": "b/64683522"
+    },
+    {
+        "tests": "661-oat-writer-layout",
+        "variant": "interp-ac | interpreter | jit | no-dex2oat | no-prebuild | no-image | trace",
+        "description": ["Test is designed to only check --compiler-filter=speed"]
     }
 ]
diff --git a/test/testrunner/env.py b/test/testrunner/env.py
index d45d009..cc19afc 100644
--- a/test/testrunner/env.py
+++ b/test/testrunner/env.py
@@ -115,82 +115,9 @@
 # Keep going after encountering a test failure?
 ART_TEST_KEEP_GOING = _getEnvBoolean('ART_TEST_KEEP_GOING', True)
 
-# Do you want all tests, even those that are time consuming?
-ART_TEST_FULL = _getEnvBoolean('ART_TEST_FULL', False)
-
-# Do you want interpreter tests run?
-ART_TEST_INTERPRETER = _getEnvBoolean('ART_TEST_INTERPRETER', ART_TEST_FULL)
-ART_TEST_INTERPRETER_ACCESS_CHECKS = _getEnvBoolean('ART_TEST_INTERPRETER_ACCESS_CHECKS',
-                                                   ART_TEST_FULL)
-
-# Do you want JIT tests run?
-ART_TEST_JIT = _getEnvBoolean('ART_TEST_JIT', ART_TEST_FULL)
-
-# Do you want optimizing compiler tests run?
-ART_TEST_OPTIMIZING = _getEnvBoolean('ART_TEST_OPTIMIZING', ART_TEST_FULL)
-
-# Do you want to test the optimizing compiler with graph coloring register allocation?
-ART_TEST_OPTIMIZING_GRAPH_COLOR = _getEnvBoolean('ART_TEST_OPTIMIZING_GRAPH_COLOR', ART_TEST_FULL)
-
-# Do you want to do run-tests with profiles?
-ART_TEST_SPEED_PROFILE = _getEnvBoolean('ART_TEST_SPEED_PROFILE', ART_TEST_FULL)
-
-# Do we want to test PIC-compiled tests ("apps")?
-ART_TEST_PIC_TEST = _getEnvBoolean('ART_TEST_PIC_TEST', ART_TEST_FULL)
-# Do you want tracing tests run?
-ART_TEST_TRACE = _getEnvBoolean('ART_TEST_TRACE', ART_TEST_FULL)
-
-# Do you want tracing tests (streaming mode) run?
-ART_TEST_TRACE_STREAM = _getEnvBoolean('ART_TEST_TRACE_STREAM', ART_TEST_FULL)
-
-# Do you want tests with GC verification enabled run?
-ART_TEST_GC_VERIFY = _getEnvBoolean('ART_TEST_GC_VERIFY', ART_TEST_FULL)
-
-# Do you want tests with the GC stress mode enabled run?
-ART_TEST_GC_STRESS = _getEnvBoolean('ART_TEST_GC_STRESS', ART_TEST_FULL)
-
-# Do you want tests with the JNI forcecopy mode enabled run?
-ART_TEST_JNI_FORCECOPY = _getEnvBoolean('ART_TEST_JNI_FORCECOPY', ART_TEST_FULL)
-
-# Do you want run-tests with relocation disabled run?
-ART_TEST_RUN_TEST_RELOCATE = _getEnvBoolean('ART_TEST_RUN_TEST_RELOCATE', ART_TEST_FULL)
-
-# Do you want run-tests with prebuilding?
-ART_TEST_RUN_TEST_PREBUILD = _getEnvBoolean('ART_TEST_RUN_TEST_PREBUILD', ART_TEST_FULL)
-
-# Do you want run-tests with no prebuilding enabled run?
-ART_TEST_RUN_TEST_NO_PREBUILD = _getEnvBoolean('ART_TEST_RUN_TEST_NO_PREBUILD', ART_TEST_FULL)
-
-# Do you want run-tests with a pregenerated core.art?
-ART_TEST_RUN_TEST_IMAGE = _getEnvBoolean('ART_TEST_RUN_TEST_IMAGE', ART_TEST_FULL)
-
-# Do you want run-tests without a pregenerated core.art?
-ART_TEST_RUN_TEST_NO_IMAGE = _getEnvBoolean('ART_TEST_RUN_TEST_NO_IMAGE', ART_TEST_FULL)
-
-# Do you want run-tests with relocation enabled but patchoat failing?
-ART_TEST_RUN_TEST_RELOCATE_NO_PATCHOAT = _getEnvBoolean('ART_TEST_RUN_TEST_RELOCATE_NO_PATCHOAT',
-                                                       ART_TEST_FULL)
-
-# Do you want run-tests without a dex2oat?
-ART_TEST_RUN_TEST_NO_DEX2OAT = _getEnvBoolean('ART_TEST_RUN_TEST_NO_DEX2OAT', ART_TEST_FULL)
-
-# Do you want run-tests with libartd.so?
-ART_TEST_RUN_TEST_DEBUG = _getEnvBoolean('ART_TEST_RUN_TEST_DEBUG', ART_TEST_FULL)
-
-# Do you want run-tests with libart.so?
-ART_TEST_RUN_TEST_NDEBUG = _getEnvBoolean('ART_TEST_RUN_TEST_NDEBUG', ART_TEST_FULL)
-
 # Do you want failed tests to have their artifacts cleaned up?
 ART_TEST_RUN_TEST_ALWAYS_CLEAN = _getEnvBoolean('ART_TEST_RUN_TEST_ALWAYS_CLEAN', True)
 
