| Antoine Pitrou | 1584ae3 | 2012-04-09 17:03:32 +0200 | [diff] [blame] | 1 | |
| 2 | # Various microbenchmarks comparing unicode and byte string performance |
| 3 | # Please keep this file both 2.x and 3.x compatible! |
| 4 | |
| 5 | import timeit |
| 6 | import itertools |
| 7 | import operator |
| 8 | import re |
| 9 | import sys |
| 10 | import datetime |
| 11 | import optparse |
| 12 | |
| 13 | VERSION = '2.0' |
| 14 | |
| 15 | def p(*args): |
| 16 | sys.stdout.write(' '.join(str(s) for s in args) + '\n') |
| 17 | |
| 18 | if sys.version_info >= (3,): |
| 19 | BYTES = bytes_from_str = lambda x: x.encode('ascii') |
| 20 | UNICODE = unicode_from_str = lambda x: x |
| 21 | else: |
| 22 | BYTES = bytes_from_str = lambda x: x |
| 23 | UNICODE = unicode_from_str = lambda x: x.decode('ascii') |
| 24 | |
| 25 | class UnsupportedType(TypeError): |
| 26 | pass |
| 27 | |
| 28 | |
| 29 | p('stringbench v%s' % VERSION) |
| 30 | p(sys.version) |
| 31 | p(datetime.datetime.now()) |
| 32 | |
| 33 | REPEAT = 1 |
| 34 | REPEAT = 3 |
| 35 | #REPEAT = 7 |
| 36 | |
| 37 | if __name__ != "__main__": |
| 38 | raise SystemExit("Must run as main program") |
| 39 | |
| 40 | parser = optparse.OptionParser() |
| 41 | parser.add_option("-R", "--skip-re", dest="skip_re", |
| 42 | action="store_true", |
| 43 | help="skip regular expression tests") |
| 44 | parser.add_option("-8", "--8-bit", dest="bytes_only", |
| 45 | action="store_true", |
| 46 | help="only do 8-bit string benchmarks") |
| 47 | parser.add_option("-u", "--unicode", dest="unicode_only", |
| 48 | action="store_true", |
| 49 | help="only do Unicode string benchmarks") |
| 50 | |
| 51 | |
| 52 | _RANGE_1000 = list(range(1000)) |
| 53 | _RANGE_100 = list(range(100)) |
| 54 | _RANGE_10 = list(range(10)) |
| 55 | |
| 56 | dups = {} |
| 57 | def bench(s, group, repeat_count): |
| 58 | def blah(f): |
| 59 | if f.__name__ in dups: |
| 60 | raise AssertionError("Multiple functions with same name: %r" % |
| 61 | (f.__name__,)) |
| 62 | dups[f.__name__] = 1 |
| 63 | f.comment = s |
| 64 | f.is_bench = True |
| 65 | f.group = group |
| 66 | f.repeat_count = repeat_count |
| 67 | return f |
| 68 | return blah |
| 69 | |
| 70 | def uses_re(f): |
| 71 | f.uses_re = True |
| 72 | |
| 73 | ####### 'in' comparisons |
| 74 | |
| 75 | @bench('"A" in "A"*1000', "early match, single character", 1000) |
| 76 | def in_test_quick_match_single_character(STR): |
| 77 | s1 = STR("A" * 1000) |
| 78 | s2 = STR("A") |
| 79 | for x in _RANGE_1000: |
| 80 | s2 in s1 |
| 81 | |
| 82 | @bench('"B" in "A"*1000', "no match, single character", 1000) |
| 83 | def in_test_no_match_single_character(STR): |
| 84 | s1 = STR("A" * 1000) |
| 85 | s2 = STR("B") |
| 86 | for x in _RANGE_1000: |
| 87 | s2 in s1 |
| 88 | |
| 89 | |
| 90 | @bench('"AB" in "AB"*1000', "early match, two characters", 1000) |
| 91 | def in_test_quick_match_two_characters(STR): |
| 92 | s1 = STR("AB" * 1000) |
| 93 | s2 = STR("AB") |
| 94 | for x in _RANGE_1000: |
| 95 | s2 in s1 |
| 96 | |
| 97 | @bench('"BC" in "AB"*1000', "no match, two characters", 1000) |
| 98 | def in_test_no_match_two_character(STR): |
| 99 | s1 = STR("AB" * 1000) |
| 100 | s2 = STR("BC") |
| 101 | for x in _RANGE_1000: |
| 102 | s2 in s1 |
| 103 | |
| 104 | @bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000) |
| 105 | def in_test_slow_match_two_characters(STR): |
| 106 | s1 = STR("AB" * 300+"C") |
| 107 | s2 = STR("BC") |
| 108 | for x in _RANGE_1000: |
| 109 | s2 in s1 |
| 110 | |
| 111 | @bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")', |
| 112 | "late match, 100 characters", 100) |
| 113 | def in_test_slow_match_100_characters(STR): |
| 114 | m = STR("ABC"*33) |
| 115 | d = STR("D") |
| 116 | e = STR("E") |
| 117 | s1 = (m+d)*300 + m+e |
| 118 | s2 = m+e |
| 119 | for x in _RANGE_100: |
| 120 | s2 in s1 |
| 121 | |
| 122 | # Try with regex |
| 123 | @uses_re |
| 124 | @bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")', |
| 125 | "late match, 100 characters", 100) |
| 126 | def re_test_slow_match_100_characters(STR): |
| 127 | m = STR("ABC"*33) |
| 128 | d = STR("D") |
| 129 | e = STR("E") |
| 130 | s1 = (m+d)*300 + m+e |
| 131 | s2 = m+e |
| 132 | pat = re.compile(s2) |
| 133 | search = pat.search |
| 134 | for x in _RANGE_100: |
| 135 | search(s1) |
| 136 | |
| 137 | |
| 138 | #### same tests as 'in' but use 'find' |
| 139 | |
| 140 | @bench('("A"*1000).find("A")', "early match, single character", 1000) |
| 141 | def find_test_quick_match_single_character(STR): |
| 142 | s1 = STR("A" * 1000) |
| 143 | s2 = STR("A") |
| 144 | s1_find = s1.find |
| 145 | for x in _RANGE_1000: |
| 146 | s1_find(s2) |
| 147 | |
| 148 | @bench('("A"*1000).find("B")', "no match, single character", 1000) |
| 149 | def find_test_no_match_single_character(STR): |
| 150 | s1 = STR("A" * 1000) |
| 151 | s2 = STR("B") |
| 152 | s1_find = s1.find |
| 153 | for x in _RANGE_1000: |
| 154 | s1_find(s2) |
| 155 | |
| 156 | |
| 157 | @bench('("AB"*1000).find("AB")', "early match, two characters", 1000) |
| 158 | def find_test_quick_match_two_characters(STR): |
| 159 | s1 = STR("AB" * 1000) |
| 160 | s2 = STR("AB") |
| 161 | s1_find = s1.find |
| 162 | for x in _RANGE_1000: |
| 163 | s1_find(s2) |
| 164 | |
| 165 | @bench('("AB"*1000).find("BC")', "no match, two characters", 1000) |
| 166 | def find_test_no_match_two_character(STR): |
| 167 | s1 = STR("AB" * 1000) |
| 168 | s2 = STR("BC") |
| 169 | s1_find = s1.find |
| 170 | for x in _RANGE_1000: |
| 171 | s1_find(s2) |
| 172 | |
| 173 | @bench('("AB"*1000).find("CA")', "no match, two characters", 1000) |
| 174 | def find_test_no_match_two_character_bis(STR): |
| 175 | s1 = STR("AB" * 1000) |
| 176 | s2 = STR("CA") |
| 177 | s1_find = s1.find |
| 178 | for x in _RANGE_1000: |
| 179 | s1_find(s2) |
| 180 | |
| 181 | @bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000) |
| 182 | def find_test_slow_match_two_characters(STR): |
| 183 | s1 = STR("AB" * 300+"C") |
| 184 | s2 = STR("BC") |
| 185 | s1_find = s1.find |
| 186 | for x in _RANGE_1000: |
| 187 | s1_find(s2) |
| 188 | |
| 189 | @bench('("AB"*300+"CA").find("CA")', "late match, two characters", 1000) |
| 190 | def find_test_slow_match_two_characters_bis(STR): |
| 191 | s1 = STR("AB" * 300+"CA") |
| 192 | s2 = STR("CA") |
| 193 | s1_find = s1.find |
| 194 | for x in _RANGE_1000: |
| 195 | s1_find(s2) |
| 196 | |
| 197 | @bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s+"E")', |
| 198 | "late match, 100 characters", 100) |
| 199 | def find_test_slow_match_100_characters(STR): |
| 200 | m = STR("ABC"*33) |
| 201 | d = STR("D") |
| 202 | e = STR("E") |
| 203 | s1 = (m+d)*500 + m+e |