-# Do you want run-tests with the --debuggable flag
-ART_TEST_RUN_TEST_DEBUGGABLE = _getEnvBoolean('ART_TEST_RUN_TEST_DEBUGGABLE', ART_TEST_FULL)
-
-# Do you want to test multi-part boot-image functionality?
-ART_TEST_RUN_TEST_MULTI_IMAGE = _getEnvBoolean('ART_TEST_RUN_TEST_MULTI_IMAGE', ART_TEST_FULL)
-
-ART_TEST_DEBUG_GC = _getEnvBoolean('ART_TEST_DEBUG_GC', False)
-
 ART_TEST_BISECTION = _getEnvBoolean('ART_TEST_BISECTION', False)
 
 DEX2OAT_HOST_INSTRUCTION_SET_FEATURES = _env.get('DEX2OAT_HOST_INSTRUCTION_SET_FEATURES')
@@ -217,8 +144,6 @@
 # Note: ART_2ND_PHONY_TEST_HOST_SUFFIX is 2ND_ART_PHONY_HOST_TARGET_SUFFIX in .mk files
 # Python does not let us have variable names starting with a digit, so it has differ.
 
-ART_TEST_RUN_TEST_JVMTI_STRESS = _getEnvBoolean('ART_TEST_RUN_TEST_JVMTI_STRESS', ART_TEST_FULL)
-
 if TARGET_2ND_ARCH:
   if "64" in TARGET_ARCH:
     ART_PHONY_TEST_TARGET_SUFFIX = "64"
diff --git a/test/testrunner/testrunner.py b/test/testrunner/testrunner.py
index f425097..2a772ff 100755
--- a/test/testrunner/testrunner.py
+++ b/test/testrunner/testrunner.py
@@ -45,6 +45,7 @@
 
 """
 import argparse
+import collections
 import fnmatch
 import itertools
 import json
@@ -60,21 +61,6 @@
 import env
 from target_config import target_config
 
-TARGET_TYPES = set()
-RUN_TYPES = set()
-PREBUILD_TYPES = set()
-COMPILER_TYPES = set()
-RELOCATE_TYPES = set()
-TRACE_TYPES = set()
-GC_TYPES = set()
-JNI_TYPES = set()
-IMAGE_TYPES = set()
-PICTEST_TYPES = set()
-DEBUGGABLE_TYPES = set()
-ADDRESS_SIZES = set()
-OPTIMIZING_COMPILER_TYPES = set()
-JVMTI_TYPES = set()
-ADDRESS_SIZES_TARGET = {'host': set(), 'target': set()}
 # timeout for individual tests.
 # TODO: make it adjustable per tests and for buildbots
 timeout = 3000 # 50 minutes
@@ -128,6 +114,12 @@
 gdb_arg = ''
 stop_testrunner = False
 dex2oat_jobs = -1   # -1 corresponds to default threads for dex2oat
+run_all_configs = False
+
+# Dict to store user requested test variants.
+# key: variant_type.
+# value: set of variants user wants to run of type <key>.
+_user_input_variants = collections.defaultdict(set)
 
 def gather_test_info():
   """The method gathers test information about the test to be run which includes
@@ -151,7 +143,7 @@
   VARIANT_TYPE_DICT['jvmti'] = {'no-jvmti', 'jvmti-stress', 'redefine-stress', 'trace-stress',
                                 'field-stress', 'step-stress'}
   VARIANT_TYPE_DICT['compiler'] = {'interp-ac', 'interpreter', 'jit', 'optimizing',
-                              'regalloc_gc', 'speed-profile'}
+                                   'regalloc_gc', 'speed-profile'}
 
   for v_type in VARIANT_TYPE_DICT:
     TOTAL_VARIANTS_SET = TOTAL_VARIANTS_SET.union(VARIANT_TYPE_DICT.get(v_type))
@@ -173,106 +165,75 @@
     # Bisection search writes to standard output.
     env.ART_TEST_QUIET = False
 
-  if not TARGET_TYPES:
-    TARGET_TYPES.add('host')
-    TARGET_TYPES.add('target')
+  global _user_input_variants
+  global run_all_configs
+  if run_all_configs:
+    target_types = _user_input_variants['target']
+    _user_input_variants = VARIANT_TYPE_DICT
+    _user_input_variants['target'] = target_types
 
-  if env.ART_TEST_RUN_TEST_NO_PREBUILD:
-    PREBUILD_TYPES.add('no-prebuild')
-  if env.ART_TEST_RUN_TEST_NO_DEX2OAT:
-    PREBUILD_TYPES.add('no-dex2oat')
-  if env.ART_TEST_RUN_TEST_PREBUILD or not PREBUILD_TYPES: # Default
-    PREBUILD_TYPES.add('prebuild')
+  if not _user_input_variants['target']:
+    _user_input_variants['target'].add('host')
+    _user_input_variants['target'].add('target')
 
-  if env.ART_TEST_INTERPRETER_ACCESS_CHECKS:
-    COMPILER_TYPES.add('interp-ac')
-  if env.ART_TEST_INTERPRETER:
-    COMPILER_TYPES.add('interpreter')
-  if env.ART_TEST_JIT:
-    COMPILER_TYPES.add('jit')
-  if env.ART_TEST_OPTIMIZING_GRAPH_COLOR:
-    COMPILER_TYPES.add('regalloc_gc')
-    OPTIMIZING_COMPILER_TYPES.add('regalloc_gc')
-  if env.ART_TEST_OPTIMIZING:
-    COMPILER_TYPES.add('optimizing')
-    OPTIMIZING_COMPILER_TYPES.add('optimizing')
-  if env.ART_TEST_SPEED_PROFILE:
-    COMPILER_TYPES.add('speed-profile')
+  if not _user_input_variants['prebuild']: # Default
+    _user_input_variants['prebuild'].add('prebuild')
 
   # By default only run without jvmti
-  if not JVMTI_TYPES:
-    JVMTI_TYPES.add('no-jvmti')
+  if not _user_input_variants['jvmti']:
+    _user_input_variants['jvmti'].add('no-jvmti')
 
   # By default we run all 'compiler' variants.
-  if not COMPILER_TYPES:
-    COMPILER_TYPES.add('optimizing')
-    COMPILER_TYPES.add('jit')
-    COMPILER_TYPES.add('interpreter')
-    COMPILER_TYPES.add('interp-ac')
-    COMPILER_TYPES.add('speed-profile')
-    OPTIMIZING_COMPILER_TYPES.add('optimizing')
+  if not _user_input_variants['compiler']:
+    _user_input_variants['compiler'].add('optimizing')
+    _user_input_variants['compiler'].add('jit')
+    _user_input_variants['compiler'].add('interpreter')
+    _user_input_variants['compiler'].add('interp-ac')
+    _user_input_variants['compiler'].add('speed-profile')
 
-  if env.ART_TEST_RUN_TEST_RELOCATE:
-    RELOCATE_TYPES.add('relocate')
-  if env.ART_TEST_RUN_TEST_RELOCATE_NO_PATCHOAT:
-    RELOCATE_TYPES.add('relocate-npatchoat')
-  if not RELOCATE_TYPES: # Default
-    RELOCATE_TYPES.add('no-relocate')
+  if not _user_input_variants['relocate']: # Default
+    _user_input_variants['relocate'].add('no-relocate')
 
-  if env.ART_TEST_TRACE:
-    TRACE_TYPES.add('trace')
-  if env.ART_TEST_TRACE_STREAM:
-    TRACE_TYPES.add('stream')
-  if not TRACE_TYPES: # Default
-    TRACE_TYPES.add('ntrace')
+  if not _user_input_variants['trace']: # Default
+    _user_input_variants['trace'].add('ntrace')
 
-  if env.ART_TEST_GC_STRESS:
-    GC_TYPES.add('gcstress')
-  if env.ART_TEST_GC_VERIFY:
-    GC_TYPES.add('gcverify')
-  if not GC_TYPES: # Default
-    GC_TYPES.add('cms')
+  if not _user_input_variants['gc']: # Default
+    _user_input_variants['gc'].add('cms')
 
-  if env.ART_TEST_JNI_FORCECOPY:
-    JNI_TYPES.add('forcecopy')
-  if not JNI_TYPES: # Default
-    JNI_TYPES.add('checkjni')
+  if not _user_input_variants['jni']: # Default
+    _user_input_variants['jni'].add('checkjni')
 
-  if env.ART_TEST_RUN_TEST_NO_IMAGE:
-    IMAGE_TYPES.add('no-image')
-  if env.ART_TEST_RUN_TEST_MULTI_IMAGE:
-    IMAGE_TYPES.add('multipicimage')
-  if env.ART_TEST_RUN_TEST_IMAGE or not IMAGE_TYPES: # Default
-    IMAGE_TYPES.add('picimage')
+  if not _user_input_variants['image']: # Default
+    _user_input_variants['image'].add('picimage')
 
-  if env.ART_TEST_PIC_TEST:
-    PICTEST_TYPES.add('pictest')
-  if not PICTEST_TYPES: # Default
-    PICTEST_TYPES.add('npictest')
 