| 204 | s2 = m+e |
| 205 | s1_find = s1.find |
| 206 | for x in _RANGE_100: |
| 207 | s1_find(s2) |
| 208 | |
| 209 | @bench('s="ABC"*33; ((s+"D")*500+"E"+s).find("E"+s)', |
| 210 | "late match, 100 characters", 100) |
| 211 | def find_test_slow_match_100_characters_bis(STR): |
| 212 | m = STR("ABC"*33) |
| 213 | d = STR("D") |
| 214 | e = STR("E") |
| 215 | s1 = (m+d)*500 + e+m |
| 216 | s2 = e+m |
| 217 | s1_find = s1.find |
| 218 | for x in _RANGE_100: |
| 219 | s1_find(s2) |
| 220 | |
| 221 | |
| 222 | #### Same tests for 'rfind' |
| 223 | |
| 224 | @bench('("A"*1000).rfind("A")', "early match, single character", 1000) |
| 225 | def rfind_test_quick_match_single_character(STR): |
| 226 | s1 = STR("A" * 1000) |
| 227 | s2 = STR("A") |
| 228 | s1_rfind = s1.rfind |
| 229 | for x in _RANGE_1000: |
| 230 | s1_rfind(s2) |
| 231 | |
| 232 | @bench('("A"*1000).rfind("B")', "no match, single character", 1000) |
| 233 | def rfind_test_no_match_single_character(STR): |
| 234 | s1 = STR("A" * 1000) |
| 235 | s2 = STR("B") |
| 236 | s1_rfind = s1.rfind |
| 237 | for x in _RANGE_1000: |
| 238 | s1_rfind(s2) |
| 239 | |
| 240 | |
| 241 | @bench('("AB"*1000).rfind("AB")', "early match, two characters", 1000) |
| 242 | def rfind_test_quick_match_two_characters(STR): |
| 243 | s1 = STR("AB" * 1000) |
| 244 | s2 = STR("AB") |
| 245 | s1_rfind = s1.rfind |
| 246 | for x in _RANGE_1000: |
| 247 | s1_rfind(s2) |
| 248 | |
| 249 | @bench('("AB"*1000).rfind("BC")', "no match, two characters", 1000) |
| 250 | def rfind_test_no_match_two_character(STR): |
| 251 | s1 = STR("AB" * 1000) |
| 252 | s2 = STR("BC") |
| 253 | s1_rfind = s1.rfind |
| 254 | for x in _RANGE_1000: |
| 255 | s1_rfind(s2) |
| 256 | |
| 257 | @bench('("AB"*1000).rfind("CA")', "no match, two characters", 1000) |
| 258 | def rfind_test_no_match_two_character_bis(STR): |
| 259 | s1 = STR("AB" * 1000) |
| 260 | s2 = STR("CA") |
| 261 | s1_rfind = s1.rfind |
| 262 | for x in _RANGE_1000: |
| 263 | s1_rfind(s2) |
| 264 | |
| 265 | @bench('("C"+"AB"*300).rfind("CA")', "late match, two characters", 1000) |
| 266 | def rfind_test_slow_match_two_characters(STR): |
| 267 | s1 = STR("C" + "AB" * 300) |
| 268 | s2 = STR("CA") |
| 269 | s1_rfind = s1.rfind |
| 270 | for x in _RANGE_1000: |
| 271 | s1_rfind(s2) |
| 272 | |
| 273 | @bench('("BC"+"AB"*300).rfind("BC")', "late match, two characters", 1000) |
| 274 | def rfind_test_slow_match_two_characters_bis(STR): |
| 275 | s1 = STR("BC" + "AB" * 300) |
| 276 | s2 = STR("BC") |
| 277 | s1_rfind = s1.rfind |
| 278 | for x in _RANGE_1000: |
| 279 | s1_rfind(s2) |
| 280 | |
| 281 | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rfind("E"+s)', |
| 282 | "late match, 100 characters", 100) |
| 283 | def rfind_test_slow_match_100_characters(STR): |
| 284 | m = STR("ABC"*33) |
| 285 | d = STR("D") |
| 286 | e = STR("E") |
| 287 | s1 = e+m + (d+m)*500 |
| 288 | s2 = e+m |
| 289 | s1_rfind = s1.rfind |
| 290 | for x in _RANGE_100: |
| 291 | s1_rfind(s2) |
| 292 | |
| 293 | @bench('s="ABC"*33; (s+"E"+("D"+s)*500).rfind(s+"E")', |
| 294 | "late match, 100 characters", 100) |
| 295 | def rfind_test_slow_match_100_characters_bis(STR): |
| 296 | m = STR("ABC"*33) |
| 297 | d = STR("D") |
| 298 | e = STR("E") |
| 299 | s1 = m+e + (d+m)*500 |
| 300 | s2 = m+e |
| 301 | s1_rfind = s1.rfind |
| 302 | for x in _RANGE_100: |
| 303 | s1_rfind(s2) |
| 304 | |
| 305 | |
| 306 | #### Now with index. |
| 307 | # Skip the ones which fail because that would include exception overhead. |
| 308 | |
| 309 | @bench('("A"*1000).index("A")', "early match, single character", 1000) |
| 310 | def index_test_quick_match_single_character(STR): |
| 311 | s1 = STR("A" * 1000) |
| 312 | s2 = STR("A") |
| 313 | s1_index = s1.index |
| 314 | for x in _RANGE_1000: |
| 315 | s1_index(s2) |
| 316 | |
| 317 | @bench('("AB"*1000).index("AB")', "early match, two characters", 1000) |
| 318 | def index_test_quick_match_two_characters(STR): |
| 319 | s1 = STR("AB" * 1000) |
| 320 | s2 = STR("AB") |
| 321 | s1_index = s1.index |
| 322 | for x in _RANGE_1000: |
| 323 | s1_index(s2) |
| 324 | |
| 325 | @bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000) |
| 326 | def index_test_slow_match_two_characters(STR): |
| 327 | s1 = STR("AB" * 300+"C") |
| 328 | s2 = STR("BC") |
| 329 | s1_index = s1.index |
| 330 | for x in _RANGE_1000: |
| 331 | s1_index(s2) |
| 332 | |
| 333 | @bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s+"E")', |
| 334 | "late match, 100 characters", 100) |
| 335 | def index_test_slow_match_100_characters(STR): |
| 336 | m = STR("ABC"*33) |
| 337 | d = STR("D") |
| 338 | e = STR("E") |
| 339 | s1 = (m+d)*500 + m+e |
| 340 | s2 = m+e |
| 341 | s1_index = s1.index |
| 342 | for x in _RANGE_100: |
| 343 | s1_index(s2) |
| 344 | |
| 345 | |
| 346 | #### Same for rindex |
| 347 | |
| 348 | @bench('("A"*1000).rindex("A")', "early match, single character", 1000) |
| 349 | def rindex_test_quick_match_single_character(STR): |
| 350 | s1 = STR("A" * 1000) |
| 351 | s2 = STR("A") |
| 352 | s1_rindex = s1.rindex |
| 353 | for x in _RANGE_1000: |
| 354 | s1_rindex(s2) |
| 355 | |
| 356 | @bench('("AB"*1000).rindex("AB")', "early match, two characters", 1000) |
| 357 | def rindex_test_quick_match_two_characters(STR): |
| 358 | s1 = STR("AB" * 1000) |
| 359 | s2 = STR("AB") |
| 360 | s1_rindex = s1.rindex |
| 361 | for x in _RANGE_1000: |
| 362 | s1_rindex(s2) |
| 363 | |
| 364 | @bench('("C"+"AB"*300).rindex("CA")', "late match, two characters", 1000) |
| 365 | def rindex_test_slow_match_two_characters(STR): |
| 366 | s1 = STR("C" + "AB" * 300) |
| 367 | s2 = STR("CA") |
| 368 | s1_rindex = s1.rindex |
| 369 | for x in _RANGE_1000: |
| 370 | s1_rindex(s2) |
| 371 | |
| 372 | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rindex("E"+s)', |
| 373 | "late match, 100 characters", 100) |
| 374 | def rindex_test_slow_match_100_characters(STR): |
| 375 | m = STR("ABC"*33) |
| 376 | d = STR("D") |
| 377 | e = STR("E") |
| 378 | s1 = e + m + (d+m)*500 |
| 379 | s2 = e + m |
| 380 | s1_rindex = s1.rindex |
| 381 | for x in _RANGE_100: |
| 382 | s1_rindex(s2) |
| 383 | |
| 384 | |
| 385 | #### Same for partition |
| 386 | |
| 387 | @bench('("A"*1000).partition("A")', "early match, single character", 1000) |
| 388 | def partition_test_quick_match_single_character(STR): |
| 389 | s1 = STR("A" * 1000) |
| 390 | s2 = STR("A") |
| 391 | s1_partition = s1.partition |
| 392 | for x in _RANGE_1000: |
| 393 | s1_partition(s2) |
| 394 | |
| 395 | @bench('("A"*1000).partition("B")', "no match, single character", 1000) |
| 396 | def partition_test_no_match_single_character(STR): |