-  if env.ART_TEST_RUN_TEST_NDEBUG:
-    RUN_TYPES.add('ndebug')
-  if env.ART_TEST_RUN_TEST_DEBUG or not RUN_TYPES: # Default
-    RUN_TYPES.add('debug')
+  if not _user_input_variants['pictest']: # Default
+    _user_input_variants['pictest'].add('npictest')
 
-  if env.ART_TEST_RUN_TEST_DEBUGGABLE:
-    DEBUGGABLE_TYPES.add('debuggable')
-  if not DEBUGGABLE_TYPES: # Default
-    DEBUGGABLE_TYPES.add('ndebuggable')
+  if not _user_input_variants['debuggable']: # Default
+    _user_input_variants['debuggable'].add('ndebuggable')
 
-  if not ADDRESS_SIZES:
-    ADDRESS_SIZES_TARGET['target'].add(env.ART_PHONY_TEST_TARGET_SUFFIX)
-    ADDRESS_SIZES_TARGET['host'].add(env.ART_PHONY_TEST_HOST_SUFFIX)
+  if not _user_input_variants['run']: # Default
+    _user_input_variants['run'].add('debug')
+
+  _user_input_variants['address_sizes_target'] = collections.defaultdict(set)
+  if not _user_input_variants['address_sizes']:
+    _user_input_variants['address_sizes_target']['target'].add(
+        env.ART_PHONY_TEST_TARGET_SUFFIX)
+    _user_input_variants['address_sizes_target']['host'].add(
+        env.ART_PHONY_TEST_HOST_SUFFIX)
     if env.ART_TEST_RUN_TEST_2ND_ARCH:
-      ADDRESS_SIZES_TARGET['host'].add(env.ART_2ND_PHONY_TEST_HOST_SUFFIX)
-      ADDRESS_SIZES_TARGET['target'].add(env.ART_2ND_PHONY_TEST_TARGET_SUFFIX)
+      _user_input_variants['address_sizes_target']['host'].add(
+          env.ART_2ND_PHONY_TEST_HOST_SUFFIX)
+      _user_input_variants['address_sizes_target']['target'].add(
+          env.ART_2ND_PHONY_TEST_TARGET_SUFFIX)
   else:
-    ADDRESS_SIZES_TARGET['host'] = ADDRESS_SIZES_TARGET['host'].union(ADDRESS_SIZES)
-    ADDRESS_SIZES_TARGET['target'] = ADDRESS_SIZES_TARGET['target'].union(ADDRESS_SIZES)
+    _user_input_variants['address_sizes_target']['host'] = _user_input_variants['address_sizes']
+    _user_input_variants['address_sizes_target']['target'] = _user_input_variants['address_sizes']
 
   global n_thread
   if n_thread is -1:
-    if 'target' in TARGET_TYPES:
+    if 'target' in _user_input_variants['target']:
       n_thread = get_default_threads('target')
     else:
       n_thread = get_default_threads('host')
@@ -308,20 +269,12 @@
   options_all = ''
   global total_test_count
   total_test_count = len(tests)
-  total_test_count *= len(RUN_TYPES)
-  total_test_count *= len(PREBUILD_TYPES)
-  total_test_count *= len(RELOCATE_TYPES)
-  total_test_count *= len(TRACE_TYPES)
-  total_test_count *= len(GC_TYPES)
-  total_test_count *= len(JNI_TYPES)
-  total_test_count *= len(IMAGE_TYPES)
-  total_test_count *= len(PICTEST_TYPES)
-  total_test_count *= len(DEBUGGABLE_TYPES)
-  total_test_count *= len(COMPILER_TYPES)
-  total_test_count *= len(JVMTI_TYPES)
+  for variant_type in VARIANT_TYPE_DICT:
+    if not (variant_type == 'target' or 'address_sizes' in variant_type):
+      total_test_count *= len(_user_input_variants[variant_type])
   target_address_combinations = 0
-  for target in TARGET_TYPES:
-    for address_size in ADDRESS_SIZES_TARGET[target]:
+  for target in _user_input_variants['target']:
+    for address_size in _user_input_variants['address_sizes_target'][target]:
       target_address_combinations += 1
   total_test_count *= target_address_combinations
 
@@ -345,14 +298,16 @@
   if dex2oat_jobs != -1:
     options_all += ' --dex2oat-jobs ' + str(dex2oat_jobs)
 
-  config = itertools.product(tests, TARGET_TYPES, RUN_TYPES, PREBUILD_TYPES,
-                             COMPILER_TYPES, RELOCATE_TYPES, TRACE_TYPES,
-                             GC_TYPES, JNI_TYPES, IMAGE_TYPES, PICTEST_TYPES,
-                             DEBUGGABLE_TYPES, JVMTI_TYPES)
+  config = itertools.product(tests, _user_input_variants['target'], _user_input_variants['run'],
+                             _user_input_variants['prebuild'], _user_input_variants['compiler'],
+                             _user_input_variants['relocate'], _user_input_variants['trace'],
+                             _user_input_variants['gc'], _user_input_variants['jni'],
+                             _user_input_variants['image'], _user_input_variants['pictest'],
+                             _user_input_variants['debuggable'], _user_input_variants['jvmti'])
 
   for test, target, run, prebuild, compiler, relocate, trace, gc, \
       jni, image, pictest, debuggable, jvmti in config:
-    for address_size in ADDRESS_SIZES_TARGET[target]:
+    for address_size in _user_input_variants['address_sizes_target'][target]:
       if stop_testrunner:
         # When ART_TEST_KEEP_GOING is set to false, then as soon as a test
         # fails, stop_testrunner is set to True. When this happens, the method
@@ -577,11 +532,10 @@
       total_test_count)
 
     if result == 'FAIL' or result == 'TIMEOUT':
-      info += ('%s %s %s\n%s\n') % (
+      info += ('%s %s %s\n') % (
         progress_info,
         test_name,
-        COLOR_ERROR + result + COLOR_NORMAL,
-        failed_test_info)
+        COLOR_ERROR + result + COLOR_NORMAL)
     else:
       result_text = ''
       if result == 'PASS':
@@ -617,6 +571,7 @@
 def verify_knownfailure_entry(entry):
   supported_field = {
       'tests' : (list, str),
+      'test_patterns' : (list,),
       'description' : (list, str),
       'bug' : (str,),
       'variant' : (str,),
@@ -650,6 +605,11 @@
     tests = failure.get('tests', [])
     if isinstance(tests, str):
       tests = [tests]
+    patterns = failure.get("test_patterns", [])
+    if (not isinstance(patterns, list)):
+      raise ValueError("test_patters is not a list in %s" % failure)
+
+    tests += [f for f in RUN_TEST_SET if any(re.match(pat, f) is not None for pat in patterns)]
     variants = parse_variants(failure.get('variant'))
     env_vars = failure.get('env_vars')
 
@@ -804,19 +764,19 @@
   regex += '(' + '|'.join(VARIANT_TYPE_DICT['address_sizes']) + ')$'
   match = re.match(regex, test_name)
   if match:
-    TARGET_TYPES.add(match.group(1))
-    RUN_TYPES.add(match.group(2))
-    PREBUILD_TYPES.add(match.group(3))
-    COMPILER_TYPES.add(match.group(4))
-    RELOCATE_TYPES.add(match.group(5))
-    TRACE_TYPES.add(match.group(6))
-    GC_TYPES.add(match.group(7))
-    JNI_TYPES.add(match.group(8))
-    IMAGE_TYPES.add(match.group(9))
-    PICTEST_TYPES.add(match.group(10))
-    DEBUGGABLE_TYPES.add(match.group(11))
-    JVMTI_TYPES.add(match.group(12))
-    ADDRESS_SIZES.add(match.group(14))
+    _user_input_variants['target'].add(match.group(1))
+    _user_input_variants['run'].add(match.group(2))
+    _user_input_variants['prebuild'].add(match.group(3))
+    _user_input_variants['compiler'].add(match.group(4))
+    _user_input_variants['relocate'].add(match.group(5))
+    _user_input_variants['trace'].add(match.group(6))
+    _user_input_variants['gc'].add(match.group(7))
+    _user_input_variants['jni'].add(match.group(8))
+    _user_input_variants['image'].add(match.group(9))
+    _user_input_variants['pictest'].add(match.group(10))
+    _user_input_variants['debuggable'].add(match.group(11))
+    _user_input_variants['jvmti'].add(match.group(12))
+    _user_input_variants['address_sizes'].add(match.group(14))
     return {match.group(13)}
   raise ValueError(test_name + " is not a valid test")
 
@@ -865,6 +825,7 @@
   global gdb_arg
   global timeout
   global dex2oat_jobs
+  global run_all_configs
 
   parser = argparse.ArgumentParser(description="Runs all or a subset of the ART test suite.")
   parser.add_argument('-t', '--test', dest='test', help='name of the test')
@@ -872,10 +833,7 @@
   parser.add_argument('--timeout', default=timeout, type=int, dest='timeout')
   for variant in TOTAL_VARIANTS_SET:
     flag = '--' + variant
-    flag_dest = variant.replace('-', '_')
-    if variant == '32' or variant == '64':
-      flag_dest = 'n' + flag_dest
-    parser.add_argument(flag, action='store_true', dest=flag_dest)
+    parser.add_argument(flag, action='store_true', dest=variant)
   parser.add_argument('--verbose', '-v', action='store_true', dest='verbose')
   parser.add_argument('--dry-run', action='store_true', dest='dry_run')
   parser.add_argument("--skip", action="append", dest="skips", default=[],
@@ -894,6 +852,8 @@
   parser.add_argument('--gdb-arg', dest='gdb_arg')
   parser.add_argument('--dex2oat-jobs', type=int, dest='dex2oat_jobs',
                       help='Number of dex2oat jobs')
+  parser.add_argument('-a', '--all', action='store_true', dest='run_all',
+                      help="Run all the possible configurations for the input test set")
 