| 397 | s1 = STR("A" * 1000) |
| 398 | s2 = STR("B") |
| 399 | s1_partition = s1.partition |
| 400 | for x in _RANGE_1000: |
| 401 | s1_partition(s2) |
| 402 | |
| 403 | |
| 404 | @bench('("AB"*1000).partition("AB")', "early match, two characters", 1000) |
| 405 | def partition_test_quick_match_two_characters(STR): |
| 406 | s1 = STR("AB" * 1000) |
| 407 | s2 = STR("AB") |
| 408 | s1_partition = s1.partition |
| 409 | for x in _RANGE_1000: |
| 410 | s1_partition(s2) |
| 411 | |
| 412 | @bench('("AB"*1000).partition("BC")', "no match, two characters", 1000) |
| 413 | def partition_test_no_match_two_character(STR): |
| 414 | s1 = STR("AB" * 1000) |
| 415 | s2 = STR("BC") |
| 416 | s1_partition = s1.partition |
| 417 | for x in _RANGE_1000: |
| 418 | s1_partition(s2) |
| 419 | |
| 420 | @bench('("AB"*300+"C").partition("BC")', "late match, two characters", 1000) |
| 421 | def partition_test_slow_match_two_characters(STR): |
| 422 | s1 = STR("AB" * 300+"C") |
| 423 | s2 = STR("BC") |
| 424 | s1_partition = s1.partition |
| 425 | for x in _RANGE_1000: |
| 426 | s1_partition(s2) |
| 427 | |
| 428 | @bench('s="ABC"*33; ((s+"D")*500+s+"E").partition(s+"E")', |
| 429 | "late match, 100 characters", 100) |
| 430 | def partition_test_slow_match_100_characters(STR): |
| 431 | m = STR("ABC"*33) |
| 432 | d = STR("D") |
| 433 | e = STR("E") |
| 434 | s1 = (m+d)*500 + m+e |
| 435 | s2 = m+e |
| 436 | s1_partition = s1.partition |
| 437 | for x in _RANGE_100: |
| 438 | s1_partition(s2) |
| 439 | |
| 440 | |
| 441 | #### Same for rpartition |
| 442 | |
| 443 | @bench('("A"*1000).rpartition("A")', "early match, single character", 1000) |
| 444 | def rpartition_test_quick_match_single_character(STR): |
| 445 | s1 = STR("A" * 1000) |
| 446 | s2 = STR("A") |
| 447 | s1_rpartition = s1.rpartition |
| 448 | for x in _RANGE_1000: |
| 449 | s1_rpartition(s2) |
| 450 | |
| 451 | @bench('("A"*1000).rpartition("B")', "no match, single character", 1000) |
| 452 | def rpartition_test_no_match_single_character(STR): |
| 453 | s1 = STR("A" * 1000) |
| 454 | s2 = STR("B") |
| 455 | s1_rpartition = s1.rpartition |
| 456 | for x in _RANGE_1000: |
| 457 | s1_rpartition(s2) |
| 458 | |
| 459 | |
| 460 | @bench('("AB"*1000).rpartition("AB")', "early match, two characters", 1000) |
| 461 | def rpartition_test_quick_match_two_characters(STR): |
| 462 | s1 = STR("AB" * 1000) |
| 463 | s2 = STR("AB") |
| 464 | s1_rpartition = s1.rpartition |
| 465 | for x in _RANGE_1000: |
| 466 | s1_rpartition(s2) |
| 467 | |
| 468 | @bench('("AB"*1000).rpartition("BC")', "no match, two characters", 1000) |
| 469 | def rpartition_test_no_match_two_character(STR): |
| 470 | s1 = STR("AB" * 1000) |
| 471 | s2 = STR("BC") |
| 472 | s1_rpartition = s1.rpartition |
| 473 | for x in _RANGE_1000: |
| 474 | s1_rpartition(s2) |
| 475 | |
| 476 | @bench('("C"+"AB"*300).rpartition("CA")', "late match, two characters", 1000) |
| 477 | def rpartition_test_slow_match_two_characters(STR): |
| 478 | s1 = STR("C" + "AB" * 300) |
| 479 | s2 = STR("CA") |
| 480 | s1_rpartition = s1.rpartition |
| 481 | for x in _RANGE_1000: |
| 482 | s1_rpartition(s2) |
| 483 | |
| 484 | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rpartition("E"+s)', |
| 485 | "late match, 100 characters", 100) |
| 486 | def rpartition_test_slow_match_100_characters(STR): |
| 487 | m = STR("ABC"*33) |
| 488 | d = STR("D") |
| 489 | e = STR("E") |
| 490 | s1 = e + m + (d+m)*500 |
| 491 | s2 = e + m |
| 492 | s1_rpartition = s1.rpartition |
| 493 | for x in _RANGE_100: |
| 494 | s1_rpartition(s2) |
| 495 | |
| 496 | |
| 497 | #### Same for split(s, 1) |
| 498 | |
| 499 | @bench('("A"*1000).split("A", 1)', "early match, single character", 1000) |
| 500 | def split_test_quick_match_single_character(STR): |
| 501 | s1 = STR("A" * 1000) |
| 502 | s2 = STR("A") |
| 503 | s1_split = s1.split |
| 504 | for x in _RANGE_1000: |
| 505 | s1_split(s2, 1) |
| 506 | |
| 507 | @bench('("A"*1000).split("B", 1)', "no match, single character", 1000) |
| 508 | def split_test_no_match_single_character(STR): |
| 509 | s1 = STR("A" * 1000) |
| 510 | s2 = STR("B") |
| 511 | s1_split = s1.split |
| 512 | for x in _RANGE_1000: |
| 513 | s1_split(s2, 1) |
| 514 | |
| 515 | |
| 516 | @bench('("AB"*1000).split("AB", 1)', "early match, two characters", 1000) |
| 517 | def split_test_quick_match_two_characters(STR): |
| 518 | s1 = STR("AB" * 1000) |
| 519 | s2 = STR("AB") |
| 520 | s1_split = s1.split |
| 521 | for x in _RANGE_1000: |
| 522 | s1_split(s2, 1) |
| 523 | |
| 524 | @bench('("AB"*1000).split("BC", 1)', "no match, two characters", 1000) |
| 525 | def split_test_no_match_two_character(STR): |
| 526 | s1 = STR("AB" * 1000) |
| 527 | s2 = STR("BC") |
| 528 | s1_split = s1.split |
| 529 | for x in _RANGE_1000: |
| 530 | s1_split(s2, 1) |
| 531 | |
| 532 | @bench('("AB"*300+"C").split("BC", 1)', "late match, two characters", 1000) |
| 533 | def split_test_slow_match_two_characters(STR): |
| 534 | s1 = STR("AB" * 300+"C") |
| 535 | s2 = STR("BC") |
| 536 | s1_split = s1.split |
| 537 | for x in _RANGE_1000: |
| 538 | s1_split(s2, 1) |
| 539 | |
| 540 | @bench('s="ABC"*33; ((s+"D")*500+s+"E").split(s+"E", 1)', |
| 541 | "late match, 100 characters", 100) |
| 542 | def split_test_slow_match_100_characters(STR): |
| 543 | m = STR("ABC"*33) |
| 544 | d = STR("D") |
| 545 | e = STR("E") |
| 546 | s1 = (m+d)*500 + m+e |
| 547 | s2 = m+e |
| 548 | s1_split = s1.split |
| 549 | for x in _RANGE_100: |
| 550 | s1_split(s2, 1) |
| 551 | |
| 552 | |
| 553 | #### Same for rsplit(s, 1) |
| 554 | |
| 555 | @bench('("A"*1000).rsplit("A", 1)', "early match, single character", 1000) |
| 556 | def rsplit_test_quick_match_single_character(STR): |
| 557 | s1 = STR("A" * 1000) |
| 558 | s2 = STR("A") |
| 559 | s1_rsplit = s1.rsplit |
| 560 | for x in _RANGE_1000: |
| 561 | s1_rsplit(s2, 1) |
| 562 | |
| 563 | @bench('("A"*1000).rsplit("B", 1)', "no match, single character", 1000) |
| 564 | def rsplit_test_no_match_single_character(STR): |
| 565 | s1 = STR("A" * 1000) |
| 566 | s2 = STR("B") |
| 567 | s1_rsplit = s1.rsplit |
| 568 | for x in _RANGE_1000: |
| 569 | s1_rsplit(s2, 1) |
| 570 | |
| 571 | |
| 572 | @bench('("AB"*1000).rsplit("AB", 1)', "early match, two characters", 1000) |
| 573 | def rsplit_test_quick_match_two_characters(STR): |
| 574 | s1 = STR("AB" * 1000) |
| 575 | s2 = STR("AB") |
| 576 | s1_rsplit = s1.rsplit |
| 577 | for x in _RANGE_1000: |
| 578 | s1_rsplit(s2, 1) |
| 579 | |
| 580 | @bench('("AB"*1000).rsplit("BC", 1)', "no match, two characters", 1000) |
| 581 | def rsplit_test_no_match_two_character(STR): |
| 582 | s1 = STR("AB" * 1000) |