   options = vars(parser.parse_args())
   if options['build_target']:
@@ -904,82 +864,12 @@
   env.EXTRA_DISABLED_TESTS.update(set(options['skips']))
   if options['test']:
     test = parse_test_name(options['test'])
-  if options['pictest']:
-    PICTEST_TYPES.add('pictest')
-  if options['ndebug']:
-    RUN_TYPES.add('ndebug')
-  if options['interp_ac']:
-    COMPILER_TYPES.add('interp-ac')
-  if options['picimage']:
-    IMAGE_TYPES.add('picimage')
-  if options['n64']:
-    ADDRESS_SIZES.add('64')
-  if options['interpreter']:
-    COMPILER_TYPES.add('interpreter')
-  if options['jni']:
-    JNI_TYPES.add('jni')
-  if options['relocate_npatchoat']:
-    RELOCATE_TYPES.add('relocate-npatchoat')
-  if options['no_prebuild']:
-    PREBUILD_TYPES.add('no-prebuild')
-  if options['npictest']:
-    PICTEST_TYPES.add('npictest')
-  if options['no_dex2oat']:
-    PREBUILD_TYPES.add('no-dex2oat')
-  if options['jit']:
-    COMPILER_TYPES.add('jit')
-  if options['relocate']:
-    RELOCATE_TYPES.add('relocate')
-  if options['ndebuggable']:
-    DEBUGGABLE_TYPES.add('ndebuggable')
-  if options['no_image']:
-    IMAGE_TYPES.add('no-image')
-  if options['optimizing']:
-    COMPILER_TYPES.add('optimizing')
-  if options['speed_profile']:
-    COMPILER_TYPES.add('speed-profile')
-  if options['trace']:
-    TRACE_TYPES.add('trace')
-  if options['gcstress']:
-    GC_TYPES.add('gcstress')
-  if options['no_relocate']:
-    RELOCATE_TYPES.add('no-relocate')
-  if options['target']:
-    TARGET_TYPES.add('target')
-  if options['forcecopy']:
-    JNI_TYPES.add('forcecopy')
-  if options['n32']:
-    ADDRESS_SIZES.add('32')
-  if options['host']:
-    TARGET_TYPES.add('host')
-  if options['gcverify']:
-    GC_TYPES.add('gcverify')
-  if options['debuggable']:
-    DEBUGGABLE_TYPES.add('debuggable')
-  if options['prebuild']:
-    PREBUILD_TYPES.add('prebuild')
-  if options['debug']:
-    RUN_TYPES.add('debug')
-  if options['checkjni']:
-    JNI_TYPES.add('checkjni')
-  if options['ntrace']:
-    TRACE_TYPES.add('ntrace')
-  if options['cms']:
-    GC_TYPES.add('cms')
-  if options['multipicimage']:
-    IMAGE_TYPES.add('multipicimage')
-  if options['jvmti_stress']:
-    JVMTI_TYPES.add('jvmti-stress')
-  if options['redefine_stress']:
-    JVMTI_TYPES.add('redefine-stress')
-  if options['field_stress']:
-    JVMTI_TYPES.add('field-stress')
-  if options['step_stress']:
-    JVMTI_TYPES.add('step-stress')
-  if options['trace_stress']:
-    JVMTI_TYPES.add('trace-stress')
-  if options['no_jvmti']:
-    JVMTI_TYPES.add('no-jvmti')
+
+  for variant_type in VARIANT_TYPE_DICT:
+    for variant in VARIANT_TYPE_DICT[variant_type]:
+      if options.get(variant):
+        _user_input_variants[variant_type].add(variant)
+
   if options['verbose']:
     verbose = True
   if options['n_thread']:
@@ -996,6 +886,8 @@
   timeout = options['timeout']
   if options['dex2oat_jobs']:
     dex2oat_jobs = options['dex2oat_jobs']
+  if options['run_all']:
+    run_all_configs = True
 
   return test
 
@@ -1005,9 +897,9 @@
   setup_test_env()
   if build:
     build_targets = ''
-    if 'host' in TARGET_TYPES:
+    if 'host' in _user_input_variants['target']:
       build_targets += 'test-art-host-run-test-dependencies'
-    if 'target' in TARGET_TYPES:
+    if 'target' in _user_input_variants['target']:
       build_targets += 'test-art-target-run-test-dependencies'
     build_command = 'make'
     build_command += ' -j'
diff --git a/tools/ahat/Android.mk b/tools/ahat/Android.mk
index 4b3044a..cf31e2e 100644
--- a/tools/ahat/Android.mk
+++ b/tools/ahat/Android.mk
@@ -42,7 +42,9 @@
 
 # The ahat tests rely on running ART to generate a heap dump for test, but ART
 # doesn't run on darwin. Only build and run the tests for linux.
+# There are also issues with running under instrumentation.
 ifeq ($(HOST_OS),linux)
+ifneq ($(EMMA_INSTRUMENT),true)
 # --- ahat-test-dump.jar --------------
 include $(CLEAR_VARS)
 LOCAL_MODULE := ahat-test-dump
@@ -105,6 +107,7 @@
 ahat-test: PRIVATE_AHAT_TEST_JAR := $(AHAT_TEST_JAR)
 ahat-test: $(AHAT_TEST_JAR)
 	java -enableassertions -jar $(PRIVATE_AHAT_TEST_JAR)
+endif # EMMA_INSTRUMENT
 endif # linux
 
 # Clean up local variables.
diff --git a/tools/cpp-define-generator/Android.bp b/tools/cpp-define-generator/Android.bp
index 59c5211..57c9c09 100644
--- a/tools/cpp-define-generator/Android.bp
+++ b/tools/cpp-define-generator/Android.bp
@@ -20,7 +20,7 @@
 //
 // In the future we may wish to parameterize this on (32,64)x(read_barrier,no_read_barrier).
 
-cc_binary {  // Do not use art_cc_binary because HOST_PREFER_32_BIT is incompatible with genrule.
+cc_binary { // Do not use art_cc_binary because HOST_PREFER_32_BIT is incompatible with genrule.
     name: "cpp-define-generator-data",
     host_supported: true,
     device_supported: false,
@@ -39,9 +39,9 @@
 // For the exact filename that this generates to run make command on just
 // this rule later.
 genrule {
-  name: "cpp-define-generator-asm-support",
-  out: ["asm_support_gen.h"],
-  tools: ["cpp-define-generator-data"],
-  tool_files: ["verify-asm-support"],
-  cmd: "$(location verify-asm-support) --quiet \"$(location cpp-define-generator-data)\" \"$(out)\""
+    name: "cpp-define-generator-asm-support",
+    out: ["asm_support_gen.h"],
+    tools: ["cpp-define-generator-data"],
+    tool_files: ["verify-asm-support"],
+    cmd: "$(location verify-asm-support) --quiet \"$(location cpp-define-generator-data)\" \"$(out)\"",
 }
diff --git a/tools/libjdwp_art_failures.txt b/tools/libjdwp_art_failures.txt
new file mode 100644
index 0000000..6b5daec
--- /dev/null
+++ b/tools/libjdwp_art_failures.txt
@@ -0,0 +1,102 @@
+/*
+ * This file contains expectations for ART's buildbot. The purpose of this file is
+ * to temporarily list failing tests and not break the bots.
+ */
+[
+{
+  description: "Test fails due to unexpectedly getting the thread-groups of zombie threads",
+  result: EXEC_FAILED,
+  bug: 66906414,
+  name: "org.apache.harmony.jpda.tests.jdwp.ThreadReference.ThreadGroup002Test#testThreadGroup002"
+},
+{
+  description: "Test fails due to modifiers not including ACC_SUPER",
+  result: EXEC_FAILED,
+  bug: 66906055,
+  name: "org.apache.harmony.jpda.tests.jdwp.ReferenceType.ModifiersTest#testModifiers001"
+},
+{
+  description: "Test fails due to static values not being set correctly.",
+  result: EXEC_FAILED,
+  bug: 66905894,
+  name: "org.apache.harmony.jpda.tests.jdwp.ReferenceType.GetValues006Test#testGetValues006"
+},
+{
+  description: "Tests fail due to using the not yet supported interrupt thread functions",
+  result: EXEC_FAILED,
+  bug: 34415266,
+  names: [ "org.apache.harmony.jpda.tests.jdwp.ThreadReference.CurrentContendedMonitorTest#testCurrentContendedMonitor001",
+           "org.apache.harmony.jpda.tests.jdwp.ThreadReference.InterruptTest#testInterrupt001" ]
+},
+{
+  description: "Tests fail with assertion error on slot number",
+  result: EXEC_FAILED,
+  bug: 66905468,
+  names: [ "org.apache.harmony.jpda.tests.jdwp.Method.VariableTableTest#testVariableTableTest001",
+           "org.apache.harmony.jpda.tests.jdwp.Method.VariableTableWithGenericTest#testVariableTableWithGenericTest001" ]
+},
+{
+  description: "Test fails with assertion error 'Invalid Path' for class path.",
+  result: EXEC_FAILED,
+  bug: 66904994,
+  name: "org.apache.harmony.jpda.tests.jdwp.VirtualMachine.ClassPathsTest#testClassPaths001"
+},
+{
+  description: "Test fails with Error VM_DEAD when trying to resume during VM_DEATH event",
+  result: EXEC_FAILED,
+  bug: 66904725,
+  name: "org.apache.harmony.jpda.tests.jdwp.Events.VMDeath002Test#testVMDeathRequest"
+},
+{
+  description: "Test fails with INTERNAL error due to proxy frame!",
+  result: EXEC_FAILED,
+  bug: 66903662,
+  name: "org.apache.harmony.jpda.tests.jdwp.StackFrame.ProxyThisObjectTest#testThisObject"
+},
+{
+  description: "Test fails with unexpected TYPE_MISMATCH error",
+  result: EXEC_FAILED,
+  bug: 66904008,
+  name: "org.apache.harmony.jpda.tests.jdwp.StackFrame.ThisObjectTest#testThisObjectTest001"
+},
+{
+  description: "Tests that fail only on ART with INVALID_SLOT error",
+  result: EXEC_FAILED,
+  bug: 66903181,
+  names: [ "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testBreakpoint",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testException",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testFieldAccess",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testFieldModification",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testMethodEntry",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testMethodExit",