| 583 | s2 = STR("BC") |
| 584 | s1_rsplit = s1.rsplit |
| 585 | for x in _RANGE_1000: |
| 586 | s1_rsplit(s2, 1) |
| 587 | |
| 588 | @bench('("C"+"AB"*300).rsplit("CA", 1)', "late match, two characters", 1000) |
| 589 | def rsplit_test_slow_match_two_characters(STR): |
| 590 | s1 = STR("C" + "AB" * 300) |
| 591 | s2 = STR("CA") |
| 592 | s1_rsplit = s1.rsplit |
| 593 | for x in _RANGE_1000: |
| 594 | s1_rsplit(s2, 1) |
| 595 | |
| 596 | @bench('s="ABC"*33; ("E"+s+("D"+s)*500).rsplit("E"+s, 1)', |
| 597 | "late match, 100 characters", 100) |
| 598 | def rsplit_test_slow_match_100_characters(STR): |
| 599 | m = STR("ABC"*33) |
| 600 | d = STR("D") |
| 601 | e = STR("E") |
| 602 | s1 = e + m + (d+m)*500 |
| 603 | s2 = e + m |
| 604 | s1_rsplit = s1.rsplit |
| 605 | for x in _RANGE_100: |
| 606 | s1_rsplit(s2, 1) |
| 607 | |
| 608 | |
| 609 | #### Benchmark the operator-based methods |
| 610 | |
| 611 | @bench('"A"*10', "repeat 1 character 10 times", 1000) |
| 612 | def repeat_single_10_times(STR): |
| 613 | s = STR("A") |
| 614 | for x in _RANGE_1000: |
| 615 | s * 10 |
| 616 | |
| 617 | @bench('"A"*1000', "repeat 1 character 1000 times", 1000) |
| 618 | def repeat_single_1000_times(STR): |
| 619 | s = STR("A") |
| 620 | for x in _RANGE_1000: |
| 621 | s * 1000 |
| 622 | |
| 623 | @bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000) |
| 624 | def repeat_5_10_times(STR): |
| 625 | s = STR("ABCDE") |
| 626 | for x in _RANGE_1000: |
| 627 | s * 10 |
| 628 | |
| 629 | @bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000) |
| 630 | def repeat_5_1000_times(STR): |
| 631 | s = STR("ABCDE") |
| 632 | for x in _RANGE_1000: |
| 633 | s * 1000 |
| 634 | |
| 635 | # + for concat |
| 636 | |
| 637 | @bench('"Andrew"+"Dalke"', "concat two strings", 1000) |
| 638 | def concat_two_strings(STR): |
| 639 | s1 = STR("Andrew") |
| 640 | s2 = STR("Dalke") |
| 641 | for x in _RANGE_1000: |
| 642 | s1+s2 |
| 643 | |
| 644 | @bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15", |
| 645 | 1000) |
| 646 | def concat_many_strings(STR): |
| 647 | s1=STR('TIXSGYNREDCVBHJ') |
| 648 | s2=STR('PUMTLXBZVDO') |
| 649 | s3=STR('FVZNJ') |
| 650 | s4=STR('OGDXUW') |
| 651 | s5=STR('WEIMRNCOYVGHKB') |
| 652 | s6=STR('FCQTNMXPUZH') |
| 653 | s7=STR('TICZJYRLBNVUEAK') |
| 654 | s8=STR('REYB') |
| 655 | s9=STR('PWUOQ') |
| 656 | s10=STR('EQHCMKBS') |
| 657 | s11=STR('AEVDFOH') |
| 658 | s12=STR('IFHVD') |
| 659 | s13=STR('JGTCNLXWOHQ') |
| 660 | s14=STR('ITSKEPYLROZAWXF') |
| 661 | s15=STR('THEK') |
| 662 | s16=STR('GHPZFBUYCKMNJIT') |
| 663 | s17=STR('JMUZ') |
| 664 | s18=STR('WLZQMTB') |
| 665 | s19=STR('KPADCBW') |
| 666 | s20=STR('TNJHZQAGBU') |
| 667 | for x in _RANGE_1000: |
| 668 | (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+ |
| 669 | s11+s12+s13+s14+s15+s16+s17+s18+s19+s20) |
| 670 | |
| 671 | |
| 672 | #### Benchmark join |
| 673 | |
| 674 | def get_bytes_yielding_seq(STR, arg): |
| 675 | if STR is BYTES and sys.version_info >= (3,): |
| 676 | raise UnsupportedType |
| 677 | return STR(arg) |
| 678 | |
| 679 | @bench('"A".join("")', |
| 680 | "join empty string, with 1 character sep", 100) |
| 681 | def join_empty_single(STR): |
| 682 | sep = STR("A") |
| 683 | s2 = get_bytes_yielding_seq(STR, "") |
| 684 | sep_join = sep.join |
| 685 | for x in _RANGE_100: |
| 686 | sep_join(s2) |
| 687 | |
| 688 | @bench('"ABCDE".join("")', |
| 689 | "join empty string, with 5 character sep", 100) |
| 690 | def join_empty_5(STR): |
| 691 | sep = STR("ABCDE") |
| 692 | s2 = get_bytes_yielding_seq(STR, "") |
| 693 | sep_join = sep.join |
| 694 | for x in _RANGE_100: |
| 695 | sep_join(s2) |
| 696 | |
| 697 | @bench('"A".join("ABC..Z")', |
| 698 | "join string with 26 characters, with 1 character sep", 1000) |
| 699 | def join_alphabet_single(STR): |
| 700 | sep = STR("A") |
| 701 | s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") |
| 702 | sep_join = sep.join |
| 703 | for x in _RANGE_1000: |
| 704 | sep_join(s2) |
| 705 | |
| 706 | @bench('"ABCDE".join("ABC..Z")', |
| 707 | "join string with 26 characters, with 5 character sep", 1000) |
| 708 | def join_alphabet_5(STR): |
| 709 | sep = STR("ABCDE") |
| 710 | s2 = get_bytes_yielding_seq(STR, "ABCDEFGHIJKLMnOPQRSTUVWXYZ") |
| 711 | sep_join = sep.join |
| 712 | for x in _RANGE_1000: |
| 713 | sep_join(s2) |
| 714 | |
| 715 | @bench('"A".join(list("ABC..Z"))', |
| 716 | "join list of 26 characters, with 1 character sep", 1000) |
| 717 | def join_alphabet_list_single(STR): |
| 718 | sep = STR("A") |
| 719 | s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] |
| 720 | sep_join = sep.join |
| 721 | for x in _RANGE_1000: |
| 722 | sep_join(s2) |
| 723 | |
| 724 | @bench('"ABCDE".join(list("ABC..Z"))', |
| 725 | "join list of 26 characters, with 5 character sep", 1000) |
| 726 | def join_alphabet_list_five(STR): |
| 727 | sep = STR("ABCDE") |
| 728 | s2 = [STR(x) for x in "ABCDEFGHIJKLMnOPQRSTUVWXYZ"] |
| 729 | sep_join = sep.join |
| 730 | for x in _RANGE_1000: |
| 731 | sep_join(s2) |
| 732 | |
| 733 | @bench('"A".join(["Bob"]*100))', |
| 734 | "join list of 100 words, with 1 character sep", 1000) |
| 735 | def join_100_words_single(STR): |
| 736 | sep = STR("A") |
| 737 | s2 = [STR("Bob")]*100 |
| 738 | sep_join = sep.join |
| 739 | for x in _RANGE_1000: |
| 740 | sep_join(s2) |
| 741 | |
| 742 | @bench('"ABCDE".join(["Bob"]*100))', |
| 743 | "join list of 100 words, with 5 character sep", 1000) |
| 744 | def join_100_words_5(STR): |
| 745 | sep = STR("ABCDE") |
| 746 | s2 = [STR("Bob")]*100 |
| 747 | sep_join = sep.join |
| 748 | for x in _RANGE_1000: |
| 749 | sep_join(s2) |
| 750 | |
| 751 | #### split tests |
| 752 | |
| 753 | @bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000) |
| 754 | def whitespace_split(STR): |
| 755 | s = STR("Here are some words. "*2) |
| 756 | s_split = s.split |
| 757 | for x in _RANGE_1000: |
| 758 | s_split() |
| 759 | |
| 760 | @bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000) |
| 761 | def whitespace_rsplit(STR): |
| 762 | s = STR("Here are some words. "*2) |
| 763 | s_rsplit = s.rsplit |
| 764 | for x in _RANGE_1000: |
| 765 | s_rsplit() |
| 766 | |
| 767 | @bench('("Here are some words. "*2).split(None, 1)', |
| 768 | "split 1 whitespace", 1000) |
| 769 | def whitespace_split_1(STR): |
| 770 | s = STR("Here are some words. "*2) |
| 771 | s_split = s.split |
| 772 | N = None |
| 773 | for x in _RANGE_1000: |
| 774 | s_split(N, 1) |
| 775 | |
| 776 | @bench('("Here are some words. "*2).rsplit(None, 1)', |
| 777 | "split 1 whitespace", 1000) |
| 778 | def whitespace_rsplit_1(STR): |
| 779 | s = STR("Here are some words. "*2) |
| 780 | s_rsplit = s.rsplit |
| 781 | N = None |
| 782 | for x in _RANGE_1000: |
| 783 | s_rsplit(N, 1) |
| 784 | |
| 785 | @bench('("Here are some words. "*2).partition(" ")', |
| 786 | "split 1 whitespace", 1000) |
| 787 | def whitespace_partition(STR): |
| 788 | sep = STR(" ") |
| 789 | s = STR("Here are some words. "*2) |
| 790 | s_partition = s.partition |
| 791 | for x in _RANGE_1000: |
| 792 | s_partition(sep) |
| 793 | |
| 794 | @bench('("Here are some words. "*2).rpartition(" ")', |
| 795 | "split 1 whitespace", 1000) |
| 796 | def whitespace_rpartition(STR): |
| 797 | sep = STR(" ") |
| 798 | s = STR("Here are some words. "*2) |
| 799 | s_rpartition = s.rpartition |
| 800 | for x in _RANGE_1000: |
| 801 | s_rpartition(sep) |
| 802 | |
| 803 | human_text = """\ |
| 804 | Python is a dynamic object-oriented programming language that can be |
| 805 | used for many kinds of software development. It offers strong support |
| 806 | for integration with other languages and tools, comes with extensive |
| 807 | standard libraries, and can be learned in a few days. Many Python |
| 808 | programmers report substantial productivity gains and feel the language |
| 809 | encourages the development of higher quality, more maintainable code. |
| 810 | |
| 811 | Python runs on Windows, Linux/Unix, Mac OS X, OS/2, Amiga, Palm |
| 812 | Handhelds, and Nokia mobile phones. Python has also been ported to the |
| 813 | Java and .NET virtual machines. |
| 814 | |
| 815 | Python is distributed under an OSI-approved open source license that |
| 816 | makes it free to use, even for commercial products. |
| 817 | """*25 |
| 818 | human_text_bytes = bytes_from_str(human_text) |
| 819 | human_text_unicode = unicode_from_str(human_text) |
| 820 | def _get_human_text(STR): |
| 821 | if STR is UNICODE: |
| 822 | return human_text_unicode |
| 823 | if STR is BYTES: |
| 824 | return human_text_bytes |
| 825 | raise AssertionError |
| 826 | |
| 827 | @bench('human_text.split()', "split whitespace (huge)", 10) |
| 828 | def whitespace_split_huge(STR): |
| 829 | s = _get_human_text(STR) |
| 830 | s_split = s.split |
| 831 | for x in _RANGE_10: |
| 832 | s_split() |
| 833 | |
| 834 | @bench('human_text.rsplit()', "split whitespace (huge)", 10) |
| 835 | def whitespace_rsplit_huge(STR): |
| 836 | s = _get_human_text(STR) |
| 837 | s_rsplit = s.rsplit |
| 838 | for x in _RANGE_10: |
| 839 | s_rsplit() |
| 840 | |
| 841 | |
| 842 | |
| 843 | @bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000) |
| 844 | def newlines_split(STR): |
| 845 | s = STR("this\nis\na\ntest\n") |
| 846 | s_split = s.split |
| 847 | nl = STR("\n") |
| 848 | for x in _RANGE_1000: |
| 849 | s_split(nl) |
| 850 | |
| 851 | |
| 852 | @bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000) |
| 853 | def newlines_rsplit(STR): |
| 854 | s = STR("this\nis\na\ntest\n") |
| 855 | s_rsplit = s.rsplit |
| 856 | nl = STR("\n") |
| 857 | for x in _RANGE_1000: |
| 858 | s_rsplit(nl) |
| 859 | |
| 860 | @bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000) |
| 861 | def newlines_splitlines(STR): |
| 862 | s = STR("this\nis\na\ntest\n") |
| 863 | s_splitlines = s.splitlines |
| 864 | for x in _RANGE_1000: |
| 865 | s_splitlines() |
| 866 | |
| 867 | ## split text with 2000 newlines |
| 868 | |
| 869 | def _make_2000_lines(): |
| 870 | import random |
| 871 | r = random.Random(100) |
| 872 | chars = list(map(chr, range(32, 128))) |
| 873 | i = 0 |
| 874 | while i < len(chars): |
| 875 | chars[i] = " " |
| 876 | i += r.randrange(9) |
| 877 | s = "".join(chars) |
| 878 | s = s*4 |
| 879 | words = [] |
| 880 | for i in range(2000): |
| 881 | start = r.randrange(96) |
| 882 | n = r.randint(5, 65) |
| 883 | words.append(s[start:start+n]) |
| 884 | return "\n".join(words)+"\n" |
| 885 | |
| 886 | _text_with_2000_lines = _make_2000_lines() |
| 887 | _text_with_2000_lines_bytes = bytes_from_str(_text_with_2000_lines) |
| 888 | _text_with_2000_lines_unicode = unicode_from_str(_text_with_2000_lines) |
| 889 | def _get_2000_lines(STR): |
| 890 | if STR is UNICODE: |
| 891 | return _text_with_2000_lines_unicode |
| 892 | if STR is BYTES: |
| 893 | return _text_with_2000_lines_bytes |
| 894 | raise AssertionError |
| 895 | |
| 896 | |
| 897 | @bench('"...text...".split("\\n")', "split 2000 newlines", 10) |
| 898 | def newlines_split_2000(STR): |
| 899 | s = _get_2000_lines(STR) |
| 900 | s_split = s.split |
| 901 | nl = STR("\n") |
| 902 | for x in _RANGE_10: |
| 903 | s_split(nl) |
| 904 | |
| 905 | @bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10) |
| 906 | def newlines_rsplit_2000(STR): |
| 907 | s = _get_2000_lines(STR) |
| 908 | s_rsplit = s.rsplit |
| 909 | nl = STR("\n") |
| 910 | for x in _RANGE_10: |
| 911 | s_rsplit(nl) |
| 912 | |
| 913 | @bench('"...text...".splitlines()', "split 2000 newlines", 10) |
| 914 | def newlines_splitlines_2000(STR): |
| 915 | s = _get_2000_lines(STR) |
| 916 | s_splitlines = s.splitlines |
| 917 | for x in _RANGE_10: |
| 918 | s_splitlines() |
| 919 | |
| 920 | |
| 921 | ## split text on "--" characters |
| 922 | @bench( |
| 923 | '"this--is--a--test--of--the--emergency--broadcast--system".split("--")', |
| 924 | "split on multicharacter separator (small)", 1000) |
| 925 | def split_multichar_sep_small(STR): |
| 926 | s = STR("this--is--a--test--of--the--emergency--broadcast--system") |
| 927 | s_split = s.split |
| 928 | pat = STR("--") |
| 929 | for x in _RANGE_1000: |
| 930 | s_split(pat) |
| 931 | @bench( |
| 932 | '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")', |
| 933 | "split on multicharacter separator (small)", 1000) |
| 934 | def rsplit_multichar_sep_small(STR): |
| 935 | s = STR("this--is--a--test--of--the--emergency--broadcast--system") |
| 936 | s_rsplit = s.rsplit |
| 937 | pat = STR("--") |
| 938 | for x in _RANGE_1000: |
| 939 | s_rsplit(pat) |
| 940 | |
| 941 | ## split dna text on "ACTAT" characters |
| 942 | @bench('dna.split("ACTAT")', |
| 943 | "split on multicharacter separator (dna)", 10) |
| 944 | def split_multichar_sep_dna(STR): |
| 945 | s = _get_dna(STR) |
| 946 | s_split = s.split |
| 947 | pat = STR("ACTAT") |
| 948 | for x in _RANGE_10: |
| 949 | s_split(pat) |
| 950 | |
| 951 | @bench('dna.rsplit("ACTAT")', |
| 952 | "split on multicharacter separator (dna)", 10) |
| 953 | def rsplit_multichar_sep_dna(STR): |
| 954 | s = _get_dna(STR) |
| 955 | s_rsplit = s.rsplit |
| 956 | pat = STR("ACTAT") |
| 957 | for x in _RANGE_10: |
| 958 | s_rsplit(pat) |
| 959 | |
| 960 | |
| 961 | |
| 962 | ## split with limits |
| 963 | |
| 964 | GFF3_example = "\t".join([ |
| 965 | "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".", |
| 966 | "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"]) |
| 967 | |
| 968 | @bench('GFF3_example.split("\\t")', "tab split", 1000) |
| 969 | def tab_split_no_limit(STR): |
| 970 | sep = STR("\t") |
| 971 | s = STR(GFF3_example) |
| 972 | s_split = s.split |
| 973 | for x in _RANGE_1000: |
| 974 | s_split(sep) |
| 975 | |
| 976 | @bench('GFF3_example.split("\\t", 8)', "tab split", 1000) |
| 977 | def tab_split_limit(STR): |
| 978 | sep = STR("\t") |
| 979 | s = STR(GFF3_example) |
| 980 | s_split = s.split |
| 981 | for x in _RANGE_1000: |
| 982 | s_split(sep, 8) |
| 983 | |
| 984 | @bench('GFF3_example.rsplit("\\t")', "tab split", 1000) |
| 985 | def tab_rsplit_no_limit(STR): |
| 986 | sep = STR("\t") |
| 987 | s = STR(GFF3_example) |
| 988 | s_rsplit = s.rsplit |
| 989 | for x in _RANGE_1000: |
| 990 | s_rsplit(sep) |
| 991 | |
| 992 | @bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000) |
| 993 | def tab_rsplit_limit(STR): |
| 994 | sep = STR("\t") |
| 995 | s = STR(GFF3_example) |
| 996 | s_rsplit = s.rsplit |
| 997 | for x in _RANGE_1000: |
| 998 | s_rsplit(sep, 8) |
| 999 | |
| 1000 | #### Count characters |
| 1001 | |
| 1002 | @bench('...text.with.2000.newlines.count("\\n")', |
| 1003 | "count newlines", 10) |
| 1004 | def count_newlines(STR): |
| 1005 | s = _get_2000_lines(STR) |
| 1006 | s_count = s.count |
| 1007 | nl = STR("\n") |
| 1008 | for x in _RANGE_10: |
| 1009 | s_count(nl) |
| 1010 | |
| 1011 | # Orchid sequences concatenated, from Biopython |
| 1012 | _dna = """ |
| 1013 | CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT |
| 1014 | AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG |
| 1015 | AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT |
| 1016 | TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC |
| 1017 | AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG |
| 1018 | TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT |
| 1019 | CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT |
| 1020 | TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT |
| 1021 | GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC |
| 1022 | TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG |
| 1023 | GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA |
| 1024 | ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC |
| 1025 | CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA |
| 1026 | ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA |
| 1027 | ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA |
| 1028 | TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG |
| 1029 | CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG |
| 1030 | GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA |
| 1031 | ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG |
| 1032 | ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC |
| 1033 | ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA |
| 1034 | GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA |
| 1035 | TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG |
| 1036 | TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT |
| 1037 | TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG |
| 1038 | GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG |
| 1039 | GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT |
| 1040 | AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC |
| 1041 | GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG |
| 1042 | TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT |
| 1043 | CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA |
| 1044 | TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC |
| 1045 | TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC |
| 1046 | AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT |
| 1047 | GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT |
| 1048 | GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA |
| 1049 | CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG |
| 1050 | GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA |
| 1051 | TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG |
| 1052 | ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT |
| 1053 | GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA |
| 1054 | AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC |
| 1055 | AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA |
| 1056 | ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC |
| 1057 | GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC |
| 1058 | GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC |
| 1059 | AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA |
| 1060 | GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG |
| 1061 | ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC |
| 1062 | GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC |
| 1063 | """ |
| 1064 | _dna = "".join(_dna.splitlines()) |
| 1065 | _dna = _dna * 25 |
| 1066 | _dna_bytes = bytes_from_str(_dna) |
| 1067 | _dna_unicode = unicode_from_str(_dna) |
| 1068 | |
| 1069 | def _get_dna(STR): |
| 1070 | if STR is UNICODE: |
| 1071 | return _dna_unicode |
| 1072 | if STR is BYTES: |
| 1073 | return _dna_bytes |
| 1074 | raise AssertionError |
| 1075 | |
| 1076 | @bench('dna.count("AACT")', "count AACT substrings in DNA example", 10) |
| 1077 | def count_aact(STR): |
| 1078 | seq = _get_dna(STR) |
| 1079 | seq_count = seq.count |
| 1080 | needle = STR("AACT") |
| 1081 | for x in _RANGE_10: |
| 1082 | seq_count(needle) |
| 1083 | |
| 1084 | ##### startswith and endswith |
| 1085 | |
| 1086 | @bench('"Andrew".startswith("A")', 'startswith single character', 1000) |
| 1087 | def startswith_single(STR): |
| 1088 | s1 = STR("Andrew") |
| 1089 | s2 = STR("A") |
| 1090 | s1_startswith = s1.startswith |
| 1091 | for x in _RANGE_1000: |
| 1092 | s1_startswith(s2) |
| 1093 | |
| 1094 | @bench('"Andrew".startswith("Andrew")', 'startswith multiple characters', |
| 1095 | 1000) |
| 1096 | def startswith_multiple(STR): |
| 1097 | s1 = STR("Andrew") |
| 1098 | s2 = STR("Andrew") |
| 1099 | s1_startswith = s1.startswith |
| 1100 | for x in _RANGE_1000: |
| 1101 | s1_startswith(s2) |
| 1102 | |
| 1103 | @bench('"Andrew".startswith("Anders")', |
| 1104 | 'startswith multiple characters - not!', 1000) |
| 1105 | def startswith_multiple_not(STR): |
| 1106 | s1 = STR("Andrew") |
| 1107 | s2 = STR("Anders") |
| 1108 | s1_startswith = s1.startswith |
| 1109 | for x in _RANGE_1000: |
| 1110 | s1_startswith(s2) |
| 1111 | |
| 1112 | |
| 1113 | # endswith |
| 1114 | |
| 1115 | @bench('"Andrew".endswith("w")', 'endswith single character', 1000) |
| 1116 | def endswith_single(STR): |
| 1117 | s1 = STR("Andrew") |
| 1118 | s2 = STR("w") |
| 1119 | s1_endswith = s1.endswith |
| 1120 | for x in _RANGE_1000: |
| 1121 | s1_endswith(s2) |
| 1122 | |
| 1123 | @bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000) |
| 1124 | def endswith_multiple(STR): |
| 1125 | s1 = STR("Andrew") |
| 1126 | s2 = STR("Andrew") |
| 1127 | s1_endswith = s1.endswith |
| 1128 | for x in _RANGE_1000: |
| 1129 | s1_endswith(s2) |
| 1130 | |
| 1131 | @bench('"Andrew".endswith("Anders")', |
| 1132 | 'endswith multiple characters - not!', 1000) |
| 1133 | def endswith_multiple_not(STR): |
| 1134 | s1 = STR("Andrew") |
| 1135 | s2 = STR("Anders") |
| 1136 | s1_endswith = s1.endswith |
| 1137 | for x in _RANGE_1000: |
| 1138 | s1_endswith(s2) |
| 1139 | |
| 1140 | #### Strip |
| 1141 | |
| 1142 | @bench('"Hello!\\n".strip()', 'strip terminal newline', 1000) |
| 1143 | def terminal_newline_strip_right(STR): |
| 1144 | s = STR("Hello!\n") |
| 1145 | s_strip = s.strip |
| 1146 | for x in _RANGE_1000: |
| 1147 | s_strip() |
| 1148 | |
| 1149 | @bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000) |
| 1150 | def terminal_newline_rstrip(STR): |
| 1151 | s = STR("Hello!\n") |
| 1152 | s_rstrip = s.rstrip |
| 1153 | for x in _RANGE_1000: |
| 1154 | s_rstrip() |
| 1155 | |
| 1156 | @bench('"\\nHello!".strip()', 'strip terminal newline', 1000) |
| 1157 | def terminal_newline_strip_left(STR): |
| 1158 | s = STR("\nHello!") |
| 1159 | s_strip = s.strip |
| 1160 | for x in _RANGE_1000: |
| 1161 | s_strip() |
| 1162 | |
| 1163 | @bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000) |
| 1164 | def terminal_newline_strip_both(STR): |
| 1165 | s = STR("\nHello!\n") |
| 1166 | s_strip = s.strip |
| 1167 | for x in _RANGE_1000: |
| 1168 | s_strip() |
| 1169 | |
| 1170 | @bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000) |
| 1171 | def terminal_newline_lstrip(STR): |
| 1172 | s = STR("\nHello!") |
| 1173 | s_lstrip = s.lstrip |
| 1174 | for x in _RANGE_1000: |
| 1175 | s_lstrip() |
| 1176 | |
| 1177 | @bench('s="Hello!\\n"; s[:-1] if s[-1]=="\\n" else s', |
| 1178 | 'strip terminal newline', 1000) |
| 1179 | def terminal_newline_if_else(STR): |
| 1180 | s = STR("Hello!\n") |
| 1181 | NL = STR("\n") |
| 1182 | for x in _RANGE_1000: |
| 1183 | s[:-1] if (s[-1] == NL) else s |
| 1184 | |
| 1185 | |
| 1186 | # Strip multiple spaces or tabs |
| 1187 | |
| 1188 | @bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000) |
| 1189 | def terminal_space_strip(STR): |
| 1190 | s = STR("Hello\t \t!") |
| 1191 | s_strip = s.strip |
| 1192 | for x in _RANGE_1000: |
| 1193 | s_strip() |
| 1194 | |
| 1195 | @bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000) |
| 1196 | def terminal_space_rstrip(STR): |
| 1197 | s = STR("Hello!\t \t") |
| 1198 | s_rstrip = s.rstrip |
| 1199 | for x in _RANGE_1000: |
| 1200 | s_rstrip() |
| 1201 | |
| 1202 | @bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000) |
| 1203 | def terminal_space_lstrip(STR): |
| 1204 | s = STR("\t \tHello!") |
| 1205 | s_lstrip = s.lstrip |
| 1206 | for x in _RANGE_1000: |
| 1207 | s_lstrip() |
| 1208 | |
| 1209 | |
| 1210 | #### replace |
| 1211 | @bench('"This is a test".replace(" ", "\\t")', 'replace single character', |
| 1212 | 1000) |
| 1213 | def replace_single_character(STR): |
| 1214 | s = STR("This is a test!") |
| 1215 | from_str = STR(" ") |
| 1216 | to_str = STR("\t") |
| 1217 | s_replace = s.replace |
| 1218 | for x in _RANGE_1000: |
| 1219 | s_replace(from_str, to_str) |
| 1220 | |
| 1221 | @uses_re |
| 1222 | @bench('re.sub(" ", "\\t", "This is a test"', 'replace single character', |
| 1223 | 1000) |
| 1224 | def replace_single_character_re(STR): |
| 1225 | s = STR("This is a test!") |
| 1226 | pat = re.compile(STR(" ")) |
| 1227 | to_str = STR("\t") |
| 1228 | pat_sub = pat.sub |
| 1229 | for x in _RANGE_1000: |
| 1230 | pat_sub(to_str, s) |
| 1231 | |
| 1232 | @bench('"...text.with.2000.lines...replace("\\n", " ")', |
| 1233 | 'replace single character, big string', 10) |
| 1234 | def replace_single_character_big(STR): |
| 1235 | s = _get_2000_lines(STR) |
| 1236 | from_str = STR("\n") |
| 1237 | to_str = STR(" ") |
| 1238 | s_replace = s.replace |
| 1239 | for x in _RANGE_10: |
| 1240 | s_replace(from_str, to_str) |
| 1241 | |
| 1242 | @uses_re |
| 1243 | @bench('re.sub("\\n", " ", "...text.with.2000.lines...")', |
| 1244 | 'replace single character, big string', 10) |
| 1245 | def replace_single_character_big_re(STR): |
| 1246 | s = _get_2000_lines(STR) |
| 1247 | pat = re.compile(STR("\n")) |
| 1248 | to_str = STR(" ") |
| 1249 | pat_sub = pat.sub |
| 1250 | for x in _RANGE_10: |
| 1251 | pat_sub(to_str, s) |
| 1252 | |
| 1253 | |
| 1254 | @bench('dna.replace("ATC", "ATT")', |
| 1255 | 'replace multiple characters, dna', 10) |
| 1256 | def replace_multiple_characters_dna(STR): |
| 1257 | seq = _get_dna(STR) |
| 1258 | from_str = STR("ATC") |
| 1259 | to_str = STR("ATT") |
| 1260 | seq_replace = seq.replace |
| 1261 | for x in _RANGE_10: |
| 1262 | seq_replace(from_str, to_str) |
| 1263 | |
| 1264 | # This increases the character count |
| 1265 | @bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")', |
| 1266 | 'replace and expand multiple characters, big string', 10) |
| 1267 | def replace_multiple_character_big(STR): |
| 1268 | s = _get_2000_lines(STR) |
| 1269 | from_str = STR("\n") |
| 1270 | to_str = STR("\r\n") |
| 1271 | s_replace = s.replace |
| 1272 | for x in _RANGE_10: |
| 1273 | s_replace(from_str, to_str) |
| 1274 | |
| 1275 | |
| 1276 | # This decreases the character count |
| 1277 | @bench('"When shall we three meet again?".replace("ee", "")', |
| 1278 | 'replace/remove multiple characters', 1000) |
| 1279 | def replace_multiple_character_remove(STR): |
| 1280 | s = STR("When shall we three meet again?") |
| 1281 | from_str = STR("ee") |
| 1282 | to_str = STR("") |
| 1283 | s_replace = s.replace |
| 1284 | for x in _RANGE_1000: |
| 1285 | s_replace(from_str, to_str) |
| 1286 | |
| 1287 | |
| 1288 | big_s = "A" + ("Z"*128*1024) |
| 1289 | big_s_bytes = bytes_from_str(big_s) |
| 1290 | big_s_unicode = unicode_from_str(big_s) |
| 1291 | def _get_big_s(STR): |
| 1292 | if STR is UNICODE: return big_s_unicode |
| 1293 | if STR is BYTES: return big_s_bytes |
| 1294 | raise AssertionError |
| 1295 | |
| 1296 | # The older replace implementation counted all matches in |
| Ezio Melotti | 7c4a7e6 | 2013-08-26 01:32:56 +0300 | [diff] [blame] | 1297 | # the string even when it only needed to make one replacement. |
| Antoine Pitrou | 1584ae3 | 2012-04-09 17:03:32 +0200 | [diff] [blame] | 1298 | @bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)', |
| 1299 | 'quick replace single character match', 10) |
| 1300 | def quick_replace_single_match(STR): |
| 1301 | s = _get_big_s(STR) |
| 1302 | from_str = STR("A") |
| 1303 | to_str = STR("BB") |
| 1304 | s_replace = s.replace |
| 1305 | for x in _RANGE_10: |
| 1306 | s_replace(from_str, to_str, 1) |
| 1307 | |
| 1308 | @bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)', |
| 1309 | 'quick replace multiple character match', 10) |
| 1310 | def quick_replace_multiple_match(STR): |
| 1311 | s = _get_big_s(STR) |
| 1312 | from_str = STR("AZZ") |
| 1313 | to_str = STR("BBZZ") |
| 1314 | s_replace = s.replace |
| 1315 | for x in _RANGE_10: |
| 1316 | s_replace(from_str, to_str, 1) |
| 1317 | |
| 1318 | |
| 1319 | #### |
| 1320 | |
| 1321 | # CCP does a lot of this, for internationalisation of ingame messages. |
| 1322 | _format = "The %(thing)s is %(place)s the %(location)s." |
| 1323 | _format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", } |
| 1324 | _format_bytes = bytes_from_str(_format) |
| 1325 | _format_unicode = unicode_from_str(_format) |
| 1326 | _format_dict_bytes = dict((bytes_from_str(k), bytes_from_str(v)) for (k,v) in _format_dict.items()) |
| 1327 | _format_dict_unicode = dict((unicode_from_str(k), unicode_from_str(v)) for (k,v) in _format_dict.items()) |
| 1328 | |
| 1329 | def _get_format(STR): |
| 1330 | if STR is UNICODE: |
| 1331 | return _format_unicode |
| 1332 | if STR is BYTES: |
| 1333 | if sys.version_info >= (3,): |
| 1334 | raise UnsupportedType |
| 1335 | return _format_bytes |
| 1336 | raise AssertionError |
| 1337 | |
| 1338 | def _get_format_dict(STR): |
| 1339 | if STR is UNICODE: |
| 1340 | return _format_dict_unicode |
| 1341 | if STR is BYTES: |
| 1342 | if sys.version_info >= (3,): |
| 1343 | raise UnsupportedType |
| 1344 | return _format_dict_bytes |
| 1345 | raise AssertionError |
| 1346 | |
| 1347 | # Formatting. |
| 1348 | @bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}', |
| 1349 | 'formatting a string type with a dict', 1000) |
| 1350 | def format_with_dict(STR): |
| 1351 | s = _get_format(STR) |
| 1352 | d = _get_format_dict(STR) |
| 1353 | for x in _RANGE_1000: |
| 1354 | s % d |
| 1355 | |
| 1356 | |
| 1357 | #### Upper- and lower- case conversion |
| 1358 | |
| 1359 | @bench('("Where in the world is Carmen San Deigo?"*10).lower()', |
| 1360 | "case conversion -- rare", 1000) |
| 1361 | def lower_conversion_rare(STR): |
| 1362 | s = STR("Where in the world is Carmen San Deigo?"*10) |
| 1363 | s_lower = s.lower |
| 1364 | for x in _RANGE_1000: |
| 1365 | s_lower() |
| 1366 | |
| 1367 | @bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()', |
| 1368 | "case conversion -- dense", 1000) |
| 1369 | def lower_conversion_dense(STR): |
| 1370 | s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10) |
| 1371 | s_lower = s.lower |
| 1372 | for x in _RANGE_1000: |
| 1373 | s_lower() |
| 1374 | |
| 1375 | |
| 1376 | @bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()', |
| 1377 | "case conversion -- rare", 1000) |
| 1378 | def upper_conversion_rare(STR): |
| 1379 | s = STR("Where in the world is Carmen San Deigo?"*10) |
| 1380 | s_upper = s.upper |
| 1381 | for x in _RANGE_1000: |
| 1382 | s_upper() |
| 1383 | |
| 1384 | @bench('("where in the world is carmen san deigo?"*10).upper()', |
| 1385 | "case conversion -- dense", 1000) |
| 1386 | def upper_conversion_dense(STR): |
| 1387 | s = STR("where in the world is carmen san deigo?"*10) |
| 1388 | s_upper = s.upper |
| 1389 | for x in _RANGE_1000: |
| 1390 | s_upper() |
| 1391 | |
| 1392 | |
| 1393 | # end of benchmarks |
| 1394 | |
| 1395 | ################# |
| 1396 | |
| 1397 | class BenchTimer(timeit.Timer): |
| 1398 | def best(self, repeat=1): |
| 1399 | for i in range(1, 10): |
| 1400 | number = 10**i |
| 1401 | x = self.timeit(number) |
| 1402 | if x > 0.02: |
| 1403 | break |
| 1404 | times = [x] |
| 1405 | for i in range(1, repeat): |
| 1406 | times.append(self.timeit(number)) |
| 1407 | return min(times) / number |
| 1408 | |
| 1409 | def main(): |
| 1410 | (options, test_names) = parser.parse_args() |
| 1411 | if options.bytes_only and options.unicode_only: |
| 1412 | raise SystemExit("Only one of --8-bit and --unicode are allowed") |
| 1413 | |
| 1414 | bench_functions = [] |
| 1415 | for (k,v) in globals().items(): |
| 1416 | if hasattr(v, "is_bench"): |
| 1417 | if test_names: |
| 1418 | for name in test_names: |
| 1419 | if name in v.group: |
| 1420 | break |
| 1421 | else: |
| 1422 | # Not selected, ignore |
| 1423 | continue |
| 1424 | if options.skip_re and hasattr(v, "uses_re"): |
| 1425 | continue |
| 1426 | |
| 1427 | bench_functions.append( (v.group, k, v) ) |
| 1428 | bench_functions.sort() |
| 1429 | |
| 1430 | p("bytes\tunicode") |
| 1431 | p("(in ms)\t(in ms)\t%\tcomment") |
| 1432 | |
| 1433 | bytes_total = uni_total = 0.0 |
| 1434 | |
| 1435 | for title, group in itertools.groupby(bench_functions, |
| 1436 | operator.itemgetter(0)): |
| 1437 | # Flush buffer before each group |
| 1438 | sys.stdout.flush() |
| 1439 | p("="*10, title) |
| 1440 | for (_, k, v) in group: |
| 1441 | if hasattr(v, "is_bench"): |
| 1442 | bytes_time = 0.0 |
| 1443 | bytes_time_s = " - " |
| 1444 | if not options.unicode_only: |
| 1445 | try: |
| 1446 | bytes_time = BenchTimer("__main__.%s(__main__.BYTES)" % (k,), |
| 1447 | "import __main__").best(REPEAT) |
| 1448 | bytes_time_s = "%.2f" % (1000 * bytes_time) |
| 1449 | bytes_total += bytes_time |
| 1450 | except UnsupportedType: |
| 1451 | bytes_time_s = "N/A" |
| 1452 | uni_time = 0.0 |
| 1453 | uni_time_s = " - " |
| 1454 | if not options.bytes_only: |
| 1455 | try: |
| 1456 | uni_time = BenchTimer("__main__.%s(__main__.UNICODE)" % (k,), |
| 1457 | "import __main__").best(REPEAT) |
| 1458 | uni_time_s = "%.2f" % (1000 * uni_time) |
| 1459 | uni_total += uni_time |
| 1460 | except UnsupportedType: |
| 1461 | uni_time_s = "N/A" |
| 1462 | try: |
| 1463 | average = bytes_time/uni_time |
| 1464 | except (TypeError, ZeroDivisionError): |
| 1465 | average = 0.0 |
| 1466 | p("%s\t%s\t%.1f\t%s (*%d)" % ( |
| 1467 | bytes_time_s, uni_time_s, 100.*average, |
| 1468 | v.comment, v.repeat_count)) |
| 1469 | |
| 1470 | if bytes_total == uni_total == 0.0: |
| 1471 | p("That was zippy!") |
| 1472 | else: |
| 1473 | try: |
| 1474 | ratio = bytes_total/uni_total |
| 1475 | except ZeroDivisionError: |
| 1476 | ratio = 0.0 |
| 1477 | p("%.2f\t%.2f\t%.1f\t%s" % ( |
| 1478 | 1000*bytes_total, 1000*uni_total, 100.*ratio, |
| 1479 | "TOTAL")) |
| 1480 | |
| 1481 | if __name__ == "__main__": |
| 1482 | main() |