+           "org.apache.harmony.jpda.tests.jdwp.EventModifiers.InstanceOnlyModifierTest#testMethodExitWithReturnValue" ]
+},
+/* TODO Categorize these failures more. */
+{
+  description: "Tests that fail on both ART and RI. These tests are likely incorrect",
+  result: EXEC_FAILED,
+  bug: 66906734,
+  names: [ "org.apache.harmony.jpda.tests.jdwp.ArrayReference.SetValues003Test#testSetValues003_InvalidIndex",
+           "org.apache.harmony.jpda.tests.jdwp.ClassType.InvokeMethod002Test#testInvokeMethod_wrong_argument_types",
+           "org.apache.harmony.jpda.tests.jdwp.ClassType.InvokeMethodTest#testInvokeMethod002",
+           "org.apache.harmony.jpda.tests.jdwp.ClassType.InvokeMethodTest#testInvokeMethod003",
+           "org.apache.harmony.jpda.tests.jdwp.ClassType.NewInstanceTest#testNewInstance002",
+           "org.apache.harmony.jpda.tests.jdwp.ClassType.SetValues002Test#testSetValues002",
+           "org.apache.harmony.jpda.tests.jdwp.Events.ClassPrepare002Test#testClassPrepareCausedByDebugger",
+           "org.apache.harmony.jpda.tests.jdwp.Events.ExceptionCaughtTest#testExceptionEvent_ThrowLocation_FromNative",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.DisableCollectionTest#testDisableCollection_null",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.EnableCollectionTest#testEnableCollection_invalid",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.EnableCollectionTest#testEnableCollection_null",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.GetValues002Test#testGetValues002",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.SetValues003Test#testSetValues003",
+           "org.apache.harmony.jpda.tests.jdwp.ObjectReference.SetValuesTest#testSetValues001",
+           "org.apache.harmony.jpda.tests.jdwp.ReferenceType.FieldsWithGenericTest#testFieldsWithGeneric001",
+           "org.apache.harmony.jpda.tests.jdwp.ReferenceType.GetValues002Test#testGetValues002",
+           "org.apache.harmony.jpda.tests.jdwp.ReferenceType.GetValues004Test#testGetValues004",
+           "org.apache.harmony.jpda.tests.jdwp.StringReference.ValueTest#testStringReferenceValueTest001_NullString",
+           "org.apache.harmony.jpda.tests.jdwp.ThreadGroupReference.ChildrenTest#testChildren_NullObject",
+           "org.apache.harmony.jpda.tests.jdwp.ThreadGroupReference.NameTest#testName001_NullObject",
+           "org.apache.harmony.jpda.tests.jdwp.ThreadGroupReference.ParentTest#testParent_NullObject",
+           "org.apache.harmony.jpda.tests.jdwp.VirtualMachine.CapabilitiesNewTest#testCapabilitiesNew001" ]
+}
+]
diff --git a/tools/titrace/Android.bp b/tools/titrace/Android.bp
index b95ec9d..097622e 100644
--- a/tools/titrace/Android.bp
+++ b/tools/titrace/Android.bp
@@ -19,7 +19,10 @@
 cc_defaults {
     name: "titrace-defaults",
     host_supported: true,
-    srcs: ["titrace.cc", "instruction_decoder.cc"],
+    srcs: [
+        "titrace.cc",
+        "instruction_decoder.cc",
+    ],
     defaults: ["art_defaults"],
 
     // Note that this tool needs to be built for both 32-bit and 64-bit since it requires
@@ -27,7 +30,7 @@
     compile_multilib: "both",
 
     shared_libs: [
-        "libbase"
+        "libbase",
     ],
     target: {
         android: {
@@ -37,7 +40,7 @@
     },
     header_libs: [
         "libopenjdkjvmti_headers",
-        "libart_runtime_headers"    // for dex_instruction_list.h only
+        "libart_runtime_headers", // for dex_instruction_list.h only
         // "libbase_headers",
     ],
     multilib: {
diff --git a/tools/wrapagentproperties/Android.bp b/tools/wrapagentproperties/Android.bp
index c39b81a..8dec847 100644
--- a/tools/wrapagentproperties/Android.bp
+++ b/tools/wrapagentproperties/Android.bp
@@ -27,7 +27,7 @@
     compile_multilib: "both",
 
     shared_libs: [
-        "libbase"
+        "libbase",
     ],
     target: {
         android: {
@@ -62,5 +62,5 @@
         "art_debug_defaults",
         "wrapagentproperties-defaults",
     ],
-    shared_libs: [ ],
+    shared_libs: [],
 